1x pcr buffer Thermo Fisher Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher 1x geneamp 10x pcr buffer ii
    1x Geneamp 10x Pcr Buffer Ii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x geneamp 10x pcr buffer ii/product/Thermo Fisher
    Average 90 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    1x geneamp 10x pcr buffer ii - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    80
    Thermo Fisher polymerase chain reaction conditions 1x pcr gold buffer
    Polymerase Chain Reaction Conditions 1x Pcr Gold Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 21 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polymerase chain reaction conditions 1x pcr gold buffer/product/Thermo Fisher
    Average 80 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    polymerase chain reaction conditions 1x pcr gold buffer - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    79
    Thermo Fisher 1x polymerase chain reaction pcr buffer
    1x Polymerase Chain Reaction Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 491 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x polymerase chain reaction pcr buffer/product/Thermo Fisher
    Average 79 stars, based on 491 article reviews
    Price from $9.99 to $1999.99
    1x polymerase chain reaction pcr buffer - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    89
    Thermo Fisher pcr buffer gold
    Pcr Buffer Gold, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 176 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer gold/product/Thermo Fisher
    Average 89 stars, based on 176 article reviews
    Price from $9.99 to $1999.99
    pcr buffer gold - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    78
    Thermo Fisher pcr truestarttm buffer
    Pcr Truestarttm Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr truestarttm buffer/product/Thermo Fisher
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pcr truestarttm buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    80
    Thermo Fisher round pcr 1x pcr buffer
    Round Pcr 1x Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/round pcr 1x pcr buffer/product/Thermo Fisher
    Average 80 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    round pcr 1x pcr buffer - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    96
    Thermo Fisher geneamp pcr gold buffer
    Geneamp Pcr Gold Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 269 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp pcr gold buffer/product/Thermo Fisher
    Average 96 stars, based on 269 article reviews
    Price from $9.99 to $1999.99
    geneamp pcr gold buffer - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    78
    Thermo Fisher pfx 50 pcr buffer
    Pfx 50 Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pfx 50 pcr buffer/product/Thermo Fisher
    Average 78 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    pfx 50 pcr buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr buffer ii
    Pcr Buffer Ii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1722 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer ii/product/Thermo Fisher
    Average 99 stars, based on 1722 article reviews
    Price from $9.99 to $1999.99
    pcr buffer ii - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    Thermo Fisher 1x pcr rxn buffer
    1x Pcr Rxn Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x pcr rxn buffer/product/Thermo Fisher
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    1x pcr rxn buffer - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    97
    Thermo Fisher 1x geneamp pcr buffer
    1x Geneamp Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x geneamp pcr buffer/product/Thermo Fisher
    Average 97 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    1x geneamp pcr buffer - by Bioz Stars, 2020-02
    97/100 stars
      Buy from Supplier

    78
    Thermo Fisher pcr platinum buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    Pcr Platinum Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr platinum buffer/product/Thermo Fisher
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    pcr platinum buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    77
    Thermo Fisher 1x pcr specific buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Pcr Specific Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x pcr specific buffer/product/Thermo Fisher
    Average 77 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    1x pcr specific buffer - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    83
    Thermo Fisher 1x kcl pcr buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Kcl Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x kcl pcr buffer/product/Thermo Fisher
    Average 83 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    1x kcl pcr buffer - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    99
    Thermo Fisher pcr reactions
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    Pcr Reactions, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 26520 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reactions/product/Thermo Fisher
    Average 99 stars, based on 26520 article reviews
    Price from $9.99 to $1999.99
    pcr reactions - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    79
    Thermo Fisher 1x amplitaq 360 pcr buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Amplitaq 360 Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x amplitaq 360 pcr buffer/product/Thermo Fisher
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    1x amplitaq 360 pcr buffer - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    Thermo Fisher 1x accuprime pcr buffer i
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Accuprime Pcr Buffer I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x accuprime pcr buffer i/product/Thermo Fisher
    Average 78 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    1x accuprime pcr buffer i - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    82
    Thermo Fisher 1x geneamp pcr gold buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Geneamp Pcr Gold Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 38 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x geneamp pcr gold buffer/product/Thermo Fisher
    Average 82 stars, based on 38 article reviews
    Price from $9.99 to $1999.99
    1x geneamp pcr gold buffer - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    85
    Thermo Fisher 1x amplitaq gold pcr buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Amplitaq Gold Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x amplitaq gold pcr buffer/product/Thermo Fisher
    Average 85 stars, based on 17 article reviews
    Price from $9.99 to $1999.99
    1x amplitaq gold pcr buffer - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    83
    Thermo Fisher pcr reactions 1x phire buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    Pcr Reactions 1x Phire Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reactions 1x phire buffer/product/Thermo Fisher
    Average 83 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    pcr reactions 1x phire buffer - by Bioz Stars, 2020-02
    83/100 stars
      Buy from Supplier

