6 fam Integrated Dna Technologies Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Integrated DNA Technologies mers genomic rna
    NHC potently inhibits <t>MERS-CoV</t> and newly emerging SARS-CoV-2 replication. (A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3 cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2 clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in A . Data are combined from 2 independent experiments. ( C) SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells. Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose response of NHC in triplicate per condition. 72 hours post infection, virus production was measured by plaque assay. (D) SARS-CoV-2 genomic <t>RNA</t> reduction (left) and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified supernatants from the study in panel C . Genome copy numbers were quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D , the symbol is at the mean and the error bars represent the standard deviation.
    Mers Genomic Rna, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 98/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mers genomic rna/product/Integrated DNA Technologies
    Average 98 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    mers genomic rna - by Bioz Stars, 2020-08
    98/100 stars
      Buy from Supplier

    94
    Integrated DNA Technologies 6 fam labels
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labels, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labels/product/Integrated DNA Technologies
    Average 94 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    6 fam labels - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    91
    Integrated DNA Technologies 6 fam fluorescent label
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Fluorescent Label, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescent label/product/Integrated DNA Technologies
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescent label - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    84
    Integrated DNA Technologies 6 fam labelled primers
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labelled Primers, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labelled primers/product/Integrated DNA Technologies
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam labelled primers - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    94
    Integrated DNA Technologies 6 fam fluorescent tag
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Fluorescent Tag, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescent tag/product/Integrated DNA Technologies
    Average 94 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescent tag - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    93
    Integrated DNA Technologies carboxyfluorescein 5 6 fam
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    Carboxyfluorescein 5 6 Fam, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/carboxyfluorescein 5 6 fam/product/Integrated DNA Technologies
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    carboxyfluorescein 5 6 fam - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    91
    Integrated DNA Technologies 6 fam labelled oligonucleotides
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labelled Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labelled oligonucleotides/product/Integrated DNA Technologies
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam labelled oligonucleotides - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    94
    Integrated DNA Technologies 6 fam labeled oligonucleotides
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labeled Oligonucleotides, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labeled oligonucleotides/product/Integrated DNA Technologies
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    6 fam labeled oligonucleotides - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    84
    Integrated DNA Technologies 6 fam labelled double stranded probes
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labelled Double Stranded Probes, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labelled double stranded probes/product/Integrated DNA Technologies
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam labelled double stranded probes - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    84
    Integrated DNA Technologies 6 fam labeled dna oligos
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    6 Fam Labeled Dna Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labeled dna oligos/product/Integrated DNA Technologies
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam labeled dna oligos - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    93
    Integrated DNA Technologies 5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    5 6 Fam Ccaccccac Zen Aagatttaaacaccatgctaa 3 Iabkfq, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq/product/Integrated DNA Technologies
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    5 6 fam ccaccccac zen aagatttaaacaccatgctaa 3 iabkfq - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    84
    Integrated DNA Technologies primetime 59 6 fam zen 39 ibfq taqman probes
    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with <t>6-FAM</t> at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.
    Primetime 59 6 Fam Zen 39 Ibfq Taqman Probes, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primetime 59 6 fam zen 39 ibfq taqman probes/product/Integrated DNA Technologies
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primetime 59 6 fam zen 39 ibfq taqman probes - by Bioz Stars, 2020-08
    84/100 stars
      Buy from Supplier

    91
    Integrated DNA Technologies rna substrates
    The CRISPR system of M. tuberculosis A. The CRISPR locus of M. tuberculosis includes genes encoding Cas6 (crRNA processing), Csm1-5 (type III-A interference complex), Csm6 (ancillary ribonuclease), Cas1 and Cas2 (Adaptation). Cas6 cleaves the CRISPR <t>RNA</t> at the base of a short hairpin to generate mature crRNA that is bound by the Csm complex. On target RNA binding, the Csm complex is expected to display three enzymatic activities: target RNA cleavage ( 1 ), <t>DNA</t> cleavage by the HD domain ( 2 ) and cOA production by the cyclase domain ( 3 ). B. Purified, recombinant CRISPR-associated proteins of M. tuberculosis . M: PageRuler Unstained (Thermo Scientific); 1: Csm1-5 interference complex; 2: Csm1-5, Csm1 D630A, D631A (Cy variant); 3: Csm1-5, Csm3 D35A (C3 variant); 4: Csm6; 5: Cas6.
    Rna Substrates, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 91/100, based on 46 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rna substrates/product/Integrated DNA Technologies
    Average 91 stars, based on 46 article reviews
    Price from $9.99 to $1999.99
    rna substrates - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results


    NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication. (A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3 cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2 clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in A . Data are combined from 2 independent experiments. ( C) SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells. Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose response of NHC in triplicate per condition. 72 hours post infection, virus production was measured by plaque assay. (D) SARS-CoV-2 genomic RNA reduction (left) and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified supernatants from the study in panel C . Genome copy numbers were quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D , the symbol is at the mean and the error bars represent the standard deviation.

    Journal: Science Translational Medicine

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    doi: 10.1126/scitranslmed.abb5883

    Figure Lengend Snippet: NHC potently inhibits MERS-CoV and newly emerging SARS-CoV-2 replication. (A) Percent inhibition of MERS-CoV replication and NHC cytotoxicity in Calu-3 cells. Calu-3 cells were infected in triplicate with MERS-CoV nanoluciferase (nLUC) at a multiplicity of infection (MOI) of 0.08 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of MERS-CoV–expressed nLUC. Cytotoxicity was measured in similarly treated but uninfected cultures via Cell-Titer-Glo assay. Data are combined from 3 independent experiments. (B) NHC antiviral activity and cytotoxicity in Vero E6 cells infected with SARS-CoV-2. Vero E6 cells were infected in duplicate with SARS-CoV-2 clinical isolate 2019-nCoV/USA-WA1/2020 virus at an MOI of 0.05 in the presence of a range of drug for 48 hours, after which replication was measured through quantitation of cell viability by Cell-Titer-Glo assay. Cytotoxicity was measured as in A . Data are combined from 2 independent experiments. ( C) SARS-CoV-2 titer reduction (left) and percent inhibition (right) in Calu-3 cells. Cells were infected with at an MOI of 0.1 for 30 min, washed and exposed to a dose response of NHC in triplicate per condition. 72 hours post infection, virus production was measured by plaque assay. (D) SARS-CoV-2 genomic RNA reduction (left) and percent inhibition (right) in Calu-3 cells. Viral RNA was isolated from clarified supernatants from the study in panel C . Genome copy numbers were quantitated by qRT-PCR with primer/probes targeting the N gene. For A-D , the symbol is at the mean and the error bars represent the standard deviation.

    Article Snippet: Previously published TaqMan primers were synthesized by Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward: 5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′- TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)( ). qRT-PCR was performed using 100ng total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) on a Quant Studio 3 (Applied Biosystems).

    Techniques: Inhibition, Infection, Quantitation Assay, Glo Assay, Activity Assay, Plaque Assay, Isolation, Quantitative RT-PCR, Standard Deviation

    NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary human airway epithelial cell cultures. (A) HAE were infected at an MOI of 0.5 with clinical isolate SARS-CoV-2 for 2 hours in the presence of NHC in duplicate after which virus was removed and cultures were washed in incubated in NHC for 48 hours when apical washes were collected for virus titration by plaque assay. The line is at the mean. Each symbol represents the titer from a single well. (B) HAE cells were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in triplicate and treated similarly to A . qRT-PCR for MERS-CoV ORF1 and ORFN mRNA. Total RNA was isolated from cultures in C for qRT-PCR analysis. Representative data from three separate experiments with three different cell donors are displayed. PFU, plaque-forming units. (C) Studies performed as in A but with SARS-CoV green fluorescent protein (GFP). Representative data from two separate experiments with two different cell donors are displayed. Each symbol represents the data from one HAE culture, the line is at the mean and the error bars represent the standard deviation.

