α 32 p adenosine triphosphate atp Search Results


  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore α 32 p atp
    α 32 P Atp, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 103 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Millipore
    Average 99 stars, based on 103 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    86
    PerkinElmer alpha 32 p atp
    A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) <t>ATP</t> hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009
    Alpha 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 86/100, based on 1256 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/alpha 32 p atp/product/PerkinElmer
    Average 86 stars, based on 1256 article reviews
    Price from $9.99 to $1999.99
    alpha 32 p atp - by Bioz Stars, 2020-07
    86/100 stars
      Buy from Supplier

    92
    HARTMANN ANALYTIC α 32 p atp
    Endoribonucleolytic activity of Sso aIF5A. (a) Lane 1, [α- 32 P] <t>ATP</t> was loaded on the gel. Lane 2, incubation of 5′-PPP-GGA*-″-3′ RNA for 22 min at 65°C. Lanes 3–14, time course of degradation of 5′-PPP-GGA*-″-3′ RNA at 65°C in the presence of N-His-aIF5A purified from E. coli . The blue arrows indicate the full-length RNA and the single A nucleotide. The red arrow indicates a stable degradation product. (b) Lane 1, RNA size marker. Lane 2, incubation of 5´end-labelled 2508sh RNA for 22 min at 65°C. Lanes 3–14, time course of degradation of 5´end-labelled 2508sh RNA at 65°C in the presence of N-His-aIF5A purified from E. coli . The arrow indicates the accumulation of a stable degradation product. Only the relevant part of the autoradiogram is shown.
    α 32 P Atp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 92/100, based on 105 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/HARTMANN ANALYTIC
    Average 92 stars, based on 105 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare α 32 p atp
    A novel SBD mutant exhibits impaired chaperone holdase activity but retains Hsp70 nucleotide exchange capacity. (A) Crystal structure of the Sse1 β-domain, with amino acids selected for mutations highlighted in red ( Xu et al. , 2012 ). (B) Fluorescence anisotropy was performed with increasing concentrations of chaperone (Sse1 or Sse1 sbd ) binding fluorescently labeled <t>ATP-FAM.</t> (C) Nucleotide exchange activity assays using HSPA8 (Hsp70) prebound to α- 32 P-ATP in the presence or absence of Sse1. (D) Holdase experiments were conducted using chemically denatured FFL (200 nM) diluted into refolding buffer without chaperone (no chap), with Sse1 (400 nM), or with Sse1 sbd (400 nM). FFL diluted into denaturing buffer instead of folding buffer was used as an aggregation control (denat). (E) Differential centrifugation analysis of FFL aggregation in the absence of chaperone or with Sse1 or Sse1 sbd after a 30-min holdase assay. Samples were visualized by SDS–PAGE, followed by Coomassie stain, and scanning densitometry quantitation was performed to determine FFL aggregation under each condition. (F) Endpoint analysis of holdase experiments performed as in D, using denatured FFL with varying ratios of chaperone to substrate, quantified as fraction of total aggregation.
    α 32 P Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 703 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/GE Healthcare
    Average 92 stars, based on 703 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    NEN Life Science α 32 p atp
    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of <t>ATP</t> and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).
    α 32 P Atp, supplied by NEN Life Science, used in various techniques. Bioz Stars score: 92/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/NEN Life Science
    Average 92 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    DuPont de Nemours α 32 p atp
    UV-induced cross-linking of the complete 3 ′ UTR and the 3 ′ UTR (A) of NV and S10 extract from HeLa cells. (A) [α- 32 <t>P]ATP</t> labeled 3 ′ UTR (lanes 1 and 2) and 3 ′ UTR(A) (lane 3) RNAs were UV-crosslinked without (lane 1) or with 60 μg of S10 extract from HeLa cells (lanes 2–3). (B) Forty micrograms of S10 extract from HeLa cells were preincubated 15 min with 25-fold molar excess of heterologous (lane 2), homologous (lane 3), and non-related heterologous (lane 5) RNAs prior to the addition of [α- 32 P]ATP labeled 3 ′ UTR(A). Free RNA was loaded on lane 1. (C) [α- 32 P]UTP labeled 3 ′ UTR RNA was cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) and immunoprecipitated with anti-La (lane 3) or anti-actin antibodies (lane 2). (D) [α- 32 P]UTP labeled 3 ′ UTR RNA was UV-cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) or 100 and 500 ng of recombinant PTB protein (lanes 2 and 3, respectively). After UV-cross-linking, the reaction was followed by RNase treatment. Crosslinked proteins were loaded on an SDS–10% polyacrylamide gel and detected by autoradiography. The migration of the UV-crosslinked 68 kDa, rPTB, and the immunoprecipitated La proteins is indicated by an arrow.
