N/A
Ymer Antibody Blocking Peptide
|
Buy from Supplier |
86
Bioneer Corporation
mir 448 3p Mir 448 3p, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mir 448 3p/product/Bioneer Corporation Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
mir 448 3p - by Bioz Stars,
2024-12
86/100 stars
|
Buy from Supplier |
86
Qiagen
mir 448 3p in vivo Mir 448 3p In Vivo, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mir 448 3p in vivo/product/Qiagen Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
mir 448 3p in vivo - by Bioz Stars,
2024-12
86/100 stars
|
Buy from Supplier |
86
Dawley Inc
mir 448 3p Mir 448 3p, supplied by Dawley Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mir 448 3p/product/Dawley Inc Average 86 stars, based on 1 article reviews Price from $9.99 to $1999.99
mir 448 3p - by Bioz Stars,
2024-12
86/100 stars
|
Buy from Supplier |
N/A
strong MicroRNA rno miR 448 3p strong Accession Number MIMAT0001534 Mature Sequence UUGCAUAUGUAGGAUGUCCCA rno miR 448 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
|
Buy from Supplier |