6 fam Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Qiagen taq polymerase
    Taq Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 4729 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Qiagen
    Average 96 stars, based on 4729 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2020-01
    96/100 stars
      Buy from Supplier

    83
    Jena Bioscience 6 fam dc puromycin
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Dc Puromycin, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 83/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam dc puromycin/product/Jena Bioscience
    Average 83 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    6 fam dc puromycin - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    80
    Thermo Fisher 6 fam phosphoramidite dye
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Phosphoramidite Dye, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam phosphoramidite dye/product/Thermo Fisher
    Average 80 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    6 fam phosphoramidite dye - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    83
    Thermo Fisher fluorochrome 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    Fluorochrome 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorochrome 6 fam/product/Thermo Fisher
    Average 83 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    fluorochrome 6 fam - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    88
    Sigma-Genosys phosphoramidite 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    Phosphoramidite 6 Fam, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 88/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite 6 fam/product/Sigma-Genosys
    Average 88 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite 6 fam - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    75
    MWG-Biotech 6 fam fluorochrome
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Fluorochrome, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 75/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorochrome/product/MWG-Biotech
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorochrome - by Bioz Stars, 2020-01
    75/100 stars
      Buy from Supplier

    75
    Eurofins phosphoramidite conjugate 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    Phosphoramidite Conjugate 6 Fam, supplied by Eurofins, used in various techniques. Bioz Stars score: 75/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite conjugate 6 fam/product/Eurofins
    Average 75 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite conjugate 6 fam - by Bioz Stars, 2020-01
    75/100 stars
      Buy from Supplier

    76
    Sigma-Genosys 6 fam tcaagtggcgctggaacctc tamra
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Tcaagtggcgctggaacctc Tamra, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam tcaagtggcgctggaacctc tamra/product/Sigma-Genosys
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam tcaagtggcgctggaacctc tamra - by Bioz Stars, 2020-01
    76/100 stars
      Buy from Supplier

    79
    Thermo Fisher taqman probe 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    Taqman Probe 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman probe 6 fam/product/Thermo Fisher
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    taqman probe 6 fam - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    87
    Eurofins 6 fam fluorescence modification
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Fluorescence Modification, supplied by Eurofins, used in various techniques. Bioz Stars score: 87/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescence modification/product/Eurofins
    Average 87 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescence modification - by Bioz Stars, 2020-01
    87/100 stars
      Buy from Supplier

    93
    Thermo Fisher dyes 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    Dyes 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dyes 6 fam/product/Thermo Fisher
    Average 93 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    dyes 6 fam - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    78
    Thermo Fisher fluorescent dye 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    Fluorescent Dye 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescent dye 6 fam/product/Thermo Fisher
    Average 78 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    fluorescent dye 6 fam - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    89
    Millipore 6 fam fluorescein molecules
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Fluorescein Molecules, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescein molecules/product/Millipore
    Average 89 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescein molecules - by Bioz Stars, 2020-01
    89/100 stars
      Buy from Supplier

    77
    Bio-Serv 6 fam hex fluorescent dye
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Hex Fluorescent Dye, supplied by Bio-Serv, used in various techniques. Bioz Stars score: 77/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam hex fluorescent dye/product/Bio-Serv
    Average 77 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    6 fam hex fluorescent dye - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    79
    Thermo Fisher 6 fam aaaggccttgtggtactg mgb
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Aaaggccttgtggtactg Mgb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam aaaggccttgtggtactg mgb/product/Thermo Fisher
    Average 79 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    6 fam aaaggccttgtggtactg mgb - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    84
    Millipore 6 fam labeled primer
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Labeled Primer, supplied by Millipore, used in various techniques. Bioz Stars score: 84/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labeled primer/product/Millipore
    Average 84 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    6 fam labeled primer - by Bioz Stars, 2020-01
    84/100 stars
      Buy from Supplier

    79
    Metabion International AG 6 carboxy fluorescein 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Carboxy Fluorescein 6 Fam, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 carboxy fluorescein 6 fam/product/Metabion International AG
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    6 carboxy fluorescein 6 fam - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    79
    Thermo Fisher 6 fam cctggtcgctgtgca mgb nfq
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Cctggtcgctgtgca Mgb Nfq, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam cctggtcgctgtgca mgb nfq/product/Thermo Fisher
    Average 79 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    6 fam cctggtcgctgtgca mgb nfq - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    91
    Genomed GmbH 6 fam pst i aca primer
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    6 Fam Pst I Aca Primer, supplied by Genomed GmbH, used in various techniques. Bioz Stars score: 91/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam pst i aca primer/product/Genomed GmbH
    Average 91 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    6 fam pst i aca primer - by Bioz Stars, 2020-01
    91/100 stars
      Buy from Supplier