    α 32 P Atp, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 92/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/DuPont de Nemours
    Average 92 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    ICN Pharmaceuticals α 32 p atp
    UV-induced cross-linking of the complete 3 ′ UTR and the 3 ′ UTR (A) of NV and S10 extract from HeLa cells. (A) [α- 32 <t>P]ATP</t> labeled 3 ′ UTR (lanes 1 and 2) and 3 ′ UTR(A) (lane 3) RNAs were UV-crosslinked without (lane 1) or with 60 μg of S10 extract from HeLa cells (lanes 2–3). (B) Forty micrograms of S10 extract from HeLa cells were preincubated 15 min with 25-fold molar excess of heterologous (lane 2), homologous (lane 3), and non-related heterologous (lane 5) RNAs prior to the addition of [α- 32 P]ATP labeled 3 ′ UTR(A). Free RNA was loaded on lane 1. (C) [α- 32 P]UTP labeled 3 ′ UTR RNA was cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) and immunoprecipitated with anti-La (lane 3) or anti-actin antibodies (lane 2). (D) [α- 32 P]UTP labeled 3 ′ UTR RNA was UV-cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) or 100 and 500 ng of recombinant PTB protein (lanes 2 and 3, respectively). After UV-cross-linking, the reaction was followed by RNase treatment. Crosslinked proteins were loaded on an SDS–10% polyacrylamide gel and detected by autoradiography. The migration of the UV-crosslinked 68 kDa, rPTB, and the immunoprecipitated La proteins is indicated by an arrow.
    α 32 P Atp, supplied by ICN Pharmaceuticals, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/ICN Pharmaceuticals
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    Valiant α 32 p atp
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 92/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Valiant
    Average 92 stars, based on 82 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    91
    Valiant mci α 32 p atp
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    Mci α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mci α 32 p atp/product/Valiant
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    mci α 32 p atp - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    93
    PerkinElmer nucleotide α 32 p atp
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    Nucleotide α 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nucleotide α 32 p atp/product/PerkinElmer
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    nucleotide α 32 p atp - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    85
    PerkinElmer α 32 p atp labeled
    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 <t>P]ATP-labeled</t> pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in
    α 32 P Atp Labeled, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 85/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp labeled/product/PerkinElmer
    Average 85 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp labeled - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    91
    HARTMANN ANALYTIC α 32 p atp utp
    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P <t>α-ATP/α-UTP</t> and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.
    α 32 P Atp Utp, supplied by HARTMANN ANALYTIC, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp utp/product/HARTMANN ANALYTIC
    Average 91 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp utp - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    92
    ICN Biomedicals α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by ICN Biomedicals, used in various techniques. Bioz Stars score: 92/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/ICN Biomedicals
    Average 92 stars, based on 42 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    Thermo Fisher α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 220 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Thermo Fisher
    Average 92 stars, based on 220 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    Promega α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 77 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/Promega
    Average 92 stars, based on 77 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    GeneWorks α 32 p atp
    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. <t>UTP/CTP/ATP</t> and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.
    α 32 P Atp, supplied by GeneWorks, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp/product/GeneWorks
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    88
    PerkinElmer mbq α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Mbq α 32 P Atp, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 88/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mbq α 32 p atp/product/PerkinElmer
    Average 88 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    mbq α 32 p atp - by Bioz Stars, 2020-07
    88/100 stars
      Buy from Supplier