    Journal: Science Translational Medicine

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    doi: 10.1126/scitranslmed.abb5883

    Figure Lengend Snippet: NHC is highly active against SARS-CoV-2, MERS-CoV, and SARS-CoV in primary human airway epithelial cell cultures. (A) HAE were infected at an MOI of 0.5 with clinical isolate SARS-CoV-2 for 2 hours in the presence of NHC in duplicate after which virus was removed and cultures were washed in incubated in NHC for 48 hours when apical washes were collected for virus titration by plaque assay. The line is at the mean. Each symbol represents the titer from a single well. (B) HAE cells were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in triplicate and treated similarly to A . qRT-PCR for MERS-CoV ORF1 and ORFN mRNA. Total RNA was isolated from cultures in C for qRT-PCR analysis. Representative data from three separate experiments with three different cell donors are displayed. PFU, plaque-forming units. (C) Studies performed as in A but with SARS-CoV green fluorescent protein (GFP). Representative data from two separate experiments with two different cell donors are displayed. Each symbol represents the data from one HAE culture, the line is at the mean and the error bars represent the standard deviation.

    Article Snippet: Previously published TaqMan primers were synthesized by Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward: 5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′- TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)( ). qRT-PCR was performed using 100ng total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) on a Quant Studio 3 (Applied Biosystems).

    Techniques: Infection, Incubation, Titration, Plaque Assay, Quantitative RT-PCR, Isolation, Standard Deviation

    Remdesivir (RDV) resistance mutations in the highly conserved RNA-dependent RNA polymerase increase susceptibility to NHC. (A) Neighbor-joining trees created with representatives from all four CoV genogroups showing the genetic similarity of CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry into cells. Text color of the virus strain label corresponds to virus host species on the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV, or MERS-CoV. (B) The variation encompassed in panel A was modeled onto the RdRp structure of the SARS-CoV RdRp. (C) Amino acid sequence of CoV in panel A at known resistance alleles to antiviral drug RDV. (D) Virus titer reduction assay in DBT cells across a range of NHC with recombinant MHV bearing resistance mutations to RDV. Data shown are combined from three independent experiments performed with biological duplicates or triplicates per condition. Asterisks indicate statistically significant differences by Mann-Whitney test as indicated on the graph.

    Journal: Science Translational Medicine

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    doi: 10.1126/scitranslmed.abb5883

    Figure Lengend Snippet: Remdesivir (RDV) resistance mutations in the highly conserved RNA-dependent RNA polymerase increase susceptibility to NHC. (A) Neighbor-joining trees created with representatives from all four CoV genogroups showing the genetic similarity of CoV nsp12 (RdRp) and CoV spike glycoprotein, which mediates host tropism and entry into cells. Text color of the virus strain label corresponds to virus host species on the left. The heatmap adjacent to each neighbor-joining tree depicts percent amino acid identity (% A.A. similarity) against mouse hepatitis virus (MHV), SARS-CoV, or MERS-CoV. (B) The variation encompassed in panel A was modeled onto the RdRp structure of the SARS-CoV RdRp. (C) Amino acid sequence of CoV in panel A at known resistance alleles to antiviral drug RDV. (D) Virus titer reduction assay in DBT cells across a range of NHC with recombinant MHV bearing resistance mutations to RDV. Data shown are combined from three independent experiments performed with biological duplicates or triplicates per condition. Asterisks indicate statistically significant differences by Mann-Whitney test as indicated on the graph.

    Article Snippet: Previously published TaqMan primers were synthesized by Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward: 5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′- TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)( ). qRT-PCR was performed using 100ng total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) on a Quant Studio 3 (Applied Biosystems).

    Techniques: Sequencing, Recombinant, MANN-WHITNEY

    NHC is effective against multiple genetically distinct Bat-CoV. Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group 2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5 in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Mock, mock-treated. Representative data from two separate experiments with two different cell donors are displayed.

    Journal: Science Translational Medicine

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    doi: 10.1126/scitranslmed.abb5883

    Figure Lengend Snippet: NHC is effective against multiple genetically distinct Bat-CoV. Top: Antiviral efficacy of NHC in HAE cells against SARS-like (HKU3, SHC014, group 2b) and MERS-like (HKU5, group 2c) bat-CoV. HAE cells were infected at an MOI of 0.5 in the presence of NHC in duplicate. After 48 hours, virus produced was titrated via plaque assay. Each data point represents the titer per culture. Bottom: qRT-PCR for CoV ORF1 and ORFN mRNA in total RNA from cultures in the top panel. Mock, mock-treated. Representative data from two separate experiments with two different cell donors are displayed.

