α 32 p adenosine triphosphate atp Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher nucaway spin columns
    Nucaway Spin Columns, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1618 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucaway spin columns/product/Thermo Fisher
    Average 90 stars, based on 1618 article reviews
    Price from $9.99 to $1999.99
    nucaway spin columns - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    89
    PerkinElmer alpha 32 p atp
    A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) <t>ATP</t> hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009
    Alpha 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 89/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha 32 p atp/product/PerkinElmer
    Average 89 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    alpha 32 p atp - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    92
    GE Healthcare α 32 p atp
    Analysis of EspA kinase activity. (A) Autoradiograph of GST-EspA kin (lane 1), GST-EspA kin ( H407A ) (lane 2), GST-EspA kin-rec (lane 3), and GST-EspA kin-rec ( D696A ) (lane 4) incubated in the presence of [γ- 32 <t>P]ATP.</t> (B) Coomassie-stained gel corresponding to panel A. (C) TLC analysis of [α- 32 P]ADP produced by [α- 32 P]ATP (lane 1), GST-EspA kin (lane 2), GST-EspA kin-rec (lane 3), and GST-EspA kin-rec ( D696A ) (lane 4). (D) Quantification of [α- 32 P]ADP signal in panel C as an average from triplicate experiments.
    α 32 P Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 693 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/GE Healthcare
    Average 92 stars, based on 693 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    93
    HARTMANN ANALYTIC α 32 p atp
    AP hydrolyzes [γ- 32 <t>P]ATP</t> and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.
    α 32 P Atp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 93/100, based on 91 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/HARTMANN ANALYTIC
    Average 93 stars, based on 91 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    93/100 stars
      Buy from Supplier