    92
    Valiant radioactive α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Radioactive α 32 P Atp, supplied by Valiant, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/radioactive α 32 p atp/product/Valiant
    Average 92 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    radioactive α 32 p atp - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    85
    GE Healthcare mbq α 32 p atp
    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 <t>P-ATP.</t> A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .
    Mbq α 32 P Atp, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mbq α 32 p atp/product/GE Healthcare
    Average 85 stars, based on 20 article reviews
    Price from $9.99 to $1999.99
    mbq α 32 p atp - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    90
    PerkinElmer α 32 p atp radionucleotide
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Atp Radionucleotide, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp radionucleotide/product/PerkinElmer
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp radionucleotide - by Bioz Stars, 2020-07
    90/100 stars
      Buy from Supplier

    80
    DuPont de Nemours α 32 p atp nen dupont
    <t>ATP</t> hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.
    α 32 P Atp Nen Dupont, supplied by DuPont de Nemours, used in various techniques. Bioz Stars score: 80/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/α 32 p atp nen dupont/product/DuPont de Nemours
    Average 80 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    α 32 p atp nen dupont - by Bioz Stars, 2020-07
    80/100 stars
      Buy from Supplier

    Image Search Results


    A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009

    Journal: eLife

    Article Title: Redox signaling via the molecular chaperone BiP protects cells against endoplasmic reticulum-derived oxidative stress

    doi: 10.7554/eLife.03496

    Figure Lengend Snippet: A BiP ATPase mutant is not sufficient to protect cells during oxidative stress. ( A ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Data represent the means ± SD of three independent assays. ( B ) CSY278 containing plasmids pCS681, pCS774, pCS687, or empty vector were spotted on SMM-leu or SMM Gal-leu plates, and plates were incubated at 37°C for 3 d. ( C ) CSY275 containing a UPRE- lacZ reporter (pCS852) and plasmids pCS681, pCS802, pCS774, pCS687, pCS688, or pCS750 were cultured in SMM-ura-leu at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Three independent transformants of each strain were grown and assayed for beta–galactosidase activity in duplicate. Data represent the mean of averaged values for the three transformants ± SD. DOI: http://dx.doi.org/10.7554/eLife.03496.009

    Article Snippet: ATPase activity To measure ATPase activity, 1 µM C-terminally tagged Kar2 and 2.5 µM GST-Sec63J were incubated with 0.1 mM of cold ATP and 0.45 µCi of [alpha-32 P]ATP (Perkin–Elmer, Waltham, MA) in ATPase buffer (50 mM Tris–HCl, pH 7.4, 50 mM KCl, 5 mM MgCl2 , 1 mM DTT) in a total volume of 45 µl at room temperature.

    Techniques: Mutagenesis, Plasmid Preparation, Incubation, Cell Culture, Activity Assay

    Replacement of the BiP cysteine with aspartic acid, phenylalanine, tyrosine, or tryptophan results in decreased BiP function. ( A ) CSY214 containing the plasmids pCS681, pCS802, pCS687, pCS688, pCS750 or empty vector were spotted onto SMM plates with or without 5-fluoroorotic acid (5-FOA) and incubated for 2 d at 30°C. ( B ) CSY289, 290, 368, 292, and 293 were spotted onto YPD plates and incubated at 24°, 30°, and 37°C. ( C ) Strains from B were cultured at 24°C to log-phase in YPD and shifted to 37°C for 90 min prior to harvest. Accumulation of unprocessed untranslocated forms of the proteins Kar2, PDI, and Gas1 were detected by western blotting. ( D ) Strains from B containing an UPRE- lacZ reporter plasmid (pJC8) were cultured in SMM-ura at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Samples were assayed for beta–galactosidase activity. Three independent transformants of each strain were grown and assayed in duplicate. Data represent the mean of averaged values for the three transformants ± SD. ( E – G ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Panels F and G show CHP and NEM-treated samples, respectively. Samples without chemical additions in panels F and G were mock treated to match the CHP or NEM-treatment. Data represent the means ± SD of three independent assays. DOI: http://dx.doi.org/10.7554/eLife.03496.007

    Journal: eLife

    Article Title: Redox signaling via the molecular chaperone BiP protects cells against endoplasmic reticulum-derived oxidative stress

    doi: 10.7554/eLife.03496

    Figure Lengend Snippet: Replacement of the BiP cysteine with aspartic acid, phenylalanine, tyrosine, or tryptophan results in decreased BiP function. ( A ) CSY214 containing the plasmids pCS681, pCS802, pCS687, pCS688, pCS750 or empty vector were spotted onto SMM plates with or without 5-fluoroorotic acid (5-FOA) and incubated for 2 d at 30°C. ( B ) CSY289, 290, 368, 292, and 293 were spotted onto YPD plates and incubated at 24°, 30°, and 37°C. ( C ) Strains from B were cultured at 24°C to log-phase in YPD and shifted to 37°C for 90 min prior to harvest. Accumulation of unprocessed untranslocated forms of the proteins Kar2, PDI, and Gas1 were detected by western blotting. ( D ) Strains from B containing an UPRE- lacZ reporter plasmid (pJC8) were cultured in SMM-ura at 24°C to log-phase and shifted to 37°C (with or without 2 mM DTT) for 90 min prior to harvest. Samples were assayed for beta–galactosidase activity. Three independent transformants of each strain were grown and assayed in duplicate. Data represent the mean of averaged values for the three transformants ± SD. ( E – G ) ATP hydrolysis was assessed by determining the fraction of [alpha- 32 P]ATP converted to [alpha- 32 P]ADP as described in the 'Materials and methods'. Panels F and G show CHP and NEM-treated samples, respectively. Samples without chemical additions in panels F and G were mock treated to match the CHP or NEM-treatment. Data represent the means ± SD of three independent assays. DOI: http://dx.doi.org/10.7554/eLife.03496.007

    Article Snippet: ATPase activity To measure ATPase activity, 1 µM C-terminally tagged Kar2 and 2.5 µM GST-Sec63J were incubated with 0.1 mM of cold ATP and 0.45 µCi of [alpha-32 P]ATP (Perkin–Elmer, Waltham, MA) in ATPase buffer (50 mM Tris–HCl, pH 7.4, 50 mM KCl, 5 mM MgCl2 , 1 mM DTT) in a total volume of 45 µl at room temperature.