    Article Snippet: Previously published TaqMan primers were synthesized by Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward: 5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′- TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)( ). qRT-PCR was performed using 100ng total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) on a Quant Studio 3 (Applied Biosystems).

    Techniques: Infection, Produced, Plaque Assay, Quantitative RT-PCR

    Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and pathogenesis coincident with increased viral mutation rates . Equivalent numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at -2 hours, +12, +24 or +48 hours post infection and every 12 hours thereafter by oral gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted MERS-CoV M35C4 strain. ( A) Percent starting weight. Asterisks indicate differences between -2 hours and +12 hours group from vehicle by two-way ANOVA with Tukey’s multiple comparison test. ( B) Lung hemorrhage in mice from panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in mice from panel A as determined by plaque assay. Asterisks in both panel B and C indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. (D) MERS-CoV genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA with a Dunnett’s multiple comparison test. (E) Pulmonary function by whole body plethysmography was performed daily on four animals per group. Asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (F) Workflow to measure mutation rate in MERS-CoV RNA and host transcript ISG15 by Primer ID in mouse lung tissue. (G) Number of template consensus sequences (TCS) for MERS-CoV nsp10 and ISG15. (H) Total error rate in MERS-CoV nsp10 and ISG15. (I) The cytosine to uridine transition rate in MERS-CoV nsp10 and ISG15. In panels G-I, asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (J) Codon change frequency in MERS-CoV nsp10. Asterisks indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. For all panels, the boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range.

    Journal: Science Translational Medicine

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    doi: 10.1126/scitranslmed.abb5883

    Figure Lengend Snippet: Prophylactic and therapeutic EIDD-2801 reduces MERS-CoV replication and pathogenesis coincident with increased viral mutation rates . Equivalent numbers of 10-14 week old male and female C57BL/6 hDPP4 mice were administered vehicle (10% PEG, 2.5% Cremophor RH40 in water) or NHC prodrug EIDD-2801 beginning at -2 hours, +12, +24 or +48 hours post infection and every 12 hours thereafter by oral gavage (n = 10/group). Mice were intranasally infected with 5E+04 PFU mouse-adapted MERS-CoV M35C4 strain. ( A) Percent starting weight. Asterisks indicate differences between -2 hours and +12 hours group from vehicle by two-way ANOVA with Tukey’s multiple comparison test. ( B) Lung hemorrhage in mice from panel A scored on a scale of 0-4 where 0 is a normal pink healthy lung and 4 is a diffusely discolored dark red lung. (C) Virus lung titer in mice from panel A as determined by plaque assay. Asterisks in both panel B and C indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. (D) MERS-CoV genomic RNA in lung tissue by qRT-PCR. Asterisks indicate differences by one-way ANOVA with a Dunnett’s multiple comparison test. (E) Pulmonary function by whole body plethysmography was performed daily on four animals per group. Asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (F) Workflow to measure mutation rate in MERS-CoV RNA and host transcript ISG15 by Primer ID in mouse lung tissue. (G) Number of template consensus sequences (TCS) for MERS-CoV nsp10 and ISG15. (H) Total error rate in MERS-CoV nsp10 and ISG15. (I) The cytosine to uridine transition rate in MERS-CoV nsp10 and ISG15. In panels G-I, asterisks indicate differences from vehicle by two-way ANOVA with Tukey’s multiple comparison test. (J) Codon change frequency in MERS-CoV nsp10. Asterisks indicate differences from vehicle by Kruskal-Wallis with Dunn’s multiple comparison test. For all panels, the boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range.

    Article Snippet: Previously published TaqMan primers were synthesized by Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward: 5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′- TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)( ). qRT-PCR was performed using 100ng total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) on a Quant Studio 3 (Applied Biosystems).

    Techniques: Mutagenesis, Mouse Assay, Infection, Plaque Assay, Quantitative RT-PCR

    NHC antiviral activity is associated with increased viral mutation rates . ( A ) HAE cultures were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle, RDV, or NHC for 48 hours, after which apical washes were collected for virus titration. Data are combined from two independent studies. The boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range. (B) Schematic of Primer ID deep sequencing for single RNA genomes of MERS-CoV. (C) The total error rate for MERS-CoV RNA isolated from cultures in panel A as determined by Primer ID. Error rate values are # mutations per 10,000 bases. Asterisks indicate significant differences as compared to untreated group by two-way ANOVA with a Dunnett’s multiple comparison test. (D) Description of potential NHC mutational spectra on both positive and negative sense viral RNA. (E) Nucleotide transitions in cDNA derived from MERS-CoV genomic RNA.

    Journal: Science Translational Medicine

    Article Title: An orally bioavailable broad-spectrum antiviral inhibits SARS-CoV-2 in human airway epithelial cell cultures and multiple coronaviruses in mice

    doi: 10.1126/scitranslmed.abb5883

    Figure Lengend Snippet: NHC antiviral activity is associated with increased viral mutation rates . ( A ) HAE cultures were infected with MERS-CoV red fluorescent protein (RFP) at an MOI of 0.5 in duplicate in the presence of vehicle, RDV, or NHC for 48 hours, after which apical washes were collected for virus titration. Data are combined from two independent studies. The boxes encompass the 25th to 75th percentile, the line is at the median, while the whiskers represent the range. (B) Schematic of Primer ID deep sequencing for single RNA genomes of MERS-CoV. (C) The total error rate for MERS-CoV RNA isolated from cultures in panel A as determined by Primer ID. Error rate values are # mutations per 10,000 bases. Asterisks indicate significant differences as compared to untreated group by two-way ANOVA with a Dunnett’s multiple comparison test. (D) Description of potential NHC mutational spectra on both positive and negative sense viral RNA. (E) Nucleotide transitions in cDNA derived from MERS-CoV genomic RNA.

    Article Snippet: Previously published TaqMan primers were synthesized by Integrated DNA Technologies (IDT) to quantify MERS genomic RNA (targeting orf1a: Forward: 5′- GCACATCTGTGGTTCTCCTCTCT-3′, Probe (6-FAM/ZEN/IBFQ): 5′- TGCTCCAACAGTTACAC-3′, Reverse: 5′-AAGCCCAGGCCCTACTATTAGC)( ). qRT-PCR was performed using 100ng total RNA compared to an RNA standard curve using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher) on a Quant Studio 3 (Applied Biosystems).

    Techniques: Activity Assay, Mutagenesis, Infection, Titration, Sequencing, Isolation, Derivative Assay

    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Article Snippet: Electrophoretic mobility shift assaySingle-stranded DNA constructs (Supplementary Table S1) with or without 6-FAM labels were purchased from Integrated DNA Technologies, Inc (IDT) and gel purified to remove truncated DNA fragments.

    Techniques: Translocation Assay, Incubation, Polyacrylamide Gel Electrophoresis

    Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Article Snippet: Electrophoretic mobility shift assaySingle-stranded DNA constructs (Supplementary Table S1) with or without 6-FAM labels were purchased from Integrated DNA Technologies, Inc (IDT) and gel purified to remove truncated DNA fragments.

    Techniques: Sequencing, Incubation, Concentration Assay, Fluorescence

    Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Article Snippet: Electrophoretic mobility shift assaySingle-stranded DNA constructs (Supplementary Table S1) with or without 6-FAM labels were purchased from Integrated DNA Technologies, Inc (IDT) and gel purified to remove truncated DNA fragments.

    Techniques: Translocation Assay, Incubation, Concentration Assay, Polyacrylamide Gel Electrophoresis

    Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Stalling the translocation of helicase motor stimulates cleavage (A) Schematic representation of target DNA (100 bp) with PAM (TTC in red) end-labelled with 6-FAM at 5’ end of the non-target strand and biotinylated at 12 th nucleotide (Target I). A similar target DNA without biotin (Target II) is also represented. Indicated in red arrow are the prominent cleavage sites. (B) Target (I) (II) were incubated with streptavidin and Cascade/I-C to form interference complex. Cleavage was initiated by addition of Cas3 (0.2 and 0.5 μM) and 1 mM ATP/ADP/AMP-PNP. Prominent cleavages of the target (I) and (II) are indicated by a red arrow (approx. 60 nt and 40 nt). A 20% denaturing PAGE was used to assess the cleavage.