    91
    DuPont de Nemours α 32 p atp
    RNA helicase assay of 74%NS3 fusion proteins. (A) Structure of the 3′-tailed dsRNA substrate; the lower strand of RNA was labeled with [α- 32 <t>P]ATP.</t> (B) RNA helicase activity of the parental G2 protein. Lane 1, heated RNA substrate (hS); lane 2, untreated RNA substrate (S); lane 3, RNA helicase activity of 1 pmol of purified G2 protein; lane 4, same as lane 3 but omitting ATP and Mn 2+ . (C) RNA helicase activity of mutant fusion proteins. (D) Percent unwinding of dsRNA to single-stranded RNA (ssRNA). Means (columns) and range of values (error bars) from three independent experiments are shown.
    α 32 P Atp, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 91/100, based on 73 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/DuPont de Nemours
    Average 91 stars, based on 73 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    88
    Valiant α 32 p atp
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 88/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Valiant
    Average 88 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    89
    NEN Life Science α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    α 32 P Atp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 89/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/NEN Life Science
    Average 89 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    89
    ICN Pharmaceuticals α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    α 32 P Atp, supplied by ICN Pharmaceuticals, used in various techniques. Bioz Stars score: 89/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/ICN Pharmaceuticals
    Average 89 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    78
    PerkinElmer nucleotide α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    Nucleotide α 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleotide α 32 p atp/product/PerkinElmer
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    nucleotide α 32 p atp - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    78
    Valiant mci α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    Mci α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mci α 32 p atp/product/Valiant
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mci α 32 p atp - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    77
    HARTMANN ANALYTIC α 32 p atp utp
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    α 32 P Atp Utp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 77/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp utp/product/HARTMANN ANALYTIC
    Average 77 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp utp - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    80
    PerkinElmer α 32 p atp labeled
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    α 32 P Atp Labeled, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 80/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp labeled/product/PerkinElmer
    Average 80 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp labeled - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    89
    ICN Biomedicals α 32 p atp
    A deaminase present in a crude P.furiosus extract transforms m 1 A57 preformed in yeast tRNA Asp by the P.abyssi TrmI enzyme into m 1 I57 and does not deaminate the m 1 A58 preformed in T.thermophilus tRNA Asp . [α- 32 <t>P]ATP-labelled</t> yeast tRNA Asp (A and C) and [α- 32 P]ATP- labelled T.thermophilus tRNA Asp (B and D) were incubated for 1 h at 60°C in the presence of the purified P.abyssi TrmI enzyme and of AdoMet. The transcripts were then recovered and incubated in a crude P.abyssi S30 extract for different periods of time as shown. At the end of the incubation time the transcripts were recovered, digested by nuclease P1 and analysed by 1D-TLC using solvent B (see Materials and Methods) on cellulose plates followed by autoradiography ( A and B ). ( C ) and ( D ) correspond to the autoradiograms of 2D-TLC of the samples incubated for 60 min in the presence of the P.furiosus extract.
    α 32 P Atp, supplied by ICN Biomedicals, used in various techniques. Bioz Stars score: 89/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/ICN Biomedicals
    Average 89 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    89
    Promega α 32 p atp
    A deaminase present in a crude P.furiosus extract transforms m 1 A57 preformed in yeast tRNA Asp by the P.abyssi TrmI enzyme into m 1 I57 and does not deaminate the m 1 A58 preformed in T.thermophilus tRNA Asp . [α- 32 <t>P]ATP-labelled</t> yeast tRNA Asp (A and C) and [α- 32 P]ATP- labelled T.thermophilus tRNA Asp (B and D) were incubated for 1 h at 60°C in the presence of the purified P.abyssi TrmI enzyme and of AdoMet. The transcripts were then recovered and incubated in a crude P.abyssi S30 extract for different periods of time as shown. At the end of the incubation time the transcripts were recovered, digested by nuclease P1 and analysed by 1D-TLC using solvent B (see Materials and Methods) on cellulose plates followed by autoradiography ( A and B ). ( C ) and ( D ) correspond to the autoradiograms of 2D-TLC of the samples incubated for 60 min in the presence of the P.furiosus extract.
    α 32 P Atp, supplied by Promega, used in various techniques. Bioz Stars score: 89/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Promega
    Average 89 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    91
    Thermo Fisher α 32 p atp
    A deaminase present in a crude P.furiosus extract transforms m 1 A57 preformed in yeast tRNA Asp by the P.abyssi TrmI enzyme into m 1 I57 and does not deaminate the m 1 A58 preformed in T.thermophilus tRNA Asp . [α- 32 <t>P]ATP-labelled</t> yeast tRNA Asp (A and C) and [α- 32 P]ATP- labelled T.thermophilus tRNA Asp (B and D) were incubated for 1 h at 60°C in the presence of the purified P.abyssi TrmI enzyme and of AdoMet. The transcripts were then recovered and incubated in a crude P.abyssi S30 extract for different periods of time as shown. At the end of the incubation time the transcripts were recovered, digested by nuclease P1 and analysed by 1D-TLC using solvent B (see Materials and Methods) on cellulose plates followed by autoradiography ( A and B ). ( C ) and ( D ) correspond to the autoradiograms of 2D-TLC of the samples incubated for 60 min in the presence of the P.furiosus extract.
    α 32 P Atp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 220 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Thermo Fisher
    Average 91 stars, based on 220 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-02
    91/100 stars
      Buy from Supplier

    92
    PerkinElmer mbq α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Mbq α 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 92/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mbq α 32 p atp/product/PerkinElmer
    Average 92 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    mbq α 32 p atp - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    78
    PerkinElmer α 32 p atp radionucleotide
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Atp Radionucleotide, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 78/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp radionucleotide/product/PerkinElmer
    Average 78 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp radionucleotide - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    79
    DuPont de Nemours α 32 p atp nen dupont
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Atp Nen Dupont, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp nen dupont/product/DuPont de Nemours
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp nen dupont - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    80
    PerkinElmer atp α 32p easytide lead
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Atp α 32p Easytide Lead, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 80/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/atp α 32p easytide lead/product/PerkinElmer
    Average 80 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    atp α 32p easytide lead - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    92
    GE Healthcare α 32 p datp
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Datp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 2296 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p datp/product/GE Healthcare
    Average 92 stars, based on 2296 article reviews
    Price from $9.99 to $1999.99
    α 32 p datp - by Bioz Stars, 2020-02
    92/100 stars
      Buy from Supplier

