α 32 p atp Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher t4 kinase
    T4 Kinase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 627 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 kinase/product/Thermo Fisher
    Average 99 stars, based on 627 article reviews
    Price from $9.99 to $1999.99
    t4 kinase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    PerkinElmer alpha 32 p atp
    A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) <t>ATP</t> hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009
    Alpha 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 94/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha 32 p atp/product/PerkinElmer
    Average 94 stars, based on 62 article reviews
    Price from $9.99 to $1999.99
    alpha 32 p atp - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    91
    GE Healthcare α 32 p atp
    A novel SBD mutant exhibits impaired chaperone holdase activity but retains Hsp70 nucleotide exchange capacity. (A) Crystal structure of the Sse1 β-domain, with amino acids selected for mutations highlighted in red ( Xu et al. , 2012 ). (B) Fluorescence anisotropy was performed with increasing concentrations of chaperone (Sse1 or Sse1 sbd ) binding fluorescently labeled <t>ATP-FAM.</t> (C) Nucleotide exchange activity assays using HSPA8 (Hsp70) prebound to α- 32 P-ATP in the presence or absence of Sse1. (D) Holdase experiments were conducted using chemically denatured FFL (200 nM) diluted into refolding buffer without chaperone (no chap), with Sse1 (400 nM), or with Sse1 sbd (400 nM). FFL diluted into denaturing buffer instead of folding buffer was used as an aggregation control (denat). (E) Differential centrifugation analysis of FFL aggregation in the absence of chaperone or with Sse1 or Sse1 sbd after a 30-min holdase assay. Samples were visualized by SDS–PAGE, followed by Coomassie stain, and scanning densitometry quantitation was performed to determine FFL aggregation under each condition. (F) Endpoint analysis of holdase experiments performed as in D, using denatured FFL with varying ratios of chaperone to substrate, quantified as fraction of total aggregation.
    α 32 P Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 91/100, based on 695 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/GE Healthcare
    Average 91 stars, based on 695 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    HARTMANN ANALYTIC α 32 p atp
    AP hydrolyzes [γ- 32 <t>P]ATP</t> and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.
    α 32 P Atp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 94/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/HARTMANN ANALYTIC
    Average 94 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    93
    DuPont de Nemours α 32 p atp
    Effect of CoA and organic acids on the synthesis of p 4 A catalyzed by acyl-CoA synthetase. (A) Effect of CoA on the synthesis of p 4 A. The reaction mixture (50 μl) contained 50 mM MES-KOH (pH 6.3), 0.1 mM dithiothreitol, 11 mM MgCl 2 , 1 mM [2,8- 3 <t>H]ATP,</t> 10 mM P 3 , and the indicated concentrations of CoA and acyl-CoA synthetase (8.3 μg of protein). (B) Effect of organic acids on the inhibitory effect of CoA on the synthesis of p 4 A. Reaction mixtures (28 μl) containing 72 mM MES-KOH (pH 6.3), 0.14 mM dithiothreitol, 7.9 mM MgCl 2 , 0.76 mM [α- 32 P]ATP, 7.2 mM P 3 , 0.14 mM CoA, 0.7 μl of desalted inorganic pyrophosphatase, and acyl-CoA synthetase (5.2 μg of protein) were preincubated at 30°C for 20 min. Thereafter, they were supplemented with 12 μl of the following solutions: water (lane b), 1% Triton X-100–5% ethanol (solution C; lane c), 1 mM solutions of palmitic acid in solution C (lane d), octanoic acid in water (lane e), or other possible effectors (acetic acid, lysine, methionine, phenylalanine, tryptophan, and luciferin; lanes f to k, respectively). One hour after the addition of organic acids, aliquots of the reaction were analyzed by TLC. Control without acyl-CoA synthetase is shown in lane a.
    α 32 P Atp, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 93/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/DuPont de Nemours
    Average 93 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    87
    Valiant α 32 p atp
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 87/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Valiant
    Average 87 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    85
    ICN Pharmaceuticals α 32 p atp
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    α 32 P Atp, supplied by ICN Pharmaceuticals, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/ICN Pharmaceuticals
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    86
    NEN Life Science α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    α 32 P Atp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 86/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/NEN Life Science
    Average 86 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    GE Healthcare α 32 p dideoxy atp
    Autoradiograms of agarose gels showing DNA breakdown after intrastriatal NMDA injection (20 nmol). Brains were removed rapidly, and 2-mm-thick coronal slices were cut. DNA was isolated from the second slice containing both cortex and striatum, and a [ 32 <t>P]dideoxy-ATP</t> end-labeling method with terminal transferase was performed. A , DNA breakdown both in the form of nonspecific fragmentation (smearing) and oligonucleosomal breakdown (laddering) appears at 12–24 hr and intensifies 48 hr after NMDA in SV129 mice. Each lane contains tissue obtained from different animals killed at 12, 24, and 48 hr after NMDA injection. B , Both nonspecific DNA fragmentation and oligonucleosomal breakdown are observed to a lesser extent in nNOS −/− compared with nNOS +/+ littermates 48 hr after NMDA. The gel is representative of three independent experiments. M , Molecular weight marker.
    α 32 P Dideoxy Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p dideoxy atp/product/GE Healthcare
    Average 86 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    α 32 p dideoxy atp - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    94
    PerkinElmer nucleotide α 32 p atp
    Autoradiograms of agarose gels showing DNA breakdown after intrastriatal NMDA injection (20 nmol). Brains were removed rapidly, and 2-mm-thick coronal slices were cut. DNA was isolated from the second slice containing both cortex and striatum, and a [ 32 <t>P]dideoxy-ATP</t> end-labeling method with terminal transferase was performed. A , DNA breakdown both in the form of nonspecific fragmentation (smearing) and oligonucleosomal breakdown (laddering) appears at 12–24 hr and intensifies 48 hr after NMDA in SV129 mice. Each lane contains tissue obtained from different animals killed at 12, 24, and 48 hr after NMDA injection. B , Both nonspecific DNA fragmentation and oligonucleosomal breakdown are observed to a lesser extent in nNOS −/− compared with nNOS +/+ littermates 48 hr after NMDA. The gel is representative of three independent experiments. M , Molecular weight marker.
    Nucleotide α 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleotide α 32 p atp/product/PerkinElmer
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    nucleotide α 32 p atp - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    92
    Valiant mci α 32 p atp
    Autoradiograms of agarose gels showing DNA breakdown after intrastriatal NMDA injection (20 nmol). Brains were removed rapidly, and 2-mm-thick coronal slices were cut. DNA was isolated from the second slice containing both cortex and striatum, and a [ 32 <t>P]dideoxy-ATP</t> end-labeling method with terminal transferase was performed. A , DNA breakdown both in the form of nonspecific fragmentation (smearing) and oligonucleosomal breakdown (laddering) appears at 12–24 hr and intensifies 48 hr after NMDA in SV129 mice. Each lane contains tissue obtained from different animals killed at 12, 24, and 48 hr after NMDA injection. B , Both nonspecific DNA fragmentation and oligonucleosomal breakdown are observed to a lesser extent in nNOS −/− compared with nNOS +/+ littermates 48 hr after NMDA. The gel is representative of three independent experiments. M , Molecular weight marker.
    Mci α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mci α 32 p atp/product/Valiant
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mci α 32 p atp - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    89
    PerkinElmer α 32 p labeled atp
    Autoradiograms of agarose gels showing DNA breakdown after intrastriatal NMDA injection (20 nmol). Brains were removed rapidly, and 2-mm-thick coronal slices were cut. DNA was isolated from the second slice containing both cortex and striatum, and a [ 32 <t>P]dideoxy-ATP</t> end-labeling method with terminal transferase was performed. A , DNA breakdown both in the form of nonspecific fragmentation (smearing) and oligonucleosomal breakdown (laddering) appears at 12–24 hr and intensifies 48 hr after NMDA in SV129 mice. Each lane contains tissue obtained from different animals killed at 12, 24, and 48 hr after NMDA injection. B , Both nonspecific DNA fragmentation and oligonucleosomal breakdown are observed to a lesser extent in nNOS −/− compared with nNOS +/+ littermates 48 hr after NMDA. The gel is representative of three independent experiments. M , Molecular weight marker.
    α 32 P Labeled Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 89/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p labeled atp/product/PerkinElmer
    Average 89 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    α 32 p labeled atp - by Bioz Stars, 2020-04
    89/100 stars
      Buy from Supplier

