6 fam Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher 6fam tamra
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6fam Tamra, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 64 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6fam tamra/product/Thermo Fisher
    Average 99 stars, based on 64 article reviews
    Price from $9.99 to $1999.99
    6fam tamra - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    90
    Millipore phosphoramidite conjugate 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Phosphoramidite Conjugate 6 Fam, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite conjugate 6 fam/product/Millipore
    Average 90 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite conjugate 6 fam - by Bioz Stars, 2020-08
    90/100 stars
      Buy from Supplier

    93
    Thermo Fisher phosphoramidite dye 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Phosphoramidite Dye 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite dye 6 fam/product/Thermo Fisher
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite dye 6 fam - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Thermo Fisher fluorochrome 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Fluorochrome 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fluorochrome 6 fam/product/Thermo Fisher
    Average 85 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    fluorochrome 6 fam - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    89
    Sigma-Genosys phosphoramidite 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Phosphoramidite 6 Fam, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 89/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite 6 fam/product/Sigma-Genosys
    Average 89 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite 6 fam - by Bioz Stars, 2020-08
    89/100 stars
      Buy from Supplier

    85
    Thermo Fisher 6 fam amidite
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Amidite, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam amidite/product/Thermo Fisher
    Average 85 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    6 fam amidite - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    93
    Thermo Fisher 6 carboxyfluorescein 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Carboxyfluorescein 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 carboxyfluorescein 6 fam/product/Thermo Fisher
    Average 93 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    6 carboxyfluorescein 6 fam - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    Thermo Fisher primer 6 fam 8f
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Primer 6 Fam 8f, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/primer 6 fam 8f/product/Thermo Fisher
    Average 85 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    primer 6 fam 8f - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    MWG-Biotech 6 fam fluorochrome
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Fluorochrome, supplied by MWG-Biotech, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorochrome/product/MWG-Biotech
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorochrome - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    85
    Sigma-Genosys 6 fam tcaagtggcgctggaacctc tamra
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Tcaagtggcgctggaacctc Tamra, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam tcaagtggcgctggaacctc tamra/product/Sigma-Genosys
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    6 fam tcaagtggcgctggaacctc tamra - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    86
    Eurofins phosphoramidite conjugate 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Phosphoramidite Conjugate 6 Fam, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/phosphoramidite conjugate 6 fam/product/Eurofins
    Average 86 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    phosphoramidite conjugate 6 fam - by Bioz Stars, 2020-08
    86/100 stars
      Buy from Supplier

    85
    Millipore 6 fam 143d tamra
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam 143d Tamra, supplied by Millipore, used in various techniques. Bioz Stars score: 85/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam 143d tamra/product/Millipore
    Average 85 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    6 fam 143d tamra - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    Thermo Fisher 6 fam dyes
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Dyes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam dyes/product/Thermo Fisher
    Average 85 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    6 fam dyes - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    92
    Eurofins 6 fam fluorescence modification
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Fluorescence Modification, supplied by Eurofins, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam fluorescence modification/product/Eurofins
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    6 fam fluorescence modification - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    85
    Thermo Fisher taqman probe 6 fam
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Taqman Probe 6 Fam, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman probe 6 fam/product/Thermo Fisher
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    taqman probe 6 fam - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    85
    PerkinElmer reagent 6 fam phosphoramidite
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    Reagent 6 Fam Phosphoramidite, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/reagent 6 fam phosphoramidite/product/PerkinElmer
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    reagent 6 fam phosphoramidite - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    88
    Millipore 6 fam labeled primer
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Labeled Primer, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam labeled primer/product/Millipore
    Average 88 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    6 fam labeled primer - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    85
    Thermo Fisher 6 fam ccttgtggtactgcctga mgb
    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination <t>6FAM</t> PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.
    6 Fam Ccttgtggtactgcctga Mgb, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/6 fam ccttgtggtactgcctga mgb/product/Thermo Fisher
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    6 fam ccttgtggtactgcctga mgb - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination 6FAM PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.

    Journal: Plant Methods

    Article Title: High-throughput retrotransposon-based fluorescent markers: improved information content and allele discrimination

    doi: 10.1186/1746-4811-5-10

    Figure Lengend Snippet: 33 P band and fluorescent peak pattern comparison . Fluorescent peak patterns with the triplex primer combination 6FAM PPT/PPT/Taq+TG, showing individual electropherograms for specific amplicons, A 1039 – 1060 nt for JI399, C 802 and 1039 – 1058 nt for JI281; the horizontal axis represents nt, and the vertical axis represents relative fluorescent units (RFU) [ 20 ]. The corresponding radio-labelled reactions with 33 P PPT/Taq+TG for both accessions, shown replicated in B , covers a partial gel image from 247 to ca. 1100 nt. The band sizes (nt) were determined by virtue of their pattern of occurrence from the 33 P gels and their corresponding fluorescent peak assessed with GeneMarker Version 1.6 software.

    Article Snippet: Amplification of SSAP templates The 33 P-based SSAP PCR conditions [ ], were tested by directly substituting the 33 P labelled specific PPT primer with its fluorescently labelled counterpart as follows: 15 ng of each of the specific 6FAM or HEX labelled PPT primer (HPLC-purified) and the Taq+2 primer (Table ) were combined in a 10 μl volume containing 1 × PCR buffer (50 mM KCl, 1.5 mM MgCl2 , 10 mM Tris-HCl pH 8.5, 0.1 mg/ml gelatin), 200 μM each dNTP, 1 U Taq polymerase (Invitrogen Ltd, 18038-026) and 3 μl (ca.

    Techniques: Software