    Article Snippet: 6-FAM labelled oligonucleotides were obtained from IDT.

    Techniques: Translocation Assay, Incubation, Polyacrylamide Gel Electrophoresis

    Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Cascade and Cas3 form a stable complex during interference. (A) Schematic representation of 100 bp DNA substrates with biotin (black dot) at 5’ end of the nontarget strand (NTS), 6-FAM (fluorophore, green star) at 5 th nucleotide, Iowa Black ® FQ (quencher, brown dot) at 28 th nucleotide on target strand (TS) and PAM sequence TTC (depicted in red colour). (B) Substrate mentioned above was incubated with or without Cascade/I-C (1 μM) and increasing concentration of Cas3/I-C (0-5 μM). A significant decline in fluorescence intensity is evident when both Cascade/I-C and Cas3/I-C were present. There was no apparent quenching when dsDNA and ssDNA were used in the absence of Cascade/I-C (C) Fluorescence quenching was observed in the presence of ATP but not when ADP and AMP-PNP were used.

    Article Snippet: 6-FAM labelled oligonucleotides were obtained from IDT.

    Techniques: Sequencing, Incubation, Concentration Assay, Fluorescence

    Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Journal: bioRxiv

    Article Title: Cas3 Mediated Target DNA Recognition and Cleavage is Independent of the Composition and Architecture of Cascade Surveillance Complex

    doi: 10.1101/666776

    Figure Lengend Snippet: Roadblock in the translocation of Cas3/I-C stimulates cleavage (A) (D) A schematic representation of 60 nt 5’ 6-FAM labelled ssDNA with biotin at 12 th (Target A) and 20th nucleotide (Target B), respectively. (B) (E) ssDNA mentioned above was incubated with 200 nM of Cas3/I-C for several time points and anisotropy measurements were recorded. With time, the decrease in anisotropy values was observed for ssDNA with a biotin roadblock. (C) (F) ssDNA was pre-incubated with streptavidin before the addition of Cas3/I-C. Prominent DNA cleavage products were observed in the presence of ATP at ~40 nt in target A and ~50 nt in target B, indicated with a red arrow. In the presence of AMP-PNP higher Cas3 concentration was required for the cleavage. A 20% denaturing PAGE was used to study the cleavage pattern.

    Article Snippet: 6-FAM labelled oligonucleotides were obtained from IDT.

    Techniques: Translocation Assay, Incubation, Concentration Assay, Polyacrylamide Gel Electrophoresis

    The CRISPR system of M. tuberculosis A. The CRISPR locus of M. tuberculosis includes genes encoding Cas6 (crRNA processing), Csm1-5 (type III-A interference complex), Csm6 (ancillary ribonuclease), Cas1 and Cas2 (Adaptation). Cas6 cleaves the CRISPR RNA at the base of a short hairpin to generate mature crRNA that is bound by the Csm complex. On target RNA binding, the Csm complex is expected to display three enzymatic activities: target RNA cleavage ( 1 ), DNA cleavage by the HD domain ( 2 ) and cOA production by the cyclase domain ( 3 ). B. Purified, recombinant CRISPR-associated proteins of M. tuberculosis . M: PageRuler Unstained (Thermo Scientific); 1: Csm1-5 interference complex; 2: Csm1-5, Csm1 D630A, D631A (Cy variant); 3: Csm1-5, Csm3 D35A (C3 variant); 4: Csm6; 5: Cas6.