    Techniques: Plasmid Preparation, Incubation, Cell Culture, Western Blot, Activity Assay

    Labeling and biochemical characterization of T7 RNAP activity. ( A ) Synthesis of Cy5-conjugated HaloTag Ligand ( S3 ) used to label RNAP from Cy5 acid S1 and HaloTag ligand-amine S2 . See ‘Materials and methods’ for details. ( B ) SDS-PAGE gel images of the unlabeled (‘RNAP’: no HaloTag; ‘Halo-RNAP’: with HaloTag) and the Cy5-labeled Halo-RNAP (‘Cy5-Halo-RNAP’) T7 RNAP. All RNAPs have a 6(His) tag at the N-terminus used for purification. Top: image stained with Coomassie Brilliant Blue. Bottom: the same gel scanned for Cy5 fluorescence (prior to Coomassie staining). ( C ) In vitro transcription activity of RNAP. The concentrations of RNAP derivatives were as indicated. The DNA template (a PCR fragment spanning from −75 to +295 of the concensus T7 RNAP promoter), was used at 10 nM. RNA products were labeled by incorporation of α 32 P-ATP, resolved on a denaturing polyacrylamide gel, and imaged by autoradiography. The major bands at ∼295 nt are the expected run-off products. DOI: http://dx.doi.org/10.7554/eLife.01775.009

    Journal: eLife

    Article Title: Single-molecule tracking of the transcription cycle by sub-second RNA detection

    doi: 10.7554/eLife.01775

    Figure Lengend Snippet: Labeling and biochemical characterization of T7 RNAP activity. ( A ) Synthesis of Cy5-conjugated HaloTag Ligand ( S3 ) used to label RNAP from Cy5 acid S1 and HaloTag ligand-amine S2 . See ‘Materials and methods’ for details. ( B ) SDS-PAGE gel images of the unlabeled (‘RNAP’: no HaloTag; ‘Halo-RNAP’: with HaloTag) and the Cy5-labeled Halo-RNAP (‘Cy5-Halo-RNAP’) T7 RNAP. All RNAPs have a 6(His) tag at the N-terminus used for purification. Top: image stained with Coomassie Brilliant Blue. Bottom: the same gel scanned for Cy5 fluorescence (prior to Coomassie staining). ( C ) In vitro transcription activity of RNAP. The concentrations of RNAP derivatives were as indicated. The DNA template (a PCR fragment spanning from −75 to +295 of the concensus T7 RNAP promoter), was used at 10 nM. RNA products were labeled by incorporation of α 32 P-ATP, resolved on a denaturing polyacrylamide gel, and imaged by autoradiography. The major bands at ∼295 nt are the expected run-off products. DOI: http://dx.doi.org/10.7554/eLife.01775.009

    Article Snippet: In ensemble measurements, 10 nM DNA template (same PCR fragment as used in single-molecule assays), 0.17 μCi/μl α-32 P-ATP (Perkin Elmer, Waltham, MA) and different concentrations of RNAP were also included in the reaction.

    Techniques: Labeling, Activity Assay, SDS Page, Purification, Staining, Fluorescence, In Vitro, Polymerase Chain Reaction, Autoradiography

    Endoribonucleolytic activity of Sso aIF5A. (a) Lane 1, [α- 32 P] ATP was loaded on the gel. Lane 2, incubation of 5′-PPP-GGA*-″-3′ RNA for 22 min at 65°C. Lanes 3–14, time course of degradation of 5′-PPP-GGA*-″-3′ RNA at 65°C in the presence of N-His-aIF5A purified from E. coli . The blue arrows indicate the full-length RNA and the single A nucleotide. The red arrow indicates a stable degradation product. (b) Lane 1, RNA size marker. Lane 2, incubation of 5´end-labelled 2508sh RNA for 22 min at 65°C. Lanes 3–14, time course of degradation of 5´end-labelled 2508sh RNA at 65°C in the presence of N-His-aIF5A purified from E. coli . The arrow indicates the accumulation of a stable degradation product. Only the relevant part of the autoradiogram is shown.