    80
    Thermo Fisher 1x sybr green pcr buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Sybr Green Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x sybr green pcr buffer/product/Thermo Fisher
    Average 80 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    1x sybr green pcr buffer - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    78
    Thermo Fisher 1x platinum taq pcr buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Platinum Taq Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x platinum taq pcr buffer/product/Thermo Fisher
    Average 78 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    1x platinum taq pcr buffer - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    79
    Thermo Fisher 1x pcr reaction buffer ii
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Pcr Reaction Buffer Ii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 79/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x pcr reaction buffer ii/product/Thermo Fisher
    Average 79 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    1x pcr reaction buffer ii - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    87
    Thermo Fisher 1x amplitaq gold 360 pcr buffer
    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of <t>TcCERS1</t> using <t>PCR.</t> Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:
    1x Amplitaq Gold 360 Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 87/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x amplitaq gold 360 pcr buffer/product/Thermo Fisher
    Average 87 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    1x amplitaq gold 360 pcr buffer - by Bioz Stars, 2020-02
    87/100 stars
      Buy from Supplier

    90
    Thermo Fisher pcr reaction buffer
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    Pcr Reaction Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 733 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr reaction buffer/product/Thermo Fisher
    Average 90 stars, based on 733 article reviews
    Price from $9.99 to $1999.99
    pcr reaction buffer - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    77
    Thermo Fisher 1x taqman pcr buffer a
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    1x Taqman Pcr Buffer A, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x taqman pcr buffer a/product/Thermo Fisher
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    1x taqman pcr buffer a - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    82
    Thermo Fisher 1x pcr amplification buffer
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    1x Pcr Amplification Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 82/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x pcr amplification buffer/product/Thermo Fisher
    Average 82 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    1x pcr amplification buffer - by Bioz Stars, 2020-02
    82/100 stars
      Buy from Supplier

    84
    Thermo Fisher 1x taq dna polymerase pcr buffer
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    1x Taq Dna Polymerase Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x taq dna polymerase pcr buffer/product/Thermo Fisher
    Average 84 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    1x taq dna polymerase pcr buffer - by Bioz Stars, 2020-02
    84/100 stars
      Buy from Supplier

    78
    Thermo Fisher geneamp pcr buffer 2
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    Geneamp Pcr Buffer 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/geneamp pcr buffer 2/product/Thermo Fisher
    Average 78 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    geneamp pcr buffer 2 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    84
    Thermo Fisher 1x pcr magnesium free
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    1x Pcr Magnesium Free, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 84/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1x pcr magnesium free/product/Thermo Fisher
    Average 84 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    1x pcr magnesium free - by Bioz Stars, 2020-02
    84/100 stars
      Buy from Supplier

    90
    Thermo Fisher taq dna polymerase pcr buffer
    Effect of <t>PGPR</t> inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative <t>RT-PCR</t> analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.
    Taq Dna Polymerase Pcr Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase pcr buffer/product/Thermo Fisher
    Average 90 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase pcr buffer - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of TcCERS1 using PCR. Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:

    Journal: Molecular and biochemical parasitology

    Article Title: Molecular and functional characterization of the ceramide synthase from Trypanosoma cruzi

    doi: 10.1016/j.molbiopara.2011.12.006

    Figure Lengend Snippet: Confirmation of rescue of YPK9 lag1Δlac1Δ by overexpression of TcCERS1 using PCR. Colonies of YPK9 containing the empty p423TEF vector (YPK9), YPK9.2Δ.TcCERS1 (2Δ.TcCERS1) and YPK9.2Δ.LAG1 containing the p423TEF:

    Article Snippet: TcCERS1 DNA was amplified by PCR in 50 μL of 1x PCR Platinum buffer (Invitrogen, Carlsbad, U.S.A.) supplemented with 1.5 mM MgCl2 , 100 ng Dm28c total DNA, 200 μM dNTPs, 1 μM of primers LAGTCS (5′-TC GGATCC ATGGGGACGTTGCGTTTCAC; BamHI site underlined) and LAGTCAS (5′-TC GAATTC TTAGAAATCTTCCTCATCATCC; EcoRI site underlined), and 1.5 U of Platinum Taq DNA polymerase (Invitrogen, Carlsbad, U.S.A.).

    Techniques: Over Expression, Polymerase Chain Reaction, Plasmid Preparation

    Effect of PGPR inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative RT-PCR analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.

    Journal: BioMed Research International

    Article Title: Plant Growth-Promoting Rhizobacteria Enhance Salinity Stress Tolerance in Okra through ROS-Scavenging Enzymes

    doi: 10.1155/2016/6284547

    Figure Lengend Snippet: Effect of PGPR inoculation on DHAR, GR, APX, and CAT transcript levels by semiquantitative RT-PCR analysis of okra leaves under salt stress. T0: noninoculated salt treated plants, T1: UPMR2 inoculated salt treated plants, T2: UPMR18 inoculated salt treated plants, and T3: both UPMR2 and UPMR18 inoculated salt treated plants. Actin: positive control, APX: ascorbate peroxidase, CAT: catalase, GR: glutathione reductase, and DHAR: dehydroascorbate reductase.

    Article Snippet: The 25 μ L PCR reaction mixture consisted of the following components: 1 μ L of each extracted PGPR genomic DNA, 0.15 μ M of each primer, 1x PCR reaction buffer (Fermentas, USA), 0.2 mM of dNTP mix, 2.5 U of Taq polymerase (Fermentas, USA), 25 mM of MgCl2 , and nucleic acid-free water to make up final volume.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Positive Control

    (a) Agarose gel electrophoresis of 16S rDNA PCR products of bacterial isolates. Lane M: 100 bP DNA ladder. Lanes 1 and 2: bacterial isolates UPMR2 and UPMR18. (b) The neighbor-joining tree shows the phylogenetic relationship of the isolates UPMR2 and UPMR18 with related isolates from the NCBI database.

    Journal: BioMed Research International

    Article Title: Plant Growth-Promoting Rhizobacteria Enhance Salinity Stress Tolerance in Okra through ROS-Scavenging Enzymes

    doi: 10.1155/2016/6284547

    Figure Lengend Snippet: (a) Agarose gel electrophoresis of 16S rDNA PCR products of bacterial isolates. Lane M: 100 bP DNA ladder. Lanes 1 and 2: bacterial isolates UPMR2 and UPMR18. (b) The neighbor-joining tree shows the phylogenetic relationship of the isolates UPMR2 and UPMR18 with related isolates from the NCBI database.

    Article Snippet: The 25 μ L PCR reaction mixture consisted of the following components: 1 μ L of each extracted PGPR genomic DNA, 0.15 μ M of each primer, 1x PCR reaction buffer (Fermentas, USA), 0.2 mM of dNTP mix, 2.5 U of Taq polymerase (Fermentas, USA), 25 mM of MgCl2 , and nucleic acid-free water to make up final volume.

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction