120 bp fragment Promega Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 83
    Thermo Fisher polyacrylamide bisacrylamide
    Polyacrylamide Bisacrylamide, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/polyacrylamide bisacrylamide/product/Thermo Fisher
    Average 83 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    polyacrylamide bisacrylamide - by Bioz Stars, 2020-01
    83/100 stars
      Buy from Supplier

    79
    Qiagen caagcagaagacggcatacga gcctga attgatggtgcctacag qiaquick pcr purification kit
    Caagcagaagacggcatacga Gcctga Attgatggtgcctacag Qiaquick Pcr Purification Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/caagcagaagacggcatacga gcctga attgatggtgcctacag qiaquick pcr purification kit/product/Qiagen
    Average 79 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    caagcagaagacggcatacga gcctga attgatggtgcctacag qiaquick pcr purification kit - by Bioz Stars, 2020-01
    79/100 stars
      Buy from Supplier

    99
    Promega colorless gotaq flexi buffer
    Colorless Gotaq Flexi Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 272 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/colorless gotaq flexi buffer/product/Promega
    Average 99 stars, based on 272 article reviews
    Price from $9.99 to $1999.99
    colorless gotaq flexi buffer - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Promega pgem t plasmid
    Pgem T Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 996 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t plasmid/product/Promega
    Average 99 stars, based on 996 article reviews
    Price from $9.99 to $1999.99
    pgem t plasmid - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    85
    Promega pcr vector pgem t
    Pcr Vector Pgem T, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr vector pgem t/product/Promega
    Average 85 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    pcr vector pgem t - by Bioz Stars, 2020-01
    85/100 stars
      Buy from Supplier

    93
    GE Healthcare s utp
    S Utp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 559 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/s utp/product/GE Healthcare
    Average 93 stars, based on 559 article reviews
    Price from $9.99 to $1999.99
    s utp - by Bioz Stars, 2020-01
    93/100 stars
      Buy from Supplier

    99
    Roche dig rna labelling kit
    Dig Rna Labelling Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1059 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dig rna labelling kit/product/Roche
    Average 99 stars, based on 1059 article reviews
    Price from $9.99 to $1999.99
    dig rna labelling kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    Millipore ammonium persulfate
    Ammonium Persulfate, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1124 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ammonium persulfate/product/Millipore
    Average 99 stars, based on 1124 article reviews
    Price from $9.99 to $1999.99
    ammonium persulfate - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results