Journal: Cell

Article Title: A trans -complementation system for SARS-CoV-2 recapitulates authentic viral replication without virulence

doi: 10.1016/j.cell.2021.02.044

Figure Lengend Snippet:

Article Snippet: Primer cov-21115-F (CATTTGTGGGTTTATACAACAAAAG) , Sigma-Aldrich , N/A.

Techniques: Recombinant, SYBR Green Assay, Electroporation, Gel Extraction, Electron Microscopy, Synthesized, Sequencing, Software

Journal: Research Square

Article Title: Bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs

doi: 10.21203/rs.3.rs-555275/v1

Figure Lengend Snippet: a. Schematic of pooled screen to identify SARS-CoV-2 regulators in Vero E6 cells. b. Scatter plot showing the gene-level mean z-scores of genes when knocked out in Vero E6 cells. The top genes conferring resistance to SARS-CoV-2 are annotated and shown in blue. c. Comparison between this Vero E6 screen to the Vero E6 screen conducted by the Wilen lab 27. Genes that scored among the top 20 resistance hits and sensitization hits in both screens are labeled. d. Venn diagram comparing hits across screens conducted in Vero E6, A549, and Huh7 (or derivatives) cells (ectopically expressing ACE2 and TMPRSS2 or not) 23–28. The top 20 genes from each cell line are included, with genes considered a hit in another cell line if the average z-score was > 3.

Article Snippet: Cells were lysed in lysis buffer (10 mM TRIS 1M pH7.6, NaCl 150 mM, Triton X100 1%, EDTA 1 mM, deoxycholate 0,1%) supplemented with sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS-PAGE and analyzed by immunoblotting using primary antibodies against ACE2 (ProteinTech 21115–1-P) and Actin (Sigma-Aldrich A1978), followed by HRP-conjugated anti-rabbit or anti-mouse immunoglobulin antibodies and chemiluminescence Clarity or Clarity max substrate (Bio-Rad).

Techniques: Labeling, Expressing

Journal: Research Square

Article Title: Bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs

doi: 10.21203/rs.3.rs-555275/v1

Figure Lengend Snippet: Properties of SARS-CoV-2 host factor screens assayed by cell viability. For each library, the number of unique guides per gene is indicated in parentheses. The essential gene QC serves as a metric for screen quality (see Methods ) in the untreated arm, when applicable; the number of days post-library introduction until the end of the experiment is written after the semicolon.

Article Snippet: Cells were lysed in lysis buffer (10 mM TRIS 1M pH7.6, NaCl 150 mM, Triton X100 1%, EDTA 1 mM, deoxycholate 0,1%) supplemented with sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS-PAGE and analyzed by immunoblotting using primary antibodies against ACE2 (ProteinTech 21115–1-P) and Actin (Sigma-Aldrich A1978), followed by HRP-conjugated anti-rabbit or anti-mouse immunoglobulin antibodies and chemiluminescence Clarity or Clarity max substrate (Bio-Rad).

Techniques:

Journal: Research Square

Article Title: Bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs

doi: 10.21203/rs.3.rs-555275/v1

Figure Lengend Snippet: Calu-3-Cas9 cells were stably transduced to express 2 different sgRNAs (g1, g2) per indicated gene and selected for 10–15 days. a. Cells were infected with SARS-CoV-2 bearing the mNG reporter and the infection efficiency was scored 48h later by flow cytometry. b. The expression levels of ACE2 were analyzed by immunoblot, Actin served as a loading control. c. Relative surface ACE2 expression was measured using a Spike-RBD-Fc fusion and a fluorescent secondary antibody followed by flow cytometry analysis. d. Cells were incubated with SARS-CoV-2 at MOI 5 for 2h at 37°C and then treated with Subtilisin A followed by RNA extraction and RdRp RT-qPCR analysis as a measure of viral internalization. e. Cells were infected with Spike del19 and VSV-G pseudotyped, GFP expressing VSV and infection efficiency was analyzed 24h later by flow cytometry. f. Cells were infected with SARS-CoV-2 at MOI 0.05 and, 24h later, lysed for RNA extraction and RdRp RT-qPCR analysis. g. Aliquots of the supernatants from F were harvested and plaque assays were performed to evaluate the production of infectious viruses in the different conditions. h. Cells were infected with MERS-CoV and 16h later, infectious particle production in the supernatant was measured by TCID 50 . The mean and SEM of at least 5 ( a ), 3 ( c , d , e , f , h ) independent experiments or representative experiments ( b and g ) are shown. The red dashed line represents 50% inhibition ( a , c-f ).

Article Snippet: Cells were lysed in lysis buffer (10 mM TRIS 1M pH7.6, NaCl 150 mM, Triton X100 1%, EDTA 1 mM, deoxycholate 0,1%) supplemented with sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS-PAGE and analyzed by immunoblotting using primary antibodies against ACE2 (ProteinTech 21115–1-P) and Actin (Sigma-Aldrich A1978), followed by HRP-conjugated anti-rabbit or anti-mouse immunoglobulin antibodies and chemiluminescence Clarity or Clarity max substrate (Bio-Rad).

Techniques: Stable Transfection, Infection, Flow Cytometry, Expressing, Western Blot, Incubation, RNA Extraction, Quantitative RT-PCR, Inhibition

Journal: Research Square

Article Title: Bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs

doi: 10.21203/rs.3.rs-555275/v1

Figure Lengend Snippet: sgRNA sequences used for CRISPR KO perturbations

Article Snippet: Cells were lysed in lysis buffer (10 mM TRIS 1M pH7.6, NaCl 150 mM, Triton X100 1%, EDTA 1 mM, deoxycholate 0,1%) supplemented with sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS-PAGE and analyzed by immunoblotting using primary antibodies against ACE2 (ProteinTech 21115–1-P) and Actin (Sigma-Aldrich A1978), followed by HRP-conjugated anti-rabbit or anti-mouse immunoglobulin antibodies and chemiluminescence Clarity or Clarity max substrate (Bio-Rad).

Techniques: CRISPR, Sequencing

Journal: Research Square

Article Title: Bidirectional genome-wide CRISPR screens reveal host factors regulating SARS-CoV-2, MERS-CoV and seasonal HCoVs

doi: 10.21203/rs.3.rs-555275/v1

Figure Lengend Snippet: sgRNA sequences used for CRISPRa perturbations

Article Snippet: Cells were lysed in lysis buffer (10 mM TRIS 1M pH7.6, NaCl 150 mM, Triton X100 1%, EDTA 1 mM, deoxycholate 0,1%) supplemented with sample buffer (50 mM Tris-HCl pH 6.8, 2% SDS, 5% glycerol, 100 mM DTT, 0.02% bromophenol blue), resolved by SDS-PAGE and analyzed by immunoblotting using primary antibodies against ACE2 (ProteinTech 21115–1-P) and Actin (Sigma-Aldrich A1978), followed by HRP-conjugated anti-rabbit or anti-mouse immunoglobulin antibodies and chemiluminescence Clarity or Clarity max substrate (Bio-Rad).

Techniques: Sequencing