    78
    PerkinElmer 800 ci mmol α
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    800 Ci Mmol α, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 78/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/800 ci mmol α/product/PerkinElmer
    Average 78 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    800 ci mmol α - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    79
    GE Healthcare 5000 ci mmol
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    5000 Ci Mmol, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 79/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/5000 ci mmol/product/GE Healthcare
    Average 79 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    5000 ci mmol - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    78
    Valiant 800 ci mmol
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    800 Ci Mmol, supplied by Valiant, used in various techniques. Bioz Stars score: 78/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/800 ci mmol/product/Valiant
    Average 78 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    800 ci mmol - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    88
    PerkinElmer fmol
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Fmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 88/100, based on 35 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/fmol/product/PerkinElmer
    Average 88 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    fmol - by Bioz Stars, 2020-02
    88/100 stars
      Buy from Supplier

    77
    PerkinElmer trace α32 p atp
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Trace α32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 77/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trace α32 p atp/product/PerkinElmer
    Average 77 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    trace α32 p atp - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    99
    PerkinElmer ci mmol
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Ci Mmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 99/100, based on 1860 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ci mmol/product/PerkinElmer
    Average 99 stars, based on 1860 article reviews
    Price from $9.99 to $1999.99
    ci mmol - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    81
    PerkinElmer α32 p atp 3000 ci mmol
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α32 P Atp 3000 Ci Mmol, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 81/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α32 p atp 3000 ci mmol/product/PerkinElmer
    Average 81 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    α32 p atp 3000 ci mmol - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    96
    GE Healthcare ci mmol
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Ci Mmol, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 96/100, based on 984 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ci mmol/product/GE Healthcare
    Average 96 stars, based on 984 article reviews
    Price from $9.99 to $1999.99
    ci mmol - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    79
    PerkinElmer γ 32
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    γ 32, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 79/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/γ 32/product/PerkinElmer
    Average 79 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    γ 32 - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    76
    GE Healthcare radiochemical
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Radiochemical, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/radiochemical/product/GE Healthcare
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    radiochemical - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    98
    GE Healthcare megaprime kit
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    Megaprime Kit, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 98/100, based on 484 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/megaprime kit/product/GE Healthcare
    Average 98 stars, based on 484 article reviews
    Price from $9.99 to $1999.99
    megaprime kit - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    78
    GE Healthcare h cgp 12177
    Effect of thyroid status on [3 H]CGP 12177 binding sites
    H Cgp 12177, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 78/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/h cgp 12177/product/GE Healthcare
    Average 78 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    h cgp 12177 - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results


    A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009

    Journal: eLife

    Article Title: Redox signaling via the molecular chaperone BiP protects cells against endoplasmic reticulum-derived oxidative stress

    doi: 10.7554/eLife.03496

    Figure Lengend Snippet: A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009

    Article Snippet: ATPase activity To measure ATPase activity, 1 µM C-terminally tagged Kar2 and 2.5 µM GST-Sec63J were incubated with 0.1 mM of cold ATP and 0.45 µCi of [alpha-32 P]ATP (Perkin–Elmer, Waltham, MA) in ATPase buffer (50 mM Tris–HCl, pH 7.4, 50 mM KCl, 5 mM MgCl2 , 1 mM DTT) in a total volume of 45 µl at room temperature.

    Techniques: Mutagenesis, Plasmid Preparation, Incubation, Cell Culture, Activity Assay

    Replacement of the BiP cysteine with aspartic acid, phenylalanine, tyrosine, or tryptophan results in decreased BiP function. ( A ) CSY214 containing the plasmids pCS681, pCS802, pCS687, pCS688, pCS750 or empty vector were spotted onto SMM plates with or without 5-fluoroorotic acid (5-FOA) and incubated for 2 d at 30°C. ( B ) CSY289, 290, 368, 292, and 293 were spotted onto YPD plates and incubated at 24°, 30°, and 37°C. ( C ) Strains from B were cultured at 24°C to log-phase in YPD and shifted to 37°C for 90 min prior to harvest. Accumulation of unprocessed untranslocated forms of the proteins Kar2, PDI, and Gas1 were detected by western blotting. ( D ) Strains from B containing an UPRE- lacZ reporter plasmid (pJC8) were cultured in SMM-ura at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Samples were assayed for beta–galactosidase activity. Three independent transformants of each strain were grown and assayed in duplicate. Data represent the mean of averaged values for the three transformants ± SD. ( E – G ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Panels F and G show CHP and NEM-treated samples, respectively. Samples without chemical additions in panels F and G were mock treated to match the CHP or NEM-treatment. Data represent the means ± SD of three independent assays. DOI: http://dx.doi.org/10.7554/eLife.03496.007

