14-816 Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    ATCC agatccccgttgcaattttctgtg f gt 17 gtgaaaggaacgtttgatgcgaca 129 149
    Agatccccgttgcaattttctgtg F Gt 17 Gtgaaaggaacgtttgatgcgaca 129 149, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/agatccccgttgcaattttctgtg f gt 17 gtgaaaggaacgtttgatgcgaca 129 149/product/ATCC
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    agatccccgttgcaattttctgtg f gt 17 gtgaaaggaacgtttgatgcgaca 129 149 - by Bioz Stars, 2024-02
    90/100 stars
      Buy from Supplier

    92
    Proteintech anti pex16
    Knockdown of PEX3, <t>PEX16,</t> and PEX19 decreases peroxisome abundance in RPE-1 cells. RPE-1 cells were transfected with siRNA of PEX3, PEX16, and PEX19 for 72 h. The transfection efficiency was evaluated by measuring ( A ) the relative mRNA levels with RT-qPCR and ( B ) the protein expression by immunoblotting. ( C ) Cells were treated with siRNA of PEX3, PEX16, and PEX19 for 48 h and treated with 5 μM chloroquine (CQ) for an additional 24 h. Cells were subjected to immunofluorescence to examine the expression of ABCD3 puncta. ( D ) Quantification of ABCD3 puncta represented the number of peroxisomes per cell. Data are expressed as means ± S.D. ( n = 3, independent experiments), * p < 0.05.
    Anti Pex16, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/anti pex16/product/Proteintech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    anti pex16 - by Bioz Stars, 2024-02
    92/100 stars
      Buy from Supplier

    92
    Proteintech tween20
    Knockdown of PEX3, <t>PEX16,</t> and PEX19 decreases peroxisome abundance in RPE-1 cells. RPE-1 cells were transfected with siRNA of PEX3, PEX16, and PEX19 for 72 h. The transfection efficiency was evaluated by measuring ( A ) the relative mRNA levels with RT-qPCR and ( B ) the protein expression by immunoblotting. ( C ) Cells were treated with siRNA of PEX3, PEX16, and PEX19 for 48 h and treated with 5 μM chloroquine (CQ) for an additional 24 h. Cells were subjected to immunofluorescence to examine the expression of ABCD3 puncta. ( D ) Quantification of ABCD3 puncta represented the number of peroxisomes per cell. Data are expressed as means ± S.D. ( n = 3, independent experiments), * p < 0.05.
    Tween20, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tween20/product/Proteintech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tween20 - by Bioz Stars, 2024-02
    92/100 stars
      Buy from Supplier

    92
    Proteintech rabbit polyclonal antibodies against pex16
    (A) Gene expression analysis in BAT, iWAT, and gWAT of WT mice kept at normal room temperature (RT) (22°C) or subjected to cold (4°C) exposure; n = 3–4. (B) Fluorescence microscopy analysis of COS-7 cells transfected with a GFP reporter under the control of a –2 kb <t>Pex16</t> promoter alone or together with HA-PRDM16. Original magnification, ×20. (C) Luciferase reporter assay in COS-7 cells; n = 3. (D) BAT SVF cells expressing retrovirally encoded FLAG-PRDM16 were subjected to ChIP assay using an anti-FLAG antibody followed by qPCR using primers to amplify various regions of the Pex16 promoter; n = 6. *P < 0.05; **P < 0.01; ***P < 0.001. (E) Gene expression analysis in iWAT of control and adipose-specific PRDM16-KO (PRDM16-AKO) mice; n = 3. Data are expressed as mean ± SEM and were analyzed by Student’s t test. †P < 0.05 versus control RT; #P < 0.05 versus control cold.
    Rabbit Polyclonal Antibodies Against Pex16, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rabbit polyclonal antibodies against pex16/product/Proteintech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    rabbit polyclonal antibodies against pex16 - by Bioz Stars, 2024-02
    92/100 stars
      Buy from Supplier

    92
    Proteintech pex16
    (A) Gene expression analysis in BAT, iWAT, and gWAT of WT mice kept at normal room temperature (RT) (22°C) or subjected to cold (4°C) exposure; n = 3–4. (B) Fluorescence microscopy analysis of COS-7 cells transfected with a GFP reporter under the control of a –2 kb <t>Pex16</t> promoter alone or together with HA-PRDM16. Original magnification, ×20. (C) Luciferase reporter assay in COS-7 cells; n = 3. (D) BAT SVF cells expressing retrovirally encoded FLAG-PRDM16 were subjected to ChIP assay using an anti-FLAG antibody followed by qPCR using primers to amplify various regions of the Pex16 promoter; n = 6. *P < 0.05; **P < 0.01; ***P < 0.001. (E) Gene expression analysis in iWAT of control and adipose-specific PRDM16-KO (PRDM16-AKO) mice; n = 3. Data are expressed as mean ± SEM and were analyzed by Student’s t test. †P < 0.05 versus control RT; #P < 0.05 versus control cold.
    Pex16, supplied by Proteintech, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pex16/product/Proteintech
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pex16 - by Bioz Stars, 2024-02
    92/100 stars
      Buy from Supplier

    Image Search Results


    Knockdown of PEX3, PEX16, and PEX19 decreases peroxisome abundance in RPE-1 cells. RPE-1 cells were transfected with siRNA of PEX3, PEX16, and PEX19 for 72 h. The transfection efficiency was evaluated by measuring ( A ) the relative mRNA levels with RT-qPCR and ( B ) the protein expression by immunoblotting. ( C ) Cells were treated with siRNA of PEX3, PEX16, and PEX19 for 48 h and treated with 5 μM chloroquine (CQ) for an additional 24 h. Cells were subjected to immunofluorescence to examine the expression of ABCD3 puncta. ( D ) Quantification of ABCD3 puncta represented the number of peroxisomes per cell. Data are expressed as means ± S.D. ( n = 3, independent experiments), * p < 0.05.

    Journal: International Journal of Molecular Sciences

    Article Title: Knockdown of PEX16 Induces Autophagic Degradation of Peroxisomes

    doi: 10.3390/ijms22157989

    Figure Lengend Snippet: Knockdown of PEX3, PEX16, and PEX19 decreases peroxisome abundance in RPE-1 cells. RPE-1 cells were transfected with siRNA of PEX3, PEX16, and PEX19 for 72 h. The transfection efficiency was evaluated by measuring ( A ) the relative mRNA levels with RT-qPCR and ( B ) the protein expression by immunoblotting. ( C ) Cells were treated with siRNA of PEX3, PEX16, and PEX19 for 48 h and treated with 5 μM chloroquine (CQ) for an additional 24 h. Cells were subjected to immunofluorescence to examine the expression of ABCD3 puncta. ( D ) Quantification of ABCD3 puncta represented the number of peroxisomes per cell. Data are expressed as means ± S.D. ( n = 3, independent experiments), * p < 0.05.

    Article Snippet: Reagents and antibodies used were as follows: anti-Calnexin (#ab22595, Abcam, Cambridge, MA, USA), anti-LC3 (#L8918, Sigma-Aldrich, St. Louis, MO, USA), anti-NBR1 (#16004-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX3 (#247042, Abcam), anti-PEX14 (#sc-23197, Santa Cruz Biotechnology, Dallas, TX, USA), anti-PEX16 (#14816-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX19 (#PA5-22129, Invitrogen, Carlsbad, CA, USA), anti-ABCD3 (#ab3421, Abcam, Cambridge, MA, USA and #SAB4200181, Sigma-Aldrich, St. Louis, MO, USA), anti-SQSTM1/p62 (#H00008878-M01, Abnova, Taipei, Taiwan), anti-VDAC (#55259-1-AP, Proteintech, Rosemont, IL, USA), anti-β-actin (#sc-47778, Santa Cruz Biotechnology, Dallas, TX, USA), and chloroquine (#C6628, Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Transfection, Quantitative RT-PCR, Expressing, Western Blot, Immunofluorescence

    Pexophagy mediates the loss of peroxisomes in RPE-1 cells with PEX16 knockdown. ( A ) Western blot analysis was used on RPE-1 cell lysates to check the protein expression of PEX16, ABCD3, PEX14, Calnexin, and VDAC, using β-actin as an internal control. ( B ) Cells were treated with PEX16 siRNA for 72 h, immunostained with ABCD3, and ( C ) the number of peroxisomes per cell was quantified. Data are expressed as means ± S.D. ( n = 3, independent experiments), * p < 0.05. ( D ) Cells were transfected with PEX16 siRNA, and then treated with chloroquine (CQ) at different time intervals as indicated. ( E ) Then, cells were subjected to immunofluorescence with ABCD3 antibody. ( F ) The number of ABCD3 puncta per cell was quantified. All data are presented as means ± S.D. ( n = 3, independent experiments), * p < 0.05. ( G ) Cells were treated with either control siRNA or PEX16 siRNA for 12 h, incubated with 5 μM CQ for 60 h, and the protein expression of PEX16, LC3, and p62 was examined with western blotting. ( H ) Wild type and ATG5 null MEF cells were treated with PEX16 siRNA for 72 h, and then subjected to immunofluorescence analysis with ABCD3 antibody. ( I ) Quantification of ABCD3 intensity from ( H ). All data are presented as means ± S.D. ( n = 3, independent experiments), * p < 0.05.

    Journal: International Journal of Molecular Sciences

    Article Title: Knockdown of PEX16 Induces Autophagic Degradation of Peroxisomes

    doi: 10.3390/ijms22157989

    Figure Lengend Snippet: Pexophagy mediates the loss of peroxisomes in RPE-1 cells with PEX16 knockdown. ( A ) Western blot analysis was used on RPE-1 cell lysates to check the protein expression of PEX16, ABCD3, PEX14, Calnexin, and VDAC, using β-actin as an internal control. ( B ) Cells were treated with PEX16 siRNA for 72 h, immunostained with ABCD3, and ( C ) the number of peroxisomes per cell was quantified. Data are expressed as means ± S.D. ( n = 3, independent experiments), * p < 0.05. ( D ) Cells were transfected with PEX16 siRNA, and then treated with chloroquine (CQ) at different time intervals as indicated. ( E ) Then, cells were subjected to immunofluorescence with ABCD3 antibody. ( F ) The number of ABCD3 puncta per cell was quantified. All data are presented as means ± S.D. ( n = 3, independent experiments), * p < 0.05. ( G ) Cells were treated with either control siRNA or PEX16 siRNA for 12 h, incubated with 5 μM CQ for 60 h, and the protein expression of PEX16, LC3, and p62 was examined with western blotting. ( H ) Wild type and ATG5 null MEF cells were treated with PEX16 siRNA for 72 h, and then subjected to immunofluorescence analysis with ABCD3 antibody. ( I ) Quantification of ABCD3 intensity from ( H ). All data are presented as means ± S.D. ( n = 3, independent experiments), * p < 0.05.

    Article Snippet: Reagents and antibodies used were as follows: anti-Calnexin (#ab22595, Abcam, Cambridge, MA, USA), anti-LC3 (#L8918, Sigma-Aldrich, St. Louis, MO, USA), anti-NBR1 (#16004-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX3 (#247042, Abcam), anti-PEX14 (#sc-23197, Santa Cruz Biotechnology, Dallas, TX, USA), anti-PEX16 (#14816-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX19 (#PA5-22129, Invitrogen, Carlsbad, CA, USA), anti-ABCD3 (#ab3421, Abcam, Cambridge, MA, USA and #SAB4200181, Sigma-Aldrich, St. Louis, MO, USA), anti-SQSTM1/p62 (#H00008878-M01, Abnova, Taipei, Taiwan), anti-VDAC (#55259-1-AP, Proteintech, Rosemont, IL, USA), anti-β-actin (#sc-47778, Santa Cruz Biotechnology, Dallas, TX, USA), and chloroquine (#C6628, Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Western Blot, Expressing, Transfection, Immunofluorescence, Incubation

    p62 mediates pexophagy in RPE-1 cells with PEX16 knockdown. ( A ) Cells were co-treated with siRNA of NBR1 and PEX16, followed by immunostaining for ABCD3. ( B ) Quantification of ABCD3 puncta per cell from ( A ). ( C ) Cells were co-treated with p62 and PEX16 siRNA and immunostained for ABCD3. ( D ) Quantification of ABCD3 puncta per cell ( C ). Data are expressed as mean ± S.D. ( n = 3, independent experiments), * p < 0.05. ( E ) Cell lysates were also analyzed by western blot to determine the protein expression of PEX16, p62, and ABCD3. Cells were treated with either control siRNA or PEX16 siRNA for 12 h and incubated with 5 μM chloroquine (CQ) for 60 h. ( F ) Co-localization of ABCD3 and NBR1 was analyzed by co-immunostaining. ( G ) Quantification of NBR1/ABCD3 co-localization. ( H ) Co-localization of ABCD3 and p62 was analyzed by co-immunostaining. ( I ) Quantification of p62/ABCD3 co-localization. All data are presented as means ± S.D. ( n = 3–4, independent experiments), * p < 0.05.

    Journal: International Journal of Molecular Sciences

    Article Title: Knockdown of PEX16 Induces Autophagic Degradation of Peroxisomes

    doi: 10.3390/ijms22157989

    Figure Lengend Snippet: p62 mediates pexophagy in RPE-1 cells with PEX16 knockdown. ( A ) Cells were co-treated with siRNA of NBR1 and PEX16, followed by immunostaining for ABCD3. ( B ) Quantification of ABCD3 puncta per cell from ( A ). ( C ) Cells were co-treated with p62 and PEX16 siRNA and immunostained for ABCD3. ( D ) Quantification of ABCD3 puncta per cell ( C ). Data are expressed as mean ± S.D. ( n = 3, independent experiments), * p < 0.05. ( E ) Cell lysates were also analyzed by western blot to determine the protein expression of PEX16, p62, and ABCD3. Cells were treated with either control siRNA or PEX16 siRNA for 12 h and incubated with 5 μM chloroquine (CQ) for 60 h. ( F ) Co-localization of ABCD3 and NBR1 was analyzed by co-immunostaining. ( G ) Quantification of NBR1/ABCD3 co-localization. ( H ) Co-localization of ABCD3 and p62 was analyzed by co-immunostaining. ( I ) Quantification of p62/ABCD3 co-localization. All data are presented as means ± S.D. ( n = 3–4, independent experiments), * p < 0.05.

    Article Snippet: Reagents and antibodies used were as follows: anti-Calnexin (#ab22595, Abcam, Cambridge, MA, USA), anti-LC3 (#L8918, Sigma-Aldrich, St. Louis, MO, USA), anti-NBR1 (#16004-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX3 (#247042, Abcam), anti-PEX14 (#sc-23197, Santa Cruz Biotechnology, Dallas, TX, USA), anti-PEX16 (#14816-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX19 (#PA5-22129, Invitrogen, Carlsbad, CA, USA), anti-ABCD3 (#ab3421, Abcam, Cambridge, MA, USA and #SAB4200181, Sigma-Aldrich, St. Louis, MO, USA), anti-SQSTM1/p62 (#H00008878-M01, Abnova, Taipei, Taiwan), anti-VDAC (#55259-1-AP, Proteintech, Rosemont, IL, USA), anti-β-actin (#sc-47778, Santa Cruz Biotechnology, Dallas, TX, USA), and chloroquine (#C6628, Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Immunostaining, Western Blot, Expressing, Incubation

    Peroxisome function is not recovered by chloroquine in cells with PEX16 knockdown. RPE-1 cells were treated with siRNA of either control or PEX16 for 12 h, followed by incubation with 5 μM chloroquine for 60 h. Under this condition, ( A ) the levels of cholesterol and ( B ) plasmalogens were measured. ( C ) VLCFA (C24:0) level was measured. All data are presented as means ± S.D. ( n = 3, independent experiments), * p < 0.05.

    Journal: International Journal of Molecular Sciences

    Article Title: Knockdown of PEX16 Induces Autophagic Degradation of Peroxisomes

    doi: 10.3390/ijms22157989

    Figure Lengend Snippet: Peroxisome function is not recovered by chloroquine in cells with PEX16 knockdown. RPE-1 cells were treated with siRNA of either control or PEX16 for 12 h, followed by incubation with 5 μM chloroquine for 60 h. Under this condition, ( A ) the levels of cholesterol and ( B ) plasmalogens were measured. ( C ) VLCFA (C24:0) level was measured. All data are presented as means ± S.D. ( n = 3, independent experiments), * p < 0.05.

    Article Snippet: Reagents and antibodies used were as follows: anti-Calnexin (#ab22595, Abcam, Cambridge, MA, USA), anti-LC3 (#L8918, Sigma-Aldrich, St. Louis, MO, USA), anti-NBR1 (#16004-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX3 (#247042, Abcam), anti-PEX14 (#sc-23197, Santa Cruz Biotechnology, Dallas, TX, USA), anti-PEX16 (#14816-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX19 (#PA5-22129, Invitrogen, Carlsbad, CA, USA), anti-ABCD3 (#ab3421, Abcam, Cambridge, MA, USA and #SAB4200181, Sigma-Aldrich, St. Louis, MO, USA), anti-SQSTM1/p62 (#H00008878-M01, Abnova, Taipei, Taiwan), anti-VDAC (#55259-1-AP, Proteintech, Rosemont, IL, USA), anti-β-actin (#sc-47778, Santa Cruz Biotechnology, Dallas, TX, USA), and chloroquine (#C6628, Sigma-Aldrich, St. Louis, MO, USA).

    Techniques: Incubation

    Primer sequences used in the present study.

    Journal: International Journal of Molecular Sciences

    Article Title: Knockdown of PEX16 Induces Autophagic Degradation of Peroxisomes

    doi: 10.3390/ijms22157989

    Figure Lengend Snippet: Primer sequences used in the present study.

    Article Snippet: Reagents and antibodies used were as follows: anti-Calnexin (#ab22595, Abcam, Cambridge, MA, USA), anti-LC3 (#L8918, Sigma-Aldrich, St. Louis, MO, USA), anti-NBR1 (#16004-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX3 (#247042, Abcam), anti-PEX14 (#sc-23197, Santa Cruz Biotechnology, Dallas, TX, USA), anti-PEX16 (#14816-1-AP, Proteintech, Rosemont, IL, USA), anti-PEX19 (#PA5-22129, Invitrogen, Carlsbad, CA, USA), anti-ABCD3 (#ab3421, Abcam, Cambridge, MA, USA and #SAB4200181, Sigma-Aldrich, St. Louis, MO, USA), anti-SQSTM1/p62 (#H00008878-M01, Abnova, Taipei, Taiwan), anti-VDAC (#55259-1-AP, Proteintech, Rosemont, IL, USA), anti-β-actin (#sc-47778, Santa Cruz Biotechnology, Dallas, TX, USA), and chloroquine (#C6628, Sigma-Aldrich, St. Louis, MO, USA).

    Techniques:

    (A) Gene expression analysis in BAT, iWAT, and gWAT of WT mice kept at normal room temperature (RT) (22°C) or subjected to cold (4°C) exposure; n = 3–4. (B) Fluorescence microscopy analysis of COS-7 cells transfected with a GFP reporter under the control of a –2 kb Pex16 promoter alone or together with HA-PRDM16. Original magnification, ×20. (C) Luciferase reporter assay in COS-7 cells; n = 3. (D) BAT SVF cells expressing retrovirally encoded FLAG-PRDM16 were subjected to ChIP assay using an anti-FLAG antibody followed by qPCR using primers to amplify various regions of the Pex16 promoter; n = 6. *P < 0.05; **P < 0.01; ***P < 0.001. (E) Gene expression analysis in iWAT of control and adipose-specific PRDM16-KO (PRDM16-AKO) mice; n = 3. Data are expressed as mean ± SEM and were analyzed by Student’s t test. †P < 0.05 versus control RT; #P < 0.05 versus control cold.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) Gene expression analysis in BAT, iWAT, and gWAT of WT mice kept at normal room temperature (RT) (22°C) or subjected to cold (4°C) exposure; n = 3–4. (B) Fluorescence microscopy analysis of COS-7 cells transfected with a GFP reporter under the control of a –2 kb Pex16 promoter alone or together with HA-PRDM16. Original magnification, ×20. (C) Luciferase reporter assay in COS-7 cells; n = 3. (D) BAT SVF cells expressing retrovirally encoded FLAG-PRDM16 were subjected to ChIP assay using an anti-FLAG antibody followed by qPCR using primers to amplify various regions of the Pex16 promoter; n = 6. *P < 0.05; **P < 0.01; ***P < 0.001. (E) Gene expression analysis in iWAT of control and adipose-specific PRDM16-KO (PRDM16-AKO) mice; n = 3. Data are expressed as mean ± SEM and were analyzed by Student’s t test. †P < 0.05 versus control RT; #P < 0.05 versus control cold.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Expressing, Fluorescence, Microscopy, Transfection, Luciferase, Reporter Assay

    (A) Gene targeting strategy for Pex16 conditional knockout mice. (B) Analysis of Cre-mediated recombination by PCR. (C) Gene expression analysis; n = 3–6. (D) qPCR analysis demonstrating that Pex16 knockout does not affect gene expression of other peroxisomal genes in BAT; n = 5. (E) Immunofluorescence analysis using anti-PMP70–Atto 488 antibody in BAT of control and Pex16-AKO mice. Original magnification, ×60. (F) Western blot analysis in iWAT. Data in C and D are expressed as mean ± SEM and were analyzed by Student’s t test; ***P < 0.001.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) Gene targeting strategy for Pex16 conditional knockout mice. (B) Analysis of Cre-mediated recombination by PCR. (C) Gene expression analysis; n = 3–6. (D) qPCR analysis demonstrating that Pex16 knockout does not affect gene expression of other peroxisomal genes in BAT; n = 5. (E) Immunofluorescence analysis using anti-PMP70–Atto 488 antibody in BAT of control and Pex16-AKO mice. Original magnification, ×60. (F) Western blot analysis in iWAT. Data in C and D are expressed as mean ± SEM and were analyzed by Student’s t test; ***P < 0.001.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Knock-Out, Expressing, Immunofluorescence, Western Blot

    (A) Body weight of mice fed normal chow diet; n = 7–9. (B) Body weight of mice fed an HFD and maintained at 22°C; n = 9–11. (C) Body weight of mice fed an HFD and maintained at 30°C; n = 8. (D) MRI analysis of body composition in mice kept at room temperature after 20 weeks of high-fat feeding; n = 10. (E) Weight of gWAT from HFD-fed mice; n = 3. (F) H&E staining of gWAT from chow- and HFD-fed control and Pex16-AKO mice. The images are representative of 3 mice per genotype. (G) OCR (VO2) before and after intraperitoneal NE injection; n = 3–4. (H) H&E staining of BAT mice kept at room temperature or subjected to cold exposure. The images are representative of 3 mice per genotype. (I) Representative images (n = 3) of BAT from cold-treated mice. Original magnification, F and H, ×10. (J) Quantification of triglycerides (TG) in BAT; n = 3–4. (K) Rectal temperature of mice subjected to a 6-hour cold challenge; n = 7–9. (L) Kaplan-Meier survival curves of mice individually housed in InfraMot (TSE Systems) activity monitors stored at 4°C; n = 7–8. Data are expressed as mean ± SEM. Student’s t test was used for analysis of the data in B, D, E, and J. Two-way ANOVA with Bonferroni’s post hoc test was used for analysis of the data in G and K. To assess statistical significance in L, Mantel-Cox (log-rank) test was used. *P < 0.05; ***P < 0.001.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) Body weight of mice fed normal chow diet; n = 7–9. (B) Body weight of mice fed an HFD and maintained at 22°C; n = 9–11. (C) Body weight of mice fed an HFD and maintained at 30°C; n = 8. (D) MRI analysis of body composition in mice kept at room temperature after 20 weeks of high-fat feeding; n = 10. (E) Weight of gWAT from HFD-fed mice; n = 3. (F) H&E staining of gWAT from chow- and HFD-fed control and Pex16-AKO mice. The images are representative of 3 mice per genotype. (G) OCR (VO2) before and after intraperitoneal NE injection; n = 3–4. (H) H&E staining of BAT mice kept at room temperature or subjected to cold exposure. The images are representative of 3 mice per genotype. (I) Representative images (n = 3) of BAT from cold-treated mice. Original magnification, F and H, ×10. (J) Quantification of triglycerides (TG) in BAT; n = 3–4. (K) Rectal temperature of mice subjected to a 6-hour cold challenge; n = 7–9. (L) Kaplan-Meier survival curves of mice individually housed in InfraMot (TSE Systems) activity monitors stored at 4°C; n = 7–8. Data are expressed as mean ± SEM. Student’s t test was used for analysis of the data in B, D, E, and J. Two-way ANOVA with Bonferroni’s post hoc test was used for analysis of the data in G and K. To assess statistical significance in L, Mantel-Cox (log-rank) test was used. *P < 0.05; ***P < 0.001.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Staining, Injection, Activity Assay

    (A) TEM analysis of BAT from control and Pex16-AKO mice kept at room temperature or subjected to cold exposure. Peroxisomes (black dots) were detected by staining using DAB. Note the difference in mitochondrial morphology between the genotypes at 4°C. Scale bars: 500 nm. P, peroxisome; M, mitochondria; LD, lipid droplet. (B) Aspect ratio (ratio of major axis length to minor axis length) measured in BAT mitochondria. The data are based on 15 mitochondria per condition. (C) Number of mitochondria per cell based on TEM images of BAT taken at ×1000–×2000 magnification. Data are the average of 8 cells per condition. (D and E) mtDNA copy number normalized to nuclear DNA measured by qPCR in BAT and iWAT; for BAT, n = 6 per genotype at 22°C and 3 per genotype at 4°C; for iWAT, n = 4 per genotype under each condition. (F) Gene expression analysis in BAT of cold-treated mice; n = 4–5. Data are expressed as mean ± SEM and were analyzed by 1-way ANOVA followed by Fisher’s least significant difference (LSD) test (B–E) or by Student’s t test (F); *P < 0.05; **P < 0.01; ***P < 0.001.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) TEM analysis of BAT from control and Pex16-AKO mice kept at room temperature or subjected to cold exposure. Peroxisomes (black dots) were detected by staining using DAB. Note the difference in mitochondrial morphology between the genotypes at 4°C. Scale bars: 500 nm. P, peroxisome; M, mitochondria; LD, lipid droplet. (B) Aspect ratio (ratio of major axis length to minor axis length) measured in BAT mitochondria. The data are based on 15 mitochondria per condition. (C) Number of mitochondria per cell based on TEM images of BAT taken at ×1000–×2000 magnification. Data are the average of 8 cells per condition. (D and E) mtDNA copy number normalized to nuclear DNA measured by qPCR in BAT and iWAT; for BAT, n = 6 per genotype at 22°C and 3 per genotype at 4°C; for iWAT, n = 4 per genotype under each condition. (F) Gene expression analysis in BAT of cold-treated mice; n = 4–5. Data are expressed as mean ± SEM and were analyzed by 1-way ANOVA followed by Fisher’s least significant difference (LSD) test (B–E) or by Student’s t test (F); *P < 0.05; **P < 0.01; ***P < 0.001.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Staining, Expressing

    (A and B) BAT SVF cells were subjected to brown adipogenesis for 4 days and then treated with scrambled (SC) or Pex16 shRNA and analyzed after an additional 5 days using immunoblotting and mtDNA content measurement by qPCR. n = 3 in B. KD, knockdown. (C) BAT SVF cells stably expressing stably expressing Mito-roGFP were differentiated into adipocytes and then treated with scrambled or Pex16 shRNA in the presence or absence of Mdivi-1 and analyzed 5 days later for mitochondrial morphology using confocal microscopy. Images are representative of 3 separate experiments. Original magnification, ×60. (D) Quantification of mitochondrial morphology of the cells in C. (E) Effect of Pex16 knockdown on OCR measured in BAT SVF cells using a Seahorse XF24 Extracellular Flux Analyzer; n = 5. AA+R, mixture of antimycin A and rotenone. (F and G) Measurement of mitochondrial respiration using an OROBOROS Oxygraph system in permeabilized BAT and iWAT from control and Pex16-AKO mice following sequential additions of octanoyl-l-carnitine (OC); pyruvate (Pyr); glutamate and malate (G+M); adenosine diphosphate and succinate (ADP+S); and FCCP; n = 4–5. Data are expressed as mean ± SEM and were analyzed by Student’s t test; *P < 0.05; **P < 0.01.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A and B) BAT SVF cells were subjected to brown adipogenesis for 4 days and then treated with scrambled (SC) or Pex16 shRNA and analyzed after an additional 5 days using immunoblotting and mtDNA content measurement by qPCR. n = 3 in B. KD, knockdown. (C) BAT SVF cells stably expressing stably expressing Mito-roGFP were differentiated into adipocytes and then treated with scrambled or Pex16 shRNA in the presence or absence of Mdivi-1 and analyzed 5 days later for mitochondrial morphology using confocal microscopy. Images are representative of 3 separate experiments. Original magnification, ×60. (D) Quantification of mitochondrial morphology of the cells in C. (E) Effect of Pex16 knockdown on OCR measured in BAT SVF cells using a Seahorse XF24 Extracellular Flux Analyzer; n = 5. AA+R, mixture of antimycin A and rotenone. (F and G) Measurement of mitochondrial respiration using an OROBOROS Oxygraph system in permeabilized BAT and iWAT from control and Pex16-AKO mice following sequential additions of octanoyl-l-carnitine (OC); pyruvate (Pyr); glutamate and malate (G+M); adenosine diphosphate and succinate (ADP+S); and FCCP; n = 4–5. Data are expressed as mean ± SEM and were analyzed by Student’s t test; *P < 0.05; **P < 0.01.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: shRNA, Western Blot, Stable Transfection, Expressing, Confocal Microscopy

    (A) Analysis of Cre-mediated recombination by PCR. (B) Western blot analysis in BAT, iWAT, and gWAT. (C) Gene expression analysis by qPCR in BAT; n = 4–6. (D) OCR (VO2) measured in control and Pex16-BKO mice using indirect calorimetry before and after intraperitoneal NE injection; n = 4. (E) Rectal temperature of control and Pex16-BKO mice subjected to a 6-hour cold challenge; n = 5–6. (F) qPCR analysis in iWAT of mice subjected to an overnight cold exposure; n = 4–6. Data are expressed as mean ± SEM and were analyzed by Student’s t test (C and F) or 2-way ANOVA with Bonferroni’s post hoc test (D and E). *P < 0.05.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) Analysis of Cre-mediated recombination by PCR. (B) Western blot analysis in BAT, iWAT, and gWAT. (C) Gene expression analysis by qPCR in BAT; n = 4–6. (D) OCR (VO2) measured in control and Pex16-BKO mice using indirect calorimetry before and after intraperitoneal NE injection; n = 4. (E) Rectal temperature of control and Pex16-BKO mice subjected to a 6-hour cold challenge; n = 5–6. (F) qPCR analysis in iWAT of mice subjected to an overnight cold exposure; n = 4–6. Data are expressed as mean ± SEM and were analyzed by Student’s t test (C and F) or 2-way ANOVA with Bonferroni’s post hoc test (D and E). *P < 0.05.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Western Blot, Expressing, Injection

    (A) mRNA levels of FAO genes in BAT of control and Pex16-AKO mice; n = 3–13. (B and C) β-Oxidation of lignoceric acid (C24:0) and palmitic acid (C16:0) in BAT; n = 6–7. (D) Gene targeting strategy using CRISPR/Cas9 to insert loxP sites into the Acox1 locus. The floxed mice were crossed with an adiponectin-Cre mouse to generate Acox1-AKO mice. gRNA, guide RNA; ssODN, single-stranded oligodeoxyribonucleotide. (E) qPCR analysis of FAO and peroxisomal biogenesis genes; n = 3. (F) Western blot analysis of Acox1 knockout in BAT and iWAT. (G) Control and Acox1-KO iWAT SVF cells were incubated with D3-C22:0, whose catabolism to D3-C16:0 was measured mass spectrometrically. FAO was expressed as ratio of D3-C16:0 to D3-C22:0; n = 4. (H) Body weight of control and Acox1-AKO mice fed an HFD and maintained at normal room temperature; n = 13–18. (I) Cold tolerance was determined by measuring rectal temperature at the indicated times after cold exposure; n = 4–5. (J) mtDNA content normalized to nuclear DNA in BAT of control and Acox1-AKO mice subjected to cold exposure; n = 3. Data are expressed as mean ± SEM. Student’s t test was used for analysis of the data in A–C, E, G, and J were analyzed by Student’s t test. Two-way ANOVA with Bonferroni’s post hoc test was used for analysis of the data in I. *P < 0.05; **P < 0.01; ***P < 0.001.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) mRNA levels of FAO genes in BAT of control and Pex16-AKO mice; n = 3–13. (B and C) β-Oxidation of lignoceric acid (C24:0) and palmitic acid (C16:0) in BAT; n = 6–7. (D) Gene targeting strategy using CRISPR/Cas9 to insert loxP sites into the Acox1 locus. The floxed mice were crossed with an adiponectin-Cre mouse to generate Acox1-AKO mice. gRNA, guide RNA; ssODN, single-stranded oligodeoxyribonucleotide. (E) qPCR analysis of FAO and peroxisomal biogenesis genes; n = 3. (F) Western blot analysis of Acox1 knockout in BAT and iWAT. (G) Control and Acox1-KO iWAT SVF cells were incubated with D3-C22:0, whose catabolism to D3-C16:0 was measured mass spectrometrically. FAO was expressed as ratio of D3-C16:0 to D3-C22:0; n = 4. (H) Body weight of control and Acox1-AKO mice fed an HFD and maintained at normal room temperature; n = 13–18. (I) Cold tolerance was determined by measuring rectal temperature at the indicated times after cold exposure; n = 4–5. (J) mtDNA content normalized to nuclear DNA in BAT of control and Acox1-AKO mice subjected to cold exposure; n = 3. Data are expressed as mean ± SEM. Student’s t test was used for analysis of the data in A–C, E, G, and J were analyzed by Student’s t test. Two-way ANOVA with Bonferroni’s post hoc test was used for analysis of the data in I. *P < 0.05; **P < 0.01; ***P < 0.001.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: CRISPR, Western Blot, Knock-Out, Incubation

    (A) Ether lipid synthetic pathway. The initial steps for synthesis of ether lipids, including plasmalogens, take place in peroxisomes, generating 1-O-alkyl-glycerol-3-phosphate (AGP), a precursor for ether-linked analogs of PC and phosphatidylethanolamine. DHAP, dihydroxyacetone phosphate. (B and C) Western blot analysis suggesting that ether lipid synthetic enzymes are degraded in BAT (B) and iWAT (C) of Pex16-AKO mice (D) Targeted lipidomics analysis of mitochondrial phospholipids in BAT of WT C57 mice. PS, phosphatidylserine; PG, phosphatidylglycerol; aPC, alkyl ether PC; pPC, plasmalogen PC; PE, phosphatidylethanolamine; pPE, plasmalogen PE; n = 5. (E) Levels of various plasmalogen PE species in the mitochondrial fraction of BAT; n = 9–10. (F) Total diacyl and plasmalogen PE content in BAT mitochondria. (G) BAT SVF cells stably expressing Mito-roGFP were differentiated into adipocytes and then treated with scrambled or GNPAT shRNA and analyzed 5 days later for mitochondrial morphology using confocal microscopy. Images are representative of 3 separate experiments. Original magnification, ×60. (H) Differentiated BAT SVF cells were treated with scrambled or GNPAT shRNA. Five days later, mtDNA copy number normalized to nuclear DNA was measured by qPCR; n = 5. (I) Effect of shRNA-mediated knockdown of GNPAT on OCR was measured in BAT SVF cells using a Seahorse XF24 Extracellular Flux Analyzer; n = 8. Data are expressed as mean ± SEM and were analyzed by Student’s t test. *P < 0.05.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) Ether lipid synthetic pathway. The initial steps for synthesis of ether lipids, including plasmalogens, take place in peroxisomes, generating 1-O-alkyl-glycerol-3-phosphate (AGP), a precursor for ether-linked analogs of PC and phosphatidylethanolamine. DHAP, dihydroxyacetone phosphate. (B and C) Western blot analysis suggesting that ether lipid synthetic enzymes are degraded in BAT (B) and iWAT (C) of Pex16-AKO mice (D) Targeted lipidomics analysis of mitochondrial phospholipids in BAT of WT C57 mice. PS, phosphatidylserine; PG, phosphatidylglycerol; aPC, alkyl ether PC; pPC, plasmalogen PC; PE, phosphatidylethanolamine; pPE, plasmalogen PE; n = 5. (E) Levels of various plasmalogen PE species in the mitochondrial fraction of BAT; n = 9–10. (F) Total diacyl and plasmalogen PE content in BAT mitochondria. (G) BAT SVF cells stably expressing Mito-roGFP were differentiated into adipocytes and then treated with scrambled or GNPAT shRNA and analyzed 5 days later for mitochondrial morphology using confocal microscopy. Images are representative of 3 separate experiments. Original magnification, ×60. (H) Differentiated BAT SVF cells were treated with scrambled or GNPAT shRNA. Five days later, mtDNA copy number normalized to nuclear DNA was measured by qPCR; n = 5. (I) Effect of shRNA-mediated knockdown of GNPAT on OCR was measured in BAT SVF cells using a Seahorse XF24 Extracellular Flux Analyzer; n = 8. Data are expressed as mean ± SEM and were analyzed by Student’s t test. *P < 0.05.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Western Blot, Stable Transfection, Expressing, shRNA, Confocal Microscopy

    (A) Mass spectrometric analysis of PE plasmalogens in the mitochondrial fractions from control and Pex16-AKO mice treated with or without AG for 8 weeks; n = 5. (B) TEM analysis of mitochondrial morphology in BAT of control and Pex16-AKO treated with or without AG, followed by cold exposure. Scale bar: 500 nm. (C) Aspect ratio measured in BAT mitochondria from control and Pex16-AKO mice. The data are based on 26 mitochondria per condition. (D) Number of mitochondria per cell based on TEM images of BAT taken at ×1000–×2000 magnification. The data are average of 6–8 cells per condition. (E) mtDNA measured by PCR in BAT of control and Pex16-AKO mice treated with or without AG, followed by cold exposure; n = 6–7. (F) VO2 was measured using indirect calorimetry before and after intraperitoneal NE injection; n = 8–9. (G). Cold tolerance was determined by measuring rectal temperature prior to and after 6 hours of cold exposure; n = 6–8. (H and I) Fatty acid and pyruvate oxidation assays in BAT; n = 3–4. Data are expressed as mean ± SEM and were analyzed by 1-way ANOVA, followed by Fisher’s LSD test (A, C–E, and G–I), or 2-way ANOVA with Bonferroni’s post hoc test (F); *P < 0.05; **P < 0.01; ***P < 0.001.

    Journal: The Journal of Clinical Investigation

    Article Title: Peroxisome-derived lipids regulate adipose thermogenesis by mediating cold-induced mitochondrial fission

    doi: 10.1172/JCI120606

    Figure Lengend Snippet: (A) Mass spectrometric analysis of PE plasmalogens in the mitochondrial fractions from control and Pex16-AKO mice treated with or without AG for 8 weeks; n = 5. (B) TEM analysis of mitochondrial morphology in BAT of control and Pex16-AKO treated with or without AG, followed by cold exposure. Scale bar: 500 nm. (C) Aspect ratio measured in BAT mitochondria from control and Pex16-AKO mice. The data are based on 26 mitochondria per condition. (D) Number of mitochondria per cell based on TEM images of BAT taken at ×1000–×2000 magnification. The data are average of 6–8 cells per condition. (E) mtDNA measured by PCR in BAT of control and Pex16-AKO mice treated with or without AG, followed by cold exposure; n = 6–7. (F) VO2 was measured using indirect calorimetry before and after intraperitoneal NE injection; n = 8–9. (G). Cold tolerance was determined by measuring rectal temperature prior to and after 6 hours of cold exposure; n = 6–8. (H and I) Fatty acid and pyruvate oxidation assays in BAT; n = 3–4. Data are expressed as mean ± SEM and were analyzed by 1-way ANOVA, followed by Fisher’s LSD test (A, C–E, and G–I), or 2-way ANOVA with Bonferroni’s post hoc test (F); *P < 0.05; **P < 0.01; ***P < 0.001.

    Article Snippet: Rabbit polyclonal antibodies against Pex16 (1:1000; catalog 14816-1-AP), Acox1 (1:1000; catalog 10957-1-AP), and GNPAT (1:1000; catalog 14931-1-AP) were from Proteintech.

    Techniques: Injection