6 fam Millipore Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Millipore phosphoramidite conjugate 6 fam
    Phosphoramidite Conjugate 6 Fam, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite conjugate 6 fam/product/Millipore
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite conjugate 6 fam - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    85
    Millipore 6 fam 143d tamra
    6 Fam 143d Tamra, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam 143d tamra/product/Millipore
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam 143d tamra - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Millipore 6 fam labeled primer
    6 Fam Labeled Primer, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labeled primer/product/Millipore
    Average 88 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    6 fam labeled primer - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    88
    Millipore 6 fam label
    6 Fam Label, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam label/product/Millipore
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    6 fam label - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    91
    Millipore 6 fam bhq1 probe
    6 Fam Bhq1 Probe, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam bhq1 probe/product/Millipore
    Average 91 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    6 fam bhq1 probe - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    89
    Millipore 6 fam bhq 1 hydrolysis probe
    6 Fam Bhq 1 Hydrolysis Probe, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 40 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam bhq 1 hydrolysis probe/product/Millipore
    Average 89 stars, based on 40 article reviews
    Price from $9.99 to $1999.99
    6 fam bhq 1 hydrolysis probe - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    93
    Millipore 6 fam labelled oligonucleotides
    6 Fam Labelled Oligonucleotides, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labelled oligonucleotides/product/Millipore
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam labelled oligonucleotides - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Millipore 6 fam agacacaacttgtgactgccgcgg bhq 1
    6 Fam Agacacaacttgtgactgccgcgg Bhq 1, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam agacacaacttgtgactgccgcgg bhq 1/product/Millipore
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam agacacaacttgtgactgccgcgg bhq 1 - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    99
    Millipore 6 fam fluorescein molecules
    6 Fam Fluorescein Molecules, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescein molecules/product/Millipore
    Average 99 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescein molecules - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    91
    Millipore 5 6 fam atcag gaacatgtcccaacatgttg agctc 3
    5 6 Fam Atcag Gaacatgtcccaacatgttg Agctc 3, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam atcag gaacatgtcccaacatgttg agctc 3/product/Millipore
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    5 6 fam atcag gaacatgtcccaacatgttg agctc 3 - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    99
    Millipore 3 linker sequence 6 fam acgtccacgaggtaagcttccgagcga acgtccacgaggtaagcttccgagcga tamra phosphate
    3 Linker Sequence 6 Fam Acgtccacgaggtaagcttccgagcga Acgtccacgaggtaagcttccgagcga Tamra Phosphate, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3 linker sequence 6 fam acgtccacgaggtaagcttccgagcga acgtccacgaggtaagcttccgagcga tamra phosphate/product/Millipore
    Average 99 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    3 linker sequence 6 fam acgtccacgaggtaagcttccgagcga acgtccacgaggtaagcttccgagcga tamra phosphate - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    96
    Millipore 5 fluorescent 6 carboxyfluorescein 6 fam tag
    5 Fluorescent 6 Carboxyfluorescein 6 Fam Tag, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 fluorescent 6 carboxyfluorescein 6 fam tag/product/Millipore
    Average 96 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    5 fluorescent 6 carboxyfluorescein 6 fam tag - by Bioz Stars, 2020-08
    96/100 stars
      Buy from Supplier

    94
    Millipore 6 fam sc1 rna
    Arginine perturbations disrupt FMRP LCR <t>-sc1</t> <t>RNA</t> phase separation but do not notably affect FMRP LCR binding to sc-1 RNA. ( A ) Schematic illustration of the three constructs used. ( B ) Similar binding affinities for interactions between FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR with <t>6-FAM–labeled</t> sc1 RNA (25 nM) are shown using FP assayed in 25 mM Na 2 PO 4 , pH 7.4, 100 mM KCl, 2 mM DTT, 0.02 mg/mL E. coli tRNA, and 0.01% Nonidet P-40. Apparent dissociation constants ( k d,app ) from three experimental replicates. ( C ) Phase diagram of FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR at a constant protein concentration of 100 μM with increasing sc1 RNA concentrations in buffer containing 25 mM Na 2 PO 4 , pH 7.4, 30 mM KCl, and 2 mM DTT. Green circles represent an observation of droplet formation, and open circles represent no droplet formation detected. The dotted red line is a visual aid for a qualitative phase boundary of FMRP LCR. ( Right ) Representative DIC microscopy images of droplets for the addition of 2.5 μM of RNA in the conditions described. (Scale bar, 5 μm.) Phase-separation propensity is dramatically decreased for methylated and RtoK mutant proteins, with smaller droplet sizes observed.
    6 Fam Sc1 Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam sc1 rna/product/Millipore
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam sc1 rna - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Millipore control rna
    Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by <t>siRNA</t> <t>transfection</t> (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.
    Control Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 87 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/control rna/product/Millipore
    Average 93 stars, based on 87 article reviews
    Price from $9.99 to $1999.99
    control rna - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    93
    Millipore negative control sirna
    Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by <t>siRNA</t> <t>transfection</t> (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.
    Negative Control Sirna, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 725 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control sirna/product/Millipore
    Average 93 stars, based on 725 article reviews
    Price from $9.99 to $1999.99
    negative control sirna - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    99
    Millipore 6 fam se
    Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by <t>siRNA</t> <t>transfection</t> (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.
    6 Fam Se, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam se/product/Millipore
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    6 fam se - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    95
    Millipore 3 tamra quencher
    Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by <t>siRNA</t> <t>transfection</t> (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.
    3 Tamra Quencher, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3 tamra quencher/product/Millipore
    Average 95 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    3 tamra quencher - by Bioz Stars, 2020-08
    95/100 stars
      Buy from Supplier