    Journal: eLife

    Article Title: Redox signaling via the molecular chaperone BiP protects cells against endoplasmic reticulum-derived oxidative stress

    doi: 10.7554/eLife.03496

    Figure Lengend Snippet: Replacement of the BiP cysteine with aspartic acid, phenylalanine, tyrosine, or tryptophan results in decreased BiP function. ( A ) CSY214 containing the plasmids pCS681, pCS802, pCS687, pCS688, pCS750 or empty vector were spotted onto SMM plates with or without 5-fluoroorotic acid (5-FOA) and incubated for 2 d at 30°C. ( B ) CSY289, 290, 368, 292, and 293 were spotted onto YPD plates and incubated at 24°, 30°, and 37°C. ( C ) Strains from B were cultured at 24°C to log-phase in YPD and shifted to 37°C for 90 min prior to harvest. Accumulation of unprocessed untranslocated forms of the proteins Kar2, PDI, and Gas1 were detected by western blotting. ( D ) Strains from B containing an UPRE- lacZ reporter plasmid (pJC8) were cultured in SMM-ura at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Samples were assayed for beta–galactosidase activity. Three independent transformants of each strain were grown and assayed in duplicate. Data represent the mean of averaged values for the three transformants ± SD. ( E – G ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Panels F and G show CHP and NEM-treated samples, respectively. Samples without chemical additions in panels F and G were mock treated to match the CHP or NEM-treatment. Data represent the means ± SD of three independent assays. DOI: http://dx.doi.org/10.7554/eLife.03496.007

    Article Snippet: ATPase activity To measure ATPase activity, 1 µM C-terminally tagged Kar2 and 2.5 µM GST-Sec63J were incubated with 0.1 mM of cold ATP and 0.45 µCi of [alpha-32 P]ATP (Perkin–Elmer, Waltham, MA) in ATPase buffer (50 mM Tris–HCl, pH 7.4, 50 mM KCl, 5 mM MgCl2 , 1 mM DTT) in a total volume of 45 µl at room temperature.

    Techniques: Plasmid Preparation, Incubation, Cell Culture, Western Blot, Activity Assay

    Labeling and biochemical characterization of T7 RNAP activity. ( A ) Synthesis of Cy5-conjugated HaloTag Ligand ( S3 ) used to label RNAP from Cy5 acid S1 and HaloTag ligand-amine S2 . See ‘Materials and methods’ for details. ( B ) SDS-PAGE gel images of the unlabeled (‘RNAP’: no HaloTag; ‘Halo-RNAP’: with HaloTag) and the Cy5-labeled Halo-RNAP (‘Cy5-Halo-RNAP’) T7 RNAP. All RNAPs have a 6(His) tag at the N-terminus used for purification. Top: image stained with Coomassie Brilliant Blue. Bottom: the same gel scanned for Cy5 fluorescence (prior to Coomassie staining). ( C ) In vitro transcription activity of RNAP. The concentrations of RNAP derivatives were as indicated. The DNA template (a PCR fragment spanning from −75 to +295 of the concensus T7 RNAP promoter), was used at 10 nM. RNA products were labeled by incorporation of α 32 P-ATP, resolved on a denaturing polyacrylamide gel, and imaged by autoradiography. The major bands at ∼295 nt are the expected run-off products. DOI: http://dx.doi.org/10.7554/eLife.01775.009

    Journal: eLife

    Article Title: Single-molecule tracking of the transcription cycle by sub-second RNA detection

    doi: 10.7554/eLife.01775

    Figure Lengend Snippet: Labeling and biochemical characterization of T7 RNAP activity. ( A ) Synthesis of Cy5-conjugated HaloTag Ligand ( S3 ) used to label RNAP from Cy5 acid S1 and HaloTag ligand-amine S2 . See ‘Materials and methods’ for details. ( B ) SDS-PAGE gel images of the unlabeled (‘RNAP’: no HaloTag; ‘Halo-RNAP’: with HaloTag) and the Cy5-labeled Halo-RNAP (‘Cy5-Halo-RNAP’) T7 RNAP. All RNAPs have a 6(His) tag at the N-terminus used for purification. Top: image stained with Coomassie Brilliant Blue. Bottom: the same gel scanned for Cy5 fluorescence (prior to Coomassie staining). ( C ) In vitro transcription activity of RNAP. The concentrations of RNAP derivatives were as indicated. The DNA template (a PCR fragment spanning from −75 to +295 of the concensus T7 RNAP promoter), was used at 10 nM. RNA products were labeled by incorporation of α 32 P-ATP, resolved on a denaturing polyacrylamide gel, and imaged by autoradiography. The major bands at ∼295 nt are the expected run-off products. DOI: http://dx.doi.org/10.7554/eLife.01775.009

    Article Snippet: In ensemble measurements, 10 nM DNA template (same PCR fragment as used in single-molecule assays), 0.17 μCi/μl α-32 P-ATP (Perkin Elmer, Waltham, MA) and different concentrations of RNAP were also included in the reaction.

    Techniques: Labeling, Activity Assay, SDS Page, Purification, Staining, Fluorescence, In Vitro, Polymerase Chain Reaction, Autoradiography

    Characterization of rTalig. (A) Adenylation by [α- 32 P]ATP and [α- 32 P]dATP. rTalig (17 pmol) (or T4 DNA ligase [1 U] used as a positive control) was incubated with 3.3 pmol of [α- 32 P]ATP or 3.3 pmol of [α- 32 P]dATP in adenylation

    Journal: Journal of Bacteriology

    Article Title: Uracil-DNA Glycosylase of Thermoplasma acidophilumDirects Long-Patch Base Excision Repair, Which Is Promoted by Deoxynucleoside Triphosphates and ATP/ADP, into Short-Patch Repair ▿

    doi: 10.1128/JB.00233-11

    Figure Lengend Snippet: Characterization of rTalig. (A) Adenylation by [α- 32 P]ATP and [α- 32 P]dATP. rTalig (17 pmol) (or T4 DNA ligase [1 U] used as a positive control) was incubated with 3.3 pmol of [α- 32 P]ATP or 3.3 pmol of [α- 32 P]dATP in adenylation

    Article Snippet: DNA ligase-adenylate formation was examined by using [α-32 P]ATP (3,000 Ci/mmol, 10 mCi/ml; catalog no. BLU503H250UC), [α-32 P]dATP (3,000 Ci/mmol, 10 mCi/ml; catalog no. NEG512H250UC), and [32 P]NAD (800 Ci/mmol, 5 mCi/ml; catalog no. NEG023X250UC) supplied by PerkinElmer NEN (catalog no. NEG023X250UC) as cosubstrates. rTalig (17 pmol) (or 1 U of T4 DNA ligase supplied by Fermentas [catalog no. EL0015, 1 U/μl] used as a positive control) was incubated with radiolabeled nucleotide in 50 mM Tris-HCl (pH 7), 5 mM DTT, and 0.1 mM MgCl2 (adenylation buffer) at 50°C for the different time periods indicated below in a 20-μl (final volume) mixture.

    Techniques: Positive Control, Incubation

    Analysis of EspA kinase activity. (A) Autoradiograph of GST-EspA kin (lane 1), GST-EspA kin ( H407A ) (lane 2), GST-EspA kin-rec (lane 3), and GST-EspA kin-rec ( D696A ) (lane 4) incubated in the presence of [γ- 32 P]ATP. (B) Coomassie-stained gel corresponding to panel A. (C) TLC analysis of [α- 32 P]ADP produced by [α- 32 P]ATP (lane 1), GST-EspA kin (lane 2), GST-EspA kin-rec (lane 3), and GST-EspA kin-rec ( D696A ) (lane 4). (D) Quantification of [α- 32 P]ADP signal in panel C as an average from triplicate experiments.

