6 fam Integrated Dna Technologies Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Integrated DNA Technologies 5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide
    5 6 Fam Agatcggaagagcgtcgtgtagg Gaaagag 3 Dna Oligonucleotide, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide/product/Integrated DNA Technologies
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    5 6 fam agatcggaagagcgtcgtgtagg gaaagag 3 dna oligonucleotide - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    Image Search Results