    78
    Glen Research 5 fluorescein phosphoramidite 6 fam
    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with <t>6-FAM-dc-puromycin</t> for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p
    5 Fluorescein Phosphoramidite 6 Fam, supplied by Glen Research, used in various techniques. Bioz Stars score: 78/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 fluorescein phosphoramidite 6 fam/product/Glen Research
    Average 78 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    5 fluorescein phosphoramidite 6 fam - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    76
    Millipore 6 fam sc1 rna
    Arginine perturbations disrupt FMRP LCR <t>-sc1</t> <t>RNA</t> phase separation but do not notably affect FMRP LCR binding to sc-1 RNA. ( A ) Schematic illustration of the three constructs used. ( B ) Similar binding affinities for interactions between FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR with <t>6-FAM–labeled</t> sc1 RNA (25 nM) are shown using FP assayed in 25 mM Na 2 PO 4 , pH 7.4, 100 mM KCl, 2 mM DTT, 0.02 mg/mL E. coli tRNA, and 0.01% Nonidet P-40. Apparent dissociation constants ( k d,app ) from three experimental replicates. ( C ) Phase diagram of FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR at a constant protein concentration of 100 μM with increasing sc1 RNA concentrations in buffer containing 25 mM Na 2 PO 4 , pH 7.4, 30 mM KCl, and 2 mM DTT. Green circles represent an observation of droplet formation, and open circles represent no droplet formation detected. The dotted red line is a visual aid for a qualitative phase boundary of FMRP LCR. ( Right ) Representative DIC microscopy images of droplets for the addition of 2.5 μM of RNA in the conditions described. (Scale bar, 5 μm.) Phase-separation propensity is dramatically decreased for methylated and RtoK mutant proteins, with smaller droplet sizes observed.
    6 Fam Sc1 Rna, supplied by Millipore, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam sc1 rna/product/Millipore
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam sc1 rna - by Bioz Stars, 2020-01
    76/100 stars
      Buy from Supplier

    80
    biomers.net 6 fam hsa mir 5p
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    6 Fam Hsa Mir 5p, supplied by biomers.net, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam hsa mir 5p/product/biomers.net
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    6 fam hsa mir 5p - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    80
    Thermo Fisher 5 6 fam se
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    5 6 Fam Se, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5 6 fam se/product/Thermo Fisher
    Average 80 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    5 6 fam se - by Bioz Stars, 2020-01
    80/100 stars
      Buy from Supplier

    70
    Thermo Fisher primer c 1360
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    Primer C 1360, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 70/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer c 1360/product/Thermo Fisher
    Average 70 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    primer c 1360 - by Bioz Stars, 2020-01
    70/100 stars
      Buy from Supplier

    88
    Thermo Fisher 6fam tamra
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    6fam Tamra, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6fam tamra/product/Thermo Fisher
    Average 88 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    6fam tamra - by Bioz Stars, 2020-01
    88/100 stars
      Buy from Supplier

    86
    LGC Biosearch 6 fam bhq1 labeled probe 5
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    6 Fam Bhq1 Labeled Probe 5, supplied by LGC Biosearch, used in various techniques. Bioz Stars score: 86/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam bhq1 labeled probe 5/product/LGC Biosearch
    Average 86 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    6 fam bhq1 labeled probe 5 - by Bioz Stars, 2020-01
    86/100 stars
      Buy from Supplier

    77
    Sangon Biotech fluorescent 6 fam labeled oligonucleotides
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    Fluorescent 6 Fam Labeled Oligonucleotides, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 77/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorescent 6 fam labeled oligonucleotides/product/Sangon Biotech
    Average 77 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    fluorescent 6 fam labeled oligonucleotides - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    79
    Thermo Fisher probe 6 fam agccgcgaggacc 3 mgb
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    Probe 6 Fam Agccgcgaggacc 3 Mgb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/probe 6 fam agccgcgaggacc 3 mgb/product/Thermo Fisher
    Average 79 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    probe 6 fam agccgcgaggacc 3 mgb - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    79
    Millipore 6 fam bhq 1 hydrolysis probe
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    6 Fam Bhq 1 Hydrolysis Probe, supplied by Millipore, used in various techniques. Bioz Stars score: 79/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam bhq 1 hydrolysis probe/product/Millipore
    Average 79 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    6 fam bhq 1 hydrolysis probe - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    77
    Millipore 6 fam se
    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with <t>6-FAM-hsa-miR-5p.</t>
    6 Fam Se, supplied by Millipore, used in various techniques. Bioz Stars score: 77/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam se/product/Millipore
    Average 77 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    6 fam se - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    Image Search Results


    JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with 6-FAM-dc-puromycin for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p

    Journal: Nature cell biology

    Article Title: HSF1 critically attunes proteotoxic-stress sensing by mTORC1 to combat stress and promote growth

    doi: 10.1038/ncb3335

    Figure Lengend Snippet: JNK negatively regulates mTORC1, translation, and cell size ( a ) HEK293T cells were stably transduced with lentiviral scramble or two combinations of JNK1/2 -targeting shRNAs, A (shJNK1_2 and shJNK2_1) and B (shJNK1_4 and shJNK2_2). Transduced cells were treated with DMSO or 500 nM MG132 for 4 hr. (b ) Three independent lines of primary MEFs were prepared for each genotype. ( c ) and ( d ) Primary Jnk1 -/- or Jnk2 -/- MEFs were treated with 200 nM MG132 for 6 hr. While JNK1 antibodies only recognized the p46 isoform, JNK2 antibodies recognized both p54 and p46 isoforms. ( e ) HEK293T cells were transfected with indicated plasmids for 48 hr. The JNK1 CA plasmid encodes a fusion protein between MKK7 and JNK1A1. ( f ) and ( g ) Following transfection with indicated siRNAs or plasmids, HEK293T cells were labeled with 6-FAM-dc-puromycin for 30 min and analyzed by flow cytometry. ( h ) - ( j ) Sizes of transfected HeLa cells (h and i) and primary Jnk -deficient MEFs (j) were measured by a Multisizer™ 3 Coulter Counter. JNK manipulation causes statistically significant changes in cell size distribution (Kolmogorov-Smirnov test, p

    Article Snippet: Measurement of global protein translation in vitro and in vivo Cells were incubated with 6-FAM-dc-puromycin (50 nM, Jena Bioscience) in vitro for 1h and analyzed by flow cytometry.

    Techniques: Stable Transfection, Transduction, Transfection, Plasmid Preparation, Labeling, Flow Cytometry, Cytometry

    Arginine perturbations disrupt FMRP LCR -sc1 RNA phase separation but do not notably affect FMRP LCR binding to sc-1 RNA. ( A ) Schematic illustration of the three constructs used. ( B ) Similar binding affinities for interactions between FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR with 6-FAM–labeled sc1 RNA (25 nM) are shown using FP assayed in 25 mM Na 2 PO 4 , pH 7.4, 100 mM KCl, 2 mM DTT, 0.02 mg/mL E. coli tRNA, and 0.01% Nonidet P-40. Apparent dissociation constants ( k d,app ) from three experimental replicates. ( C ) Phase diagram of FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR at a constant protein concentration of 100 μM with increasing sc1 RNA concentrations in buffer containing 25 mM Na 2 PO 4 , pH 7.4, 30 mM KCl, and 2 mM DTT. Green circles represent an observation of droplet formation, and open circles represent no droplet formation detected. The dotted red line is a visual aid for a qualitative phase boundary of FMRP LCR. ( Right ) Representative DIC microscopy images of droplets for the addition of 2.5 μM of RNA in the conditions described. (Scale bar, 5 μm.) Phase-separation propensity is dramatically decreased for methylated and RtoK mutant proteins, with smaller droplet sizes observed.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Phosphoregulated FMRP phase separation models activity-dependent translation through bidirectional control of mRNA granule formation

    doi: 10.1073/pnas.1814385116

    Figure Lengend Snippet: Arginine perturbations disrupt FMRP LCR -sc1 RNA phase separation but do not notably affect FMRP LCR binding to sc-1 RNA. ( A ) Schematic illustration of the three constructs used. ( B ) Similar binding affinities for interactions between FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR with 6-FAM–labeled sc1 RNA (25 nM) are shown using FP assayed in 25 mM Na 2 PO 4 , pH 7.4, 100 mM KCl, 2 mM DTT, 0.02 mg/mL E. coli tRNA, and 0.01% Nonidet P-40. Apparent dissociation constants ( k d,app ) from three experimental replicates. ( C ) Phase diagram of FMRP LCR , Me-FMRP LCR , and RtoK-FMRP LCR at a constant protein concentration of 100 μM with increasing sc1 RNA concentrations in buffer containing 25 mM Na 2 PO 4 , pH 7.4, 30 mM KCl, and 2 mM DTT. Green circles represent an observation of droplet formation, and open circles represent no droplet formation detected. The dotted red line is a visual aid for a qualitative phase boundary of FMRP LCR. ( Right ) Representative DIC microscopy images of droplets for the addition of 2.5 μM of RNA in the conditions described. (Scale bar, 5 μm.) Phase-separation propensity is dramatically decreased for methylated and RtoK mutant proteins, with smaller droplet sizes observed.

    Article Snippet: Sc1 RNA, 5′-labeled Cy3-sc1 RNA, 5′-labeled Cy3-miRNA-125b, and 5′-labeled 6-FAM-sc1 RNA were purchased from Sigma as lyophilized samples.

    Techniques: Binding Assay, Construct, Labeling, Protein Concentration, Microscopy, Methylation, Mutagenesis

    Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with 6-FAM-hsa-miR-5p.

    Journal: Scientific Reports

    Article Title: Physicochemical and biological characterization of chitosan-microRNA nanocomplexes for gene delivery to MCF-7 breast cancer cells

    doi: 10.1038/srep13567

    Figure Lengend Snippet: Uptake of CS HDP-12–miRNA complexes into MCF-7 cells observed by confocal laser scanning microscopy. Horizontal axis: optical sections at increasing height (z-values) Vertical axis: incubation times: 0, 5, 24 and 48 h. Red fluorescent staining = CellMask Deep Red membrane staining, Green fluorescent staining = CS HDP-12–miRNA complexes labelled with 6-FAM-hsa-miR-5p.

    Article Snippet: Confocal laser scanning microscopy (CLSM) We investigated the intracellular trafficking of nanocomplexes containing 6-FAM-hsa-miR-5p (Biomers, Ulm, Germany).

    Techniques: Confocal Laser Scanning Microscopy, Incubation, Staining