    Journal: Journal of Bacteriology

    Article Title: EspA, an Orphan Hybrid Histidine Protein Kinase, Regulates the Timing of Expression of Key Developmental Proteins of Myxococcus xanthus

    doi: 10.1128/JB.00265-08

    Figure Lengend Snippet: Analysis of EspA kinase activity. (A) Autoradiograph of GST-EspA kin (lane 1), GST-EspA kin ( H407A ) (lane 2), GST-EspA kin-rec (lane 3), and GST-EspA kin-rec ( D696A ) (lane 4) incubated in the presence of [γ- 32 P]ATP. (B) Coomassie-stained gel corresponding to panel A. (C) TLC analysis of [α- 32 P]ADP produced by [α- 32 P]ATP (lane 1), GST-EspA kin (lane 2), GST-EspA kin-rec (lane 3), and GST-EspA kin-rec ( D696A ) (lane 4). (D) Quantification of [α- 32 P]ADP signal in panel C as an average from triplicate experiments.

    Article Snippet: ATPase activity was measured under the conditions of the in vitro phosphorylation assay, except that 0.5 mM [α-32 P]ATP (110 TBq mmol−1 ; Amersham) was used as a substrate.

    Techniques: Activity Assay, Autoradiography, Incubation, Staining, Thin Layer Chromatography, Produced

    AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: AP hydrolyzes [γ- 32 P]ATP and [α- 32 P]ATP bound to VEGF-A 165 . VEGF-A 165 (15 μM) was labeled with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 15 min. After labeling (t = 15 min), 300 ng of AP was added (lane 3 and 4). Incubation of all samples was continued for an additional period of 15 min followed by SDS-PAGE and autoradiography.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation, SDS Page, Autoradiography

    Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: Effect of increased ionic strength on labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (3 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C for 30 min. NaCl (100 mM) was added at times (t) indicated.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation

    Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

    Journal: BMC Biochemistry

    Article Title: Binding of ATP to vascular endothelial growth factor isoform VEGF-A165 is essential for inducing proliferation of human umbilical vein endothelial cells

    doi: 10.1186/1471-2091-12-28

    Figure Lengend Snippet: Labeling of VEGF-A 165 with [γ- 32 P]ATP and [α- 32 P]ATP . VEGF-A 165 (2 μg) was incubated with radioactive ATP (5 μCi) in Tris-HCl (pH 7.5) at 37°C. MgCl 2 (0.1 mM) was added prior to ATP (+). After 15 min of incubation SDS-PAGE and autoradiography were performed.

    Article Snippet: Labeling of VEGF-A165 with [γ-32 P]ATP and [α-32 P]ATP For labeling, 3 μg VEGF-A165 (unless otherwise noted) was incubated with 5 μCi each of [γ-32 P]ATP or [α-32 P]ATP (Hartmann Analytic, Braunschweig, Germany) and combined with 0.01 mM non-radioactive ATP (optionally containing 0.1 mM MgCl2 ).

    Techniques: Labeling, Incubation, SDS Page, Autoradiography

    RNA helicase assay of 74%NS3 fusion proteins. (A) Structure of the 3′-tailed dsRNA substrate; the lower strand of RNA was labeled with [α- 32 P]ATP. (B) RNA helicase activity of the parental G2 protein. Lane 1, heated RNA substrate (hS); lane 2, untreated RNA substrate (S); lane 3, RNA helicase activity of 1 pmol of purified G2 protein; lane 4, same as lane 3 but omitting ATP and Mn 2+ . (C) RNA helicase activity of mutant fusion proteins. (D) Percent unwinding of dsRNA to single-stranded RNA (ssRNA). Means (columns) and range of values (error bars) from three independent experiments are shown.

    Journal: Journal of Virology

    Article Title: Mutagenesis of the Dengue Virus Type 2 NS3 Protein within and outside Helicase Motifs: Effects on Enzyme Activity and Virus Replication

    doi: 10.1128/JVI.75.20.9633-9643.2001

    Figure Lengend Snippet: RNA helicase assay of 74%NS3 fusion proteins. (A) Structure of the 3′-tailed dsRNA substrate; the lower strand of RNA was labeled with [α- 32 P]ATP. (B) RNA helicase activity of the parental G2 protein. Lane 1, heated RNA substrate (hS); lane 2, untreated RNA substrate (S); lane 3, RNA helicase activity of 1 pmol of purified G2 protein; lane 4, same as lane 3 but omitting ATP and Mn 2+ . (C) RNA helicase activity of mutant fusion proteins. (D) Percent unwinding of dsRNA to single-stranded RNA (ssRNA). Means (columns) and range of values (error bars) from three independent experiments are shown.

    Article Snippet: Briefly, the final volume of the standard assay used to test mutated proteins was 10 μl, containing 50 mM Tris-HCl (pH 8.0), 10 mM NaCl, 2.5 mM MgCl2 , 1 μCi of [α-32 P]ATP (800 Ci/mmol; DuPont) and 0.4 pmol of protein sample.

    Techniques: Helicase Assay, Labeling, Activity Assay, Purification, Mutagenesis

    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 P]ATP-labeled pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in

    Journal: RNA

    Article Title: Dynamic guide-target interactions contribute to sequential 2?-O-methylation by a unique archaeal dual guide box C/D sRNP

    doi: 10.1261/rna.1003308

    Figure Lengend Snippet: Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 P]ATP-labeled pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in

    Article Snippet: A typical 100 μL transcription reaction performed at 37°C for 3–4 h contained 40 mM Tris-Cl, pH 7.9, 6 mM MgCl2 , 10 mM DTT (dithiothreitol), 2 mM spermidine, 20 μCi of [α-32 P]ATP (MP Biomedicals, sp. act.

    Techniques: Methylation, Activity Assay, Mutagenesis, Thin Layer Chromatography, Labeling

    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Journal: Nucleic Acids Research

    Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription

    doi:

    Figure Lengend Snippet: Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Article Snippet: For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

    Techniques: Polyacrylamide Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay

    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P α-ATP/α-UTP and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.

    Journal: Nature Communications

    Article Title: Tailing and degradation of Argonaute-bound small RNAs protect the genome from uncontrolled RNAi

    doi: 10.1038/ncomms15332

    Figure Lengend Snippet: Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P α-ATP/α-UTP and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.

    Article Snippet: sRNAs tailing assay Overall, 500 fmol to 1 pmol of double-strand or single strand 22 nucleotides long RNAs were incubated with 80 ng of Cid14 and Cid16 in buffer containing 1 mM Hepes pH 7.5, 0.5 mM MgCl2 , 0.5 mM MnCl2 , 25 mM KCl, 0.2 mM DTT, 40U Ribolock (Thermo Scientific) and 150 nM α-32 P-ATP/UTP (Hartmann Analytic) for 2 h at 32 °C.

    Techniques: Western Blot, Co-Immunoprecipitation Assay, In Vivo, Autoradiography, Activity Assay, Purification, Incubation

    A deaminase present in a crude P.furiosus extract transforms m 1 A57 preformed in yeast tRNA Asp by the P.abyssi TrmI enzyme into m 1 I57 and does not deaminate the m 1 A58 preformed in T.thermophilus tRNA Asp . [α- 32 P]ATP-labelled yeast tRNA Asp (A and C) and [α- 32 P]ATP- labelled T.thermophilus tRNA Asp (B and D) were incubated for 1 h at 60°C in the presence of the purified P.abyssi TrmI enzyme and of AdoMet. The transcripts were then recovered and incubated in a crude P.abyssi S30 extract for different periods of time as shown. At the end of the incubation time the transcripts were recovered, digested by nuclease P1 and analysed by 1D-TLC using solvent B (see Materials and Methods) on cellulose plates followed by autoradiography ( A and B ). ( C ) and ( D ) correspond to the autoradiograms of 2D-TLC of the samples incubated for 60 min in the presence of the P.furiosus extract.

    Journal: Nucleic Acids Research

    Article Title: A primordial RNA modification enzyme: the case of tRNA (m1A) methyltransferase

    doi: 10.1093/nar/gkh191

    Figure Lengend Snippet: A deaminase present in a crude P.furiosus extract transforms m 1 A57 preformed in yeast tRNA Asp by the P.abyssi TrmI enzyme into m 1 I57 and does not deaminate the m 1 A58 preformed in T.thermophilus tRNA Asp . [α- 32 P]ATP-labelled yeast tRNA Asp (A and C) and [α- 32 P]ATP- labelled T.thermophilus tRNA Asp (B and D) were incubated for 1 h at 60°C in the presence of the purified P.abyssi TrmI enzyme and of AdoMet. The transcripts were then recovered and incubated in a crude P.abyssi S30 extract for different periods of time as shown. At the end of the incubation time the transcripts were recovered, digested by nuclease P1 and analysed by 1D-TLC using solvent B (see Materials and Methods) on cellulose plates followed by autoradiography ( A and B ). ( C ) and ( D ) correspond to the autoradiograms of 2D-TLC of the samples incubated for 60 min in the presence of the P.furiosus extract.