    97
    Millipore chemicals 5 6 carboxyfluorescein
    Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by <t>siRNA</t> <t>transfection</t> (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.
    Chemicals 5 6 Carboxyfluorescein, supplied by Millipore, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chemicals 5 6 carboxyfluorescein/product/Millipore
    Average 97 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    chemicals 5 6 carboxyfluorescein - by Bioz Stars, 2020-08
    97/100 stars
      Buy from Supplier

    Image Search Results


    Arginine perturbations disrupt FMRP LCR -sc1 RNA phase separation but do not notably affect FMRP LCR binding to sc-1 RNA. ( A ) Schematic illustration of the three constructs used. ( B ) Similar binding affinities for interactions between FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR with 6-FAM–labeled sc1 RNA (25 nM) are shown using FP assayed in 25 mM Na 2 PO 4 , pH 7.4, 100 mM KCl, 2 mM DTT, 0.02 mg/mL E. coli tRNA, and 0.01% Nonidet P-40. Apparent dissociation constants ( k d,app ) from three experimental replicates. ( C ) Phase diagram of FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR at a constant protein concentration of 100 μM with increasing sc1 RNA concentrations in buffer containing 25 mM Na 2 PO 4 , pH 7.4, 30 mM KCl, and 2 mM DTT. Green circles represent an observation of droplet formation, and open circles represent no droplet formation detected. The dotted red line is a visual aid for a qualitative phase boundary of FMRP LCR. ( Right ) Representative DIC microscopy images of droplets for the addition of 2.5 μM of RNA in the conditions described. (Scale bar, 5 μm.) Phase-separation propensity is dramatically decreased for methylated and RtoK mutant proteins, with smaller droplet sizes observed.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Phosphoregulated FMRP phase separation models activity-dependent translation through bidirectional control of mRNA granule formation

    doi: 10.1073/pnas.1814385116

    Figure Lengend Snippet: Arginine perturbations disrupt FMRP LCR -sc1 RNA phase separation but do not notably affect FMRP LCR binding to sc-1 RNA. ( A ) Schematic illustration of the three constructs used. ( B ) Similar binding affinities for interactions between FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR with 6-FAM–labeled sc1 RNA (25 nM) are shown using FP assayed in 25 mM Na 2 PO 4 , pH 7.4, 100 mM KCl, 2 mM DTT, 0.02 mg/mL E. coli tRNA, and 0.01% Nonidet P-40. Apparent dissociation constants ( k d,app ) from three experimental replicates. ( C ) Phase diagram of FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR at a constant protein concentration of 100 μM with increasing sc1 RNA concentrations in buffer containing 25 mM Na 2 PO 4 , pH 7.4, 30 mM KCl, and 2 mM DTT. Green circles represent an observation of droplet formation, and open circles represent no droplet formation detected. The dotted red line is a visual aid for a qualitative phase boundary of FMRP LCR. ( Right ) Representative DIC microscopy images of droplets for the addition of 2.5 μM of RNA in the conditions described. (Scale bar, 5 μm.) Phase-separation propensity is dramatically decreased for methylated and RtoK mutant proteins, with smaller droplet sizes observed.

    Article Snippet: Sc1 RNA, 5′-labeled Cy3-sc1 RNA, 5′-labeled Cy3-miRNA-125b, and 5′-labeled 6-FAM-sc1 RNA were purchased from Sigma as lyophilized samples.

    Techniques: Binding Assay, Construct, Labeling, Protein Concentration, Microscopy, Methylation, Mutagenesis

    Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by siRNA transfection (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.

    Journal: Oncotarget

    Article Title: Comparative proteomic analysis of cat eye syndrome critical region protein 1- function in tumor-associated macrophages and immune response regulation of glial tumors

    doi: 10.18632/oncotarget.26063

    Figure Lengend Snippet: Schematic illustration of study design and workflow Human monocytic THP-1 cells were differentiated into macrophages (MQs) by PMA stimulation (100 ng/ml) for 48 hours followed by siRNA transfection (CECR1 targeting versus non-targeted scrambled siSham as transfection control, using two different siRNA and scrambled systems). Glioblastoma cell line U87 cells were co-cultured with THP-1 derived MQs with/without siCECR1 in a separate chamber with a 0.4-micron pore size filter to enable paracrine interaction between the two cell types. After 96 hours of incubation, cell lysates of were harvested and analyzed by nano-LC/MS. Raw data was imported into Scaffold 4 for processing and exported to Excel for further analysis.

    Article Snippet: In a second validation experiment, a mix of two siRNA sequences that target CECR1 mRNA (SASI_Hs01_00039762, SASI_Hs01_00096471), transfection reagent (MISSION® siRNA Transfection Reagent, S145) and a non-targeting siRNA (MISSION® siRNA Fluorescent Universal Negative Control, SIC007) were used (All Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Transfection, Cell Culture, Derivative Assay, Incubation, Liquid Chromatography with Mass Spectroscopy