    Journal: bioRxiv

    Article Title: Cyclic oligoadenylate signalling mediates Mycobacterium tuberculosis CRISPR defence

    doi: 10.1101/667758

    Figure Lengend Snippet: The CRISPR system of M. tuberculosis A. The CRISPR locus of M. tuberculosis includes genes encoding Cas6 (crRNA processing), Csm1-5 (type III-A interference complex), Csm6 (ancillary ribonuclease), Cas1 and Cas2 (Adaptation). Cas6 cleaves the CRISPR RNA at the base of a short hairpin to generate mature crRNA that is bound by the Csm complex. On target RNA binding, the Csm complex is expected to display three enzymatic activities: target RNA cleavage ( 1 ), DNA cleavage by the HD domain ( 2 ) and cOA production by the cyclase domain ( 3 ). B. Purified, recombinant CRISPR-associated proteins of M. tuberculosis . M: PageRuler Unstained (Thermo Scientific); 1: Csm1-5 interference complex; 2: Csm1-5, Csm1 D630A, D631A (Cy variant); 3: Csm1-5, Csm3 D35A (C3 variant); 4: Csm6; 5: Cas6.

    Article Snippet: Oligonucleotides All RNA and DNA oligonucleotides as well as 6-FAM™-labeled RNA substrates were purchased from Integrated DNA Technologies (Leuven, BE).

    Techniques: CRISPR, RNA Binding Assay, Purification, Recombinant, Variant Assay

    The Cas6 ribonuclease cleaves the Mtb CRISPR repeat sequence to generate crRNA. ( A ) Cas6 (0.5 µM) was incubated with 50 nM 5’-FAM CRISPR repeat RNA at 37 °C for 5, 15, 45 min in 20 mM Tris, 100 mM potassium glutamate, pH 7.5 in the absence or presence of 5 mM divalent metal ions as indicated. Reactions were stopped by phenol-chloroform extraction. ( B ) Cas6 cleavage leaves a 3’-(cyclic) phosphate group. CRISPR repeat RNA (crRepeat, 5’-FAM labeled, 400 nM) was digested with 2 µM Cas6 for 1 h in the presence of Mg 2+ using the same reaction conditions as before. Phenol-chloroform followed by chloroform extraction provided the substrate for the E. coli Poly(A) polymerase (PAP, New England Biolabs) reaction. Polyadenylation was performed according to the manufacturer’s instructions. In a parallel experiment, Cas6 was omitted. The CRISPR repeat RNA but not the Cas6 product can be 3’-polyadenylated by PAP. This suggests that the reaction product has a cyclic 2’,3’-phosphate, as observed for other Cas6 enzymes. This observation, together with the observation that calcium supports enhanced cleavage of the CRISPR repeat, suggests that the metal ion does not participate directly in catalysis but rather plays a role in stabilisation of the RNA substrate or RNA:protein complex.

    Journal: bioRxiv

    Article Title: Cyclic oligoadenylate signalling mediates Mycobacterium tuberculosis CRISPR defence

    doi: 10.1101/667758

    Figure Lengend Snippet: The Cas6 ribonuclease cleaves the Mtb CRISPR repeat sequence to generate crRNA. ( A ) Cas6 (0.5 µM) was incubated with 50 nM 5’-FAM CRISPR repeat RNA at 37 °C for 5, 15, 45 min in 20 mM Tris, 100 mM potassium glutamate, pH 7.5 in the absence or presence of 5 mM divalent metal ions as indicated. Reactions were stopped by phenol-chloroform extraction. ( B ) Cas6 cleavage leaves a 3’-(cyclic) phosphate group. CRISPR repeat RNA (crRepeat, 5’-FAM labeled, 400 nM) was digested with 2 µM Cas6 for 1 h in the presence of Mg 2+ using the same reaction conditions as before. Phenol-chloroform followed by chloroform extraction provided the substrate for the E. coli Poly(A) polymerase (PAP, New England Biolabs) reaction. Polyadenylation was performed according to the manufacturer’s instructions. In a parallel experiment, Cas6 was omitted. The CRISPR repeat RNA but not the Cas6 product can be 3’-polyadenylated by PAP. This suggests that the reaction product has a cyclic 2’,3’-phosphate, as observed for other Cas6 enzymes. This observation, together with the observation that calcium supports enhanced cleavage of the CRISPR repeat, suggests that the metal ion does not participate directly in catalysis but rather plays a role in stabilisation of the RNA substrate or RNA:protein complex.

    Article Snippet: Oligonucleotides All RNA and DNA oligonucleotides as well as 6-FAM™-labeled RNA substrates were purchased from Integrated DNA Technologies (Leuven, BE).

    Techniques: CRISPR, Sequencing, Incubation, Labeling