    Article Snippet: [α-32 P]ATP, [α-32 P]GTP and [α-32 P]UTP were purchased from ICN Biomedicals and T7-RNA polymerase was purchased from Roche Diagnostics.

    Techniques: Incubation, Purification, Thin Layer Chromatography, Autoradiography

    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 P-ATP. A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .

    Journal: Nature structural & molecular biology

    Article Title: FICD acts bi-functionally to AMPylate and de-AMPylate the endoplasmic reticulum chaperone BiP

    doi: 10.1038/nsmb.3337

    Figure Lengend Snippet: FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 P-ATP. A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .

    Article Snippet: Radioactive in vitro AMPylation ( ) reactions were set up in a final volume of 37.5 µl containing 1 µM of ATP hydrolysis-deficient mutant BiP protein (BiPT229A ) , 0.1 µM wildtype or mutant FICD proteins, 40 µM ATP, and 0.023 MBq α-32 P-ATP (EasyTide; Perkin Elmer).

    Techniques: In Vitro, Autoradiography, SDS Page, Mutagenesis, Electrofocusing, Western Blot, Staining, Fluorescence, Labeling

    ATP hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Negative cooperativity in the nitrogenase Fe protein electron delivery cycle

    doi: 10.1073/pnas.1613089113

    Figure Lengend Snippet: ATP hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.

    Article Snippet: [α-32 P]ATP radionucleotide was purchased from PerkinElmer.

    Techniques: Flow Cytometry, Derivative Assay

    Effect of thyroid status on [3 H]CGP 12177 binding sites

    Journal: British Journal of Pharmacology

    Article Title: Regulation of ?1- and ?3-adrenergic agonist-stimulated lipolytic response in hyperthyroid and hypothyroid rat white adipocytes

    doi: 10.1038/sj.bjp.0703008

    Figure Lengend Snippet: Effect of thyroid status on [3 H]CGP 12177 binding sites

    Article Snippet: [3 H]-CGP 12177 (specific activity: 46 Ci mmol−1 ) [α-32 P]-ATP (specific activity: 30 Ci mmol−1 ) and [α-32 P]-dCTP (specific activity: 3000 Ci mmol−1 ) were obtained from Amersham (Les Ulis, France).

    Techniques: Binding Assay

    Concentration-response curves for stimulation of glycerol release from hyperthyroid (□), euthyroid control (Δ) and hypothyroid (○) rats, elicited by the partial agonists, the β 3 -selective agonist CGP 12177 (a) and the β 1 -selective agonist xamoterol (b). Each curve is a representative experiment performed in triplicate. Each point is the mean±s.e.mean over basal lipolysis value. Standard deviations not shown are within the symbol.

    Journal: British Journal of Pharmacology

    Article Title: Regulation of ?1- and ?3-adrenergic agonist-stimulated lipolytic response in hyperthyroid and hypothyroid rat white adipocytes

    doi: 10.1038/sj.bjp.0703008

    Figure Lengend Snippet: Concentration-response curves for stimulation of glycerol release from hyperthyroid (□), euthyroid control (Δ) and hypothyroid (○) rats, elicited by the partial agonists, the β 3 -selective agonist CGP 12177 (a) and the β 1 -selective agonist xamoterol (b). Each curve is a representative experiment performed in triplicate. Each point is the mean±s.e.mean over basal lipolysis value. Standard deviations not shown are within the symbol.

    Article Snippet: [3 H]-CGP 12177 (specific activity: 46 Ci mmol−1 ) [α-32 P]-ATP (specific activity: 30 Ci mmol−1 ) and [α-32 P]-dCTP (specific activity: 3000 Ci mmol−1 ) were obtained from Amersham (Les Ulis, France).

    Techniques: Concentration Assay