1481 catggcccgcagcgacctcca Search Results


91
ATCC 1481 catggcccgcagcgacctcca
Successfully annotated tags showing greater than two-fold up-regulation in both the –N and –P libraries relative to the control library ( R -value >2). A protein ID is given for: 1) tags that map directly to the genome where a gene model exists, or 2) tags that map to an EST that overlaps with a gene model on the genome. ESTs are given for tags annotated by mapping to an EST.
1481 Catggcccgcagcgacctcca, supplied by ATCC, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1481 catggcccgcagcgacctcca/product/ATCC
Average 91 stars, based on 1 article reviews
1481 catggcccgcagcgacctcca - by Bioz Stars, 2026-05
91/100 stars
  Buy from Supplier

Image Search Results


Successfully annotated tags showing greater than two-fold up-regulation in both the –N and –P libraries relative to the control library ( R -value >2). A protein ID is given for: 1) tags that map directly to the genome where a gene model exists, or 2) tags that map to an EST that overlaps with a gene model on the genome. ESTs are given for tags annotated by mapping to an EST.

Journal: Environmental Microbiology

Article Title: Nutrient-regulated transcriptional responses in the brown tide forming alga Aureococcus anophagefferens

doi: 10.1111/j.1462-2920.2010.02351.x

Figure Lengend Snippet: Successfully annotated tags showing greater than two-fold up-regulation in both the –N and –P libraries relative to the control library ( R -value >2). A protein ID is given for: 1) tags that map directly to the genome where a gene model exists, or 2) tags that map to an EST that overlaps with a gene model on the genome. ESTs are given for tags annotated by mapping to an EST.

Article Snippet: Additionally, three tags (1814, 2687, and 922) mapped to three different proteins involved in light harvesting, with all three tags showing similar magnitudes of up-regulation ( ). table ft1 table-wrap mode="anchored" t5 caption a7 Tag ID Sequence R -value Fold change for: Putative annotation EST Protein ID -P -N 1814 CATGATGGGCGTCACGGGCGC 15.58 4.8 3.2 Chloroplast light harvesting protein isoform 3 [Isochrysis galbana] - 59955 10695 CATGGAGGAGGTCAACCTCCT 3.940 14.6 17.6 Contains oxidoreductase domain - 72519 2687 CATGTTCGGCGAGGGCCAGAC 3.834 4.4 2.7 Plastid light harvesting protein isoform 39 (manually curated) 1 - 77828 922 CATGCCGGCGGCCGTGCCGGG 3.401 3.6 3.9 Fucoxanthin chlorophyll a/c protein, deviant [Phaeodactylum tricornutum CCAP 1055/1] 4208996:1 - 1894 CATGCTCGGGCTCGCGCACGC 3.327 7.8 3.6 Glycosyl transferase group 1 [Herpetosiphon aurantiacus ATCC 23779] 4211177:45 - 1481 CATGGCCCGCAGCGACCTCCA 3.276 2.3 5.4 Sensory transduction histidine kinase [Psychroflexus torquis ATCC 700755] - 71871 1839 CATGCCCGACTACACCAAGTC 3.041 3.4 2.0 Oxidoreductase, acting on the aldehyde or oxo group of donors, disulfide as acceptor / pyruvate dehydrogenase (acetyl-transferring) [Arabidopsis thaliana] - 53060 1951 CATGTTCCTGTCGCTCGACGT 3.026 16.0 6.8 Cation efflux system protein [Oceanicola batsensis HTCC2597] 4211177:393 - 6839 CATGGTCGGCGGCATCGACGA 3.026 16.0 6.8 RecName: Full=ATP synthase subunit beta, mitochondrial; Flags: Precursor 4206114:1 - 3296 CATGCCGACGCCGCGCGCGCT 2.610 Absent 2 Absent PREDICTED: similar to dishevelled-associated activator of morphogenesis 1 isoform 1 [Danio rerio] - 70943 1941 CATGTGGATGCAAGCGGCTGC 2.580 3.3 3.7 Glutaminyl-tRNA synthetase, putative [Perkinsus marinus ATCC 50983] 4211177:152 - 2546 CATGGCGCGGTACCAGATCGG 2.057 7.3 2.7 O-methyltransferase, putative [Streptomyces ghanaensis ATCC 14672] 4211177:220 - Open in a separate window 1 Manually curated notes the gene model was manually assigned a function and reviewed by a curator.

Techniques: Control, Sequencing, Transduction