    91
    HARTMANN ANALYTIC α 32 p atp utp
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    α 32 P Atp Utp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp utp/product/HARTMANN ANALYTIC
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp utp - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    93
    PerkinElmer ci mmol 32 p α atp
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    Ci Mmol 32 P α Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ci mmol 32 p α atp/product/PerkinElmer
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    ci mmol 32 p α atp - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    86
    Promega α 32 p atp
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    α 32 P Atp, supplied by Promega, used in various techniques. Bioz Stars score: 86/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Promega
    Average 86 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    93
    Thermo Fisher α 32 p atp
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    α 32 P Atp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 220 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Thermo Fisher
    Average 93 stars, based on 220 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    86
    ICN Biomedicals α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by ICN Biomedicals, used in various techniques. Bioz Stars score: 86/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/ICN Biomedicals
    Average 86 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    85
    GeneWorks α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by GeneWorks, used in various techniques. Bioz Stars score: 85/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/GeneWorks
    Average 85 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    91
    Millipore α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by Millipore, used in various techniques. Bioz Stars score: 91/100, based on 81 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Millipore
    Average 91 stars, based on 81 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    94
    PerkinElmer mbq α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Mbq α 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 94/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mbq α 32 p atp/product/PerkinElmer
    Average 94 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    mbq α 32 p atp - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    87
    GE Healthcare mbq α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Mbq α 32 P Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 87/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mbq α 32 p atp/product/GE Healthcare
    Average 87 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    mbq α 32 p atp - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    92
    Valiant radioactive α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Radioactive α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/radioactive α 32 p atp/product/Valiant
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    radioactive α 32 p atp - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    91
    PerkinElmer α 32 p atp radionucleotide
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Atp Radionucleotide, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp radionucleotide/product/PerkinElmer
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp radionucleotide - by Bioz Stars, 2020-04
    91/100 stars
      Buy from Supplier

    81
    DuPont de Nemours α 32 p atp nen dupont
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Atp Nen Dupont, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 81/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp nen dupont/product/DuPont de Nemours
    Average 81 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp nen dupont - by Bioz Stars, 2020-04
    81/100 stars
      Buy from Supplier

    85
    PerkinElmer trace α32 p atp
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Trace α32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 85/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trace α32 p atp/product/PerkinElmer
    Average 85 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    trace α32 p atp - by Bioz Stars, 2020-04
    85/100 stars
      Buy from Supplier

    81
    GE Healthcare α 32 p labeled atp
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    α 32 P Labeled Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 81/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p labeled atp/product/GE Healthcare
    Average 81 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    α 32 p labeled atp - by Bioz Stars, 2020-04
    81/100 stars
      Buy from Supplier

    94
    PerkinElmer atp α 32p easytide
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    Atp α 32p Easytide, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 94/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atp α 32p easytide/product/PerkinElmer
    Average 94 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    atp α 32p easytide - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    PerkinElmer atp α 32p easytide lead
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    Atp α 32p Easytide Lead, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atp α 32p easytide lead/product/PerkinElmer
    Average 99 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    atp α 32p easytide lead - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    PerkinElmer 3000 ci mmol α 32 p labeled atp
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    3000 Ci Mmol α 32 P Labeled Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3000 ci mmol α 32 p labeled atp/product/PerkinElmer
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    3000 ci mmol α 32 p labeled atp - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    94
    PerkinElmer α32 p atp 3000 ci mmol
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    α32 P Atp 3000 Ci Mmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 94/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α32 p atp 3000 ci mmol/product/PerkinElmer
    Average 94 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    α32 p atp 3000 ci mmol - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    90
    GE Healthcare α 32 p datp
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    α 32 P Datp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 90/100, based on 2296 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p datp/product/GE Healthcare
    Average 90 stars, based on 2296 article reviews
    Price from $9.99 to $1999.99
    α 32 p datp - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    84
    DuPont de Nemours α 32 p deoxy atp
    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled <t>ATP</t> or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.
    α 32 P Deoxy Atp, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p deoxy atp/product/DuPont de Nemours
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    α 32 p deoxy atp - by Bioz Stars, 2020-04
    84/100 stars
      Buy from Supplier

    Image Search Results


    A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009

    Journal: eLife

    Article Title: Redox signaling via the molecular chaperone BiP protects cells against endoplasmic reticulum-derived oxidative stress

    doi: 10.7554/eLife.03496

    Figure Lengend Snippet: A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009

    Article Snippet: ATPase activity To measure ATPase activity, 1 µM C-terminally tagged Kar2 and 2.5 µM GST-Sec63J were incubated with 0.1 mM of cold ATP and 0.45 µCi of [alpha-32 P]ATP (Perkin–Elmer, Waltham, MA) in ATPase buffer (50 mM Tris–HCl, pH 7.4, 50 mM KCl, 5 mM MgCl2 , 1 mM DTT) in a total volume of 45 µl at room temperature.

    Techniques: Mutagenesis, Plasmid Preparation, Incubation, Cell Culture, Activity Assay

    Replacement of the BiP cysteine with aspartic acid, phenylalanine, tyrosine, or tryptophan results in decreased BiP function. ( A ) CSY214 containing the plasmids pCS681, pCS802, pCS687, pCS688, pCS750 or empty vector were spotted onto SMM plates with or without 5-fluoroorotic acid (5-FOA) and incubated for 2 d at 30°C. ( B ) CSY289, 290, 368, 292, and 293 were spotted onto YPD plates and incubated at 24°, 30°, and 37°C. ( C ) Strains from B were cultured at 24°C to log-phase in YPD and shifted to 37°C for 90 min prior to harvest. Accumulation of unprocessed untranslocated forms of the proteins Kar2, PDI, and Gas1 were detected by western blotting. ( D ) Strains from B containing an UPRE- lacZ reporter plasmid (pJC8) were cultured in SMM-ura at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Samples were assayed for beta–galactosidase activity. Three independent transformants of each strain were grown and assayed in duplicate. Data represent the mean of averaged values for the three transformants ± SD. ( E – G ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Panels F and G show CHP and NEM-treated samples, respectively. Samples without chemical additions in panels F and G were mock treated to match the CHP or NEM-treatment. Data represent the means ± SD of three independent assays. DOI: http://dx.doi.org/10.7554/eLife.03496.007

    Journal: eLife

    Article Title: Redox signaling via the molecular chaperone BiP protects cells against endoplasmic reticulum-derived oxidative stress

    doi: 10.7554/eLife.03496

    Figure Lengend Snippet: Replacement of the BiP cysteine with aspartic acid, phenylalanine, tyrosine, or tryptophan results in decreased BiP function. ( A ) CSY214 containing the plasmids pCS681, pCS802, pCS687, pCS688, pCS750 or empty vector were spotted onto SMM plates with or without 5-fluoroorotic acid (5-FOA) and incubated for 2 d at 30°C. ( B ) CSY289, 290, 368, 292, and 293 were spotted onto YPD plates and incubated at 24°, 30°, and 37°C. ( C ) Strains from B were cultured at 24°C to log-phase in YPD and shifted to 37°C for 90 min prior to harvest. Accumulation of unprocessed untranslocated forms of the proteins Kar2, PDI, and Gas1 were detected by western blotting. ( D ) Strains from B containing an UPRE- lacZ reporter plasmid (pJC8) were cultured in SMM-ura at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Samples were assayed for beta–galactosidase activity. Three independent transformants of each strain were grown and assayed in duplicate. Data represent the mean of averaged values for the three transformants ± SD. ( E – G ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Panels F and G show CHP and NEM-treated samples, respectively. Samples without chemical additions in panels F and G were mock treated to match the CHP or NEM-treatment. Data represent the means ± SD of three independent assays. DOI: http://dx.doi.org/10.7554/eLife.03496.007

    Article Snippet: ATPase activity To measure ATPase activity, 1 µM C-terminally tagged Kar2 and 2.5 µM GST-Sec63J were incubated with 0.1 mM of cold ATP and 0.45 µCi of [alpha-32 P]ATP (Perkin–Elmer, Waltham, MA) in ATPase buffer (50 mM Tris–HCl, pH 7.4, 50 mM KCl, 5 mM MgCl2 , 1 mM DTT) in a total volume of 45 µl at room temperature.

    Techniques: Plasmid Preparation, Incubation, Cell Culture, Western Blot, Activity Assay

    Labeling and biochemical characterization of T7 RNAP activity. ( A ) Synthesis of Cy5-conjugated HaloTag Ligand ( S3 ) used to label RNAP from Cy5 acid S1 and HaloTag ligand-amine S2 . See ‘Materials and methods’ for details. ( B ) SDS-PAGE gel images of the unlabeled (‘RNAP’: no HaloTag; ‘Halo-RNAP’: with HaloTag) and the Cy5-labeled Halo-RNAP (‘Cy5-Halo-RNAP’) T7 RNAP. All RNAPs have a 6(His) tag at the N-terminus used for purification. Top: image stained with Coomassie Brilliant Blue. Bottom: the same gel scanned for Cy5 fluorescence (prior to Coomassie staining). ( C ) In vitro transcription activity of RNAP. The concentrations of RNAP derivatives were as indicated. The DNA template (a PCR fragment spanning from −75 to +295 of the concensus T7 RNAP promoter), was used at 10 nM. RNA products were labeled by incorporation of α 32 P-ATP, resolved on a denaturing polyacrylamide gel, and imaged by autoradiography. The major bands at ∼295 nt are the expected run-off products. DOI: http://dx.doi.org/10.7554/eLife.01775.009

    Journal: eLife

    Article Title: Single-molecule tracking of the transcription cycle by sub-second RNA detection

    doi: 10.7554/eLife.01775

    Figure Lengend Snippet: Labeling and biochemical characterization of T7 RNAP activity. ( A ) Synthesis of Cy5-conjugated HaloTag Ligand ( S3 ) used to label RNAP from Cy5 acid S1 and HaloTag ligand-amine S2 . See ‘Materials and methods’ for details. ( B ) SDS-PAGE gel images of the unlabeled (‘RNAP’: no HaloTag; ‘Halo-RNAP’: with HaloTag) and the Cy5-labeled Halo-RNAP (‘Cy5-Halo-RNAP’) T7 RNAP. All RNAPs have a 6(His) tag at the N-terminus used for purification. Top: image stained with Coomassie Brilliant Blue. Bottom: the same gel scanned for Cy5 fluorescence (prior to Coomassie staining). ( C ) In vitro transcription activity of RNAP. The concentrations of RNAP derivatives were as indicated. The DNA template (a PCR fragment spanning from −75 to +295 of the concensus T7 RNAP promoter), was used at 10 nM. RNA products were labeled by incorporation of α 32 P-ATP, resolved on a denaturing polyacrylamide gel, and imaged by autoradiography. The major bands at ∼295 nt are the expected run-off products. DOI: http://dx.doi.org/10.7554/eLife.01775.009

    Article Snippet: In ensemble measurements, 10 nM DNA template (same PCR fragment as used in single-molecule assays), 0.17 μCi/μl α-32 P-ATP (Perkin Elmer, Waltham, MA) and different concentrations of RNAP were also included in the reaction.

    Techniques: Labeling, Activity Assay, SDS Page, Purification, Staining, Fluorescence, In Vitro, Polymerase Chain Reaction, Autoradiography

    A novel SBD mutant exhibits impaired chaperone holdase activity but retains Hsp70 nucleotide exchange capacity. (A) Crystal structure of the Sse1 β-domain, with amino acids selected for mutations highlighted in red ( Xu et al. , 2012 ). (B) Fluorescence anisotropy was performed with increasing concentrations of chaperone (Sse1 or Sse1 sbd ) binding fluorescently labeled ATP-FAM. (C) Nucleotide exchange activity assays using HSPA8 (Hsp70) prebound to α- 32 P-ATP in the presence or absence of Sse1. (D) Holdase experiments were conducted using chemically denatured FFL (200 nM) diluted into refolding buffer without chaperone (no chap), with Sse1 (400 nM), or with Sse1 sbd (400 nM). FFL diluted into denaturing buffer instead of folding buffer was used as an aggregation control (denat). (E) Differential centrifugation analysis of FFL aggregation in the absence of chaperone or with Sse1 or Sse1 sbd after a 30-min holdase assay. Samples were visualized by SDS–PAGE, followed by Coomassie stain, and scanning densitometry quantitation was performed to determine FFL aggregation under each condition. (F) Endpoint analysis of holdase experiments performed as in D, using denatured FFL with varying ratios of chaperone to substrate, quantified as fraction of total aggregation.

    Journal: Molecular Biology of the Cell

    Article Title: Substrate binding by the yeast Hsp110 nucleotide exchange factor and molecular chaperone Sse1 is not obligate for its biological activities

    doi: 10.1091/mbc.E17-01-0070

    Figure Lengend Snippet: A novel SBD mutant exhibits impaired chaperone holdase activity but retains Hsp70 nucleotide exchange capacity. (A) Crystal structure of the Sse1 β-domain, with amino acids selected for mutations highlighted in red ( Xu et al. , 2012 ). (B) Fluorescence anisotropy was performed with increasing concentrations of chaperone (Sse1 or Sse1 sbd ) binding fluorescently labeled ATP-FAM. (C) Nucleotide exchange activity assays using HSPA8 (Hsp70) prebound to α- 32 P-ATP in the presence or absence of Sse1. (D) Holdase experiments were conducted using chemically denatured FFL (200 nM) diluted into refolding buffer without chaperone (no chap), with Sse1 (400 nM), or with Sse1 sbd (400 nM). FFL diluted into denaturing buffer instead of folding buffer was used as an aggregation control (denat). (E) Differential centrifugation analysis of FFL aggregation in the absence of chaperone or with Sse1 or Sse1 sbd after a 30-min holdase assay. Samples were visualized by SDS–PAGE, followed by Coomassie stain, and scanning densitometry quantitation was performed to determine FFL aggregation under each condition. (F) Endpoint analysis of holdase experiments performed as in D, using denatured FFL with varying ratios of chaperone to substrate, quantified as fraction of total aggregation.

    Article Snippet: HSPA8 (70 µg) was loaded with 100 µCi of α-32 P-ATP in a total volume of 120 µl of complex buffer (25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES]–KOH, pH 7.5, 100 mM KCl, 11 mM MgOAc, and 25 µM ATP) for 30 min at 4°C, and HSPA8–32 P-ATP complex was obtained by centrifugation through a Microspin G-25 column (GE Healthcare, Chicago, IL).

    Techniques: Mutagenesis, Activity Assay, Fluorescence, Binding Assay, Labeling, Centrifugation, SDS Page, Staining, Quantitation Assay

    AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation, SDS Page, Autoradiography

    Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation

    Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation, SDS Page, Autoradiography

    Effect of CoA and organic acids on the synthesis of p 4 A catalyzed by acyl-CoA synthetase. (A) Effect of CoA on the synthesis of p 4 A. The reaction mixture (50 μl) contained 50 mM MES-KOH (pH 6.3), 0.1 mM dithiothreitol, 11 mM MgCl 2 , 1 mM [2,8- 3 H]ATP, 10 mM P 3 , and the indicated concentrations of CoA and acyl-CoA synthetase (8.3 μg of protein). (B) Effect of organic acids on the inhibitory effect of CoA on the synthesis of p 4 A. Reaction mixtures (28 μl) containing 72 mM MES-KOH (pH 6.3), 0.14 mM dithiothreitol, 7.9 mM MgCl 2 , 0.76 mM [α- 32 P]ATP, 7.2 mM P 3 , 0.14 mM CoA, 0.7 μl of desalted inorganic pyrophosphatase, and acyl-CoA synthetase (5.2 μg of protein) were preincubated at 30°C for 20 min. Thereafter, they were supplemented with 12 μl of the following solutions: water (lane b), 1% Triton X-100–5% ethanol (solution C; lane c), 1 mM solutions of palmitic acid in solution C (lane d), octanoic acid in water (lane e), or other possible effectors (acetic acid, lysine, methionine, phenylalanine, tryptophan, and luciferin; lanes f to k, respectively). One hour after the addition of organic acids, aliquots of the reaction were analyzed by TLC. Control without acyl-CoA synthetase is shown in lane a.

    Journal: Journal of Bacteriology

    Article Title: Acyl Coenzyme A Synthetase from Pseudomonas fragi Catalyzes the Synthesis of Adenosine 5?-Polyphosphates and Dinucleoside Polyphosphates †

    doi:

    Figure Lengend Snippet: Effect of CoA and organic acids on the synthesis of p 4 A catalyzed by acyl-CoA synthetase. (A) Effect of CoA on the synthesis of p 4 A. The reaction mixture (50 μl) contained 50 mM MES-KOH (pH 6.3), 0.1 mM dithiothreitol, 11 mM MgCl 2 , 1 mM [2,8- 3 H]ATP, 10 mM P 3 , and the indicated concentrations of CoA and acyl-CoA synthetase (8.3 μg of protein). (B) Effect of organic acids on the inhibitory effect of CoA on the synthesis of p 4 A. Reaction mixtures (28 μl) containing 72 mM MES-KOH (pH 6.3), 0.14 mM dithiothreitol, 7.9 mM MgCl 2 , 0.76 mM [α- 32 P]ATP, 7.2 mM P 3 , 0.14 mM CoA, 0.7 μl of desalted inorganic pyrophosphatase, and acyl-CoA synthetase (5.2 μg of protein) were preincubated at 30°C for 20 min. Thereafter, they were supplemented with 12 μl of the following solutions: water (lane b), 1% Triton X-100–5% ethanol (solution C; lane c), 1 mM solutions of palmitic acid in solution C (lane d), octanoic acid in water (lane e), or other possible effectors (acetic acid, lysine, methionine, phenylalanine, tryptophan, and luciferin; lanes f to k, respectively). One hour after the addition of organic acids, aliquots of the reaction were analyzed by TLC. Control without acyl-CoA synthetase is shown in lane a.

    Article Snippet: [2,8-3 H]ATP (45 Ci/mmol) was from Amersham Life Sciences, and [α-32 P]ATP was from DuPont NEN.

    Techniques: Thin Layer Chromatography

    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 P]ATP-labeled pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in

    Journal: RNA

    Article Title: Dynamic guide-target interactions contribute to sequential 2?-O-methylation by a unique archaeal dual guide box C/D sRNP

    doi: 10.1261/rna.1003308

    Figure Lengend Snippet: Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 P]ATP-labeled pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in

    Article Snippet: A typical 100 μL transcription reaction performed at 37°C for 3–4 h contained 40 mM Tris-Cl, pH 7.9, 6 mM MgCl2 , 10 mM DTT (dithiothreitol), 2 mM spermidine, 20 μCi of [α-32 P]ATP (MP Biomedicals, sp. act.

    Techniques: Methylation, Activity Assay, Mutagenesis, Thin Layer Chromatography, Labeling

    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Journal: Nucleic Acids Research

    Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription

    doi:

    Figure Lengend Snippet: Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Article Snippet: For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

    Techniques: Polyacrylamide Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay

    Autoradiograms of agarose gels showing DNA breakdown after intrastriatal NMDA injection (20 nmol). Brains were removed rapidly, and 2-mm-thick coronal slices were cut. DNA was isolated from the second slice containing both cortex and striatum, and a [ 32 P]dideoxy-ATP end-labeling method with terminal transferase was performed. A , DNA breakdown both in the form of nonspecific fragmentation (smearing) and oligonucleosomal breakdown (laddering) appears at 12–24 hr and intensifies 48 hr after NMDA in SV129 mice. Each lane contains tissue obtained from different animals killed at 12, 24, and 48 hr after NMDA injection. B , Both nonspecific DNA fragmentation and oligonucleosomal breakdown are observed to a lesser extent in nNOS −/− compared with nNOS +/+ littermates 48 hr after NMDA. The gel is representative of three independent experiments. M , Molecular weight marker.

    Journal: The Journal of Neuroscience

    Article Title: Mechanisms of Reduced Striatal NMDA Excitotoxicity in Type I Nitric Oxide Synthase Knock-Out Mice

    doi: 10.1523/JNEUROSCI.17-18-06908.1997

    Figure Lengend Snippet: Autoradiograms of agarose gels showing DNA breakdown after intrastriatal NMDA injection (20 nmol). Brains were removed rapidly, and 2-mm-thick coronal slices were cut. DNA was isolated from the second slice containing both cortex and striatum, and a [ 32 P]dideoxy-ATP end-labeling method with terminal transferase was performed. A , DNA breakdown both in the form of nonspecific fragmentation (smearing) and oligonucleosomal breakdown (laddering) appears at 12–24 hr and intensifies 48 hr after NMDA in SV129 mice. Each lane contains tissue obtained from different animals killed at 12, 24, and 48 hr after NMDA injection. B , Both nonspecific DNA fragmentation and oligonucleosomal breakdown are observed to a lesser extent in nNOS −/− compared with nNOS +/+ littermates 48 hr after NMDA. The gel is representative of three independent experiments. M , Molecular weight marker.

    Article Snippet: The DNA samples were labeled together with [α-32 P]dideoxy-ATP (3000 μCi mmol−1 ; Amersham, Oakville, Ontario, Canada) and 25 U of terminal transferase (Boehringer Mannheim) in a final volume of 50 μl.

    Techniques: Injection, Isolation, End Labeling, Mouse Assay, Molecular Weight, Marker

    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P α-ATP/α-UTP and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.

    Journal: Nature Communications

    Article Title: Tailing and degradation of Argonaute-bound small RNAs protect the genome from uncontrolled RNAi

    doi: 10.1038/ncomms15332

    Figure Lengend Snippet: Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P α-ATP/α-UTP and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.

    Article Snippet: sRNAs tailing assay Overall, 500 fmol to 1 pmol of double-strand or single strand 22 nucleotides long RNAs were incubated with 80 ng of Cid14 and Cid16 in buffer containing 1 mM Hepes pH 7.5, 0.5 mM MgCl2 , 0.5 mM MnCl2 , 25 mM KCl, 0.2 mM DTT, 40U Ribolock (Thermo Scientific) and 150 nM α-32 P-ATP/UTP (Hartmann Analytic) for 2 h at 32 °C.

    Techniques: Western Blot, Co-Immunoprecipitation Assay, In Vivo, Autoradiography, Activity Assay, Purification, Incubation

    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. UTP/CTP/ATP and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.

    Journal: Nucleic Acids Research

    Article Title: Formation of the conserved pseudouridine at position 55 in archaeal tRNA

    doi: 10.1093/nar/gkl530

    Figure Lengend Snippet: Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. UTP/CTP/ATP and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.

    Article Snippet: [α-32 P]UTP, [α-32 P]CTP, [α-32 P]ATP and [α-32 P]GTP (400 Ci/mmol) were from ICN Biomedicals and T7 RNA polymerase was from Roche Diagnostics.

    Techniques: Modification, Sequencing, Labeling, Thin Layer Chromatography, Mutagenesis, Incubation, Autoradiography, Migration

    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 P-ATP. A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .

    Journal: Nature structural & molecular biology

    Article Title: FICD acts bi-functionally to AMPylate and de-AMPylate the endoplasmic reticulum chaperone BiP

    doi: 10.1038/nsmb.3337

    Figure Lengend Snippet: FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 P-ATP. A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .

    Article Snippet: Radioactive in vitro AMPylation ( ) reactions were set up in a final volume of 37.5 µl containing 1 µM of ATP hydrolysis-deficient mutant BiP protein (BiPT229A ) , 0.1 µM wildtype or mutant FICD proteins, 40 µM ATP, and 0.023 MBq α-32 P-ATP (EasyTide; Perkin Elmer).

    Techniques: In Vitro, Autoradiography, SDS Page, Mutagenesis, Electrofocusing, Western Blot, Staining, Fluorescence, Labeling

    ATP hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Negative cooperativity in the nitrogenase Fe protein electron delivery cycle

    doi: 10.1073/pnas.1613089113

    Figure Lengend Snippet: ATP hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.

    Article Snippet: [α-32 P]ATP radionucleotide was purchased from PerkinElmer.

    Techniques: Flow Cytometry, Derivative Assay

    Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled ATP or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.

    Journal: Journal of Virology

    Article Title: Multimers Formed by the Rotavirus Nonstructural Protein NSP2 Bind to RNA and Have Nucleoside Triphosphatase Activity

    doi:

    Figure Lengend Snippet: Autophosphorylation of rNSP2. Purified rNSP2 was incubated with α- 32 P-labeled ATP or GTP or with γ- 32 P-labeled ATP or GTP for 1 h at 37°C. Afterwards, 10 U of CIP was added to some reaction mixtures, which were then incubated for 1 h at 37°C. Proteins in the samples were detected by SDS–12% PAGE and staining with Coomassie blue (A). 32 P-labeled proteins in the gel shown in (A) were identified by autoradiography (B). CIP becomes radiolabeled due to its affinity for NTPs.

    Article Snippet: Typically, reaction mixtures for the NTPase assay contained 1 to 2 μg of rNSP2, 50 mM Tris-HCl (pH 7.5), 5 mM MgCl2 and 10 μCi of α-32 P-labeled ATP, GTP, CTP, or UTP (3,000 Ci/mmol; Amersham) in a final volume of 20 μl.

    Techniques: Purification, Incubation, Labeling, Polyacrylamide Gel Electrophoresis, Staining, Autoradiography