    Journal: RNA Biology

    Article Title: Indications for a moonlighting function of translation factor aIF5A in the crenarchaeum Sulfolobus solfataricus

    doi: 10.1080/15476286.2019.1582953

    Figure Lengend Snippet: Endoribonucleolytic activity of Sso aIF5A. (a) Lane 1, [α- 32 P] ATP was loaded on the gel. Lane 2, incubation of 5′-PPP-GGA*-″-3′ RNA for 22 min at 65°C. Lanes 3–14, time course of degradation of 5′-PPP-GGA*-″-3′ RNA at 65°C in the presence of N-His-aIF5A purified from E. coli . The blue arrows indicate the full-length RNA and the single A nucleotide. The red arrow indicates a stable degradation product. (b) Lane 1, RNA size marker. Lane 2, incubation of 5´end-labelled 2508sh RNA for 22 min at 65°C. Lanes 3–14, time course of degradation of 5´end-labelled 2508sh RNA at 65°C in the presence of N-His-aIF5A purified from E. coli . The arrow indicates the accumulation of a stable degradation product. Only the relevant part of the autoradiogram is shown.

    Article Snippet: 10 pmol of dephosphorylated 2508sh RNA were radiolabeled at the 5´-end with T4 Polynucleotide Kinase (Thermo Scientific) in the presence of 15 pmol of [α-32 P]ATP (3000 Ci/mmol, Hartmann Analytic GmbH).

    Techniques: Activity Assay, Incubation, Purification, Marker

    A novel SBD mutant exhibits impaired chaperone holdase activity but retains Hsp70 nucleotide exchange capacity. (A) Crystal structure of the Sse1 β-domain, with amino acids selected for mutations highlighted in red ( Xu et al. , 2012 ). (B) Fluorescence anisotropy was performed with increasing concentrations of chaperone (Sse1 or Sse1 sbd ) binding fluorescently labeled ATP-FAM. (C) Nucleotide exchange activity assays using HSPA8 (Hsp70) prebound to α- 32 P-ATP in the presence or absence of Sse1. (D) Holdase experiments were conducted using chemically denatured FFL (200 nM) diluted into refolding buffer without chaperone (no chap), with Sse1 (400 nM), or with Sse1 sbd (400 nM). FFL diluted into denaturing buffer instead of folding buffer was used as an aggregation control (denat). (E) Differential centrifugation analysis of FFL aggregation in the absence of chaperone or with Sse1 or Sse1 sbd after a 30-min holdase assay. Samples were visualized by SDS–PAGE, followed by Coomassie stain, and scanning densitometry quantitation was performed to determine FFL aggregation under each condition. (F) Endpoint analysis of holdase experiments performed as in D, using denatured FFL with varying ratios of chaperone to substrate, quantified as fraction of total aggregation.

    Journal: Molecular Biology of the Cell

    Article Title: Substrate binding by the yeast Hsp110 nucleotide exchange factor and molecular chaperone Sse1 is not obligate for its biological activities

    doi: 10.1091/mbc.E17-01-0070

    Figure Lengend Snippet: A novel SBD mutant exhibits impaired chaperone holdase activity but retains Hsp70 nucleotide exchange capacity. (A) Crystal structure of the Sse1 β-domain, with amino acids selected for mutations highlighted in red ( Xu et al. , 2012 ). (B) Fluorescence anisotropy was performed with increasing concentrations of chaperone (Sse1 or Sse1 sbd ) binding fluorescently labeled ATP-FAM. (C) Nucleotide exchange activity assays using HSPA8 (Hsp70) prebound to α- 32 P-ATP in the presence or absence of Sse1. (D) Holdase experiments were conducted using chemically denatured FFL (200 nM) diluted into refolding buffer without chaperone (no chap), with Sse1 (400 nM), or with Sse1 sbd (400 nM). FFL diluted into denaturing buffer instead of folding buffer was used as an aggregation control (denat). (E) Differential centrifugation analysis of FFL aggregation in the absence of chaperone or with Sse1 or Sse1 sbd after a 30-min holdase assay. Samples were visualized by SDS–PAGE, followed by Coomassie stain, and scanning densitometry quantitation was performed to determine FFL aggregation under each condition. (F) Endpoint analysis of holdase experiments performed as in D, using denatured FFL with varying ratios of chaperone to substrate, quantified as fraction of total aggregation.

    Article Snippet: HSPA8 (70 µg) was loaded with 100 µCi of α-32 P-ATP in a total volume of 120 µl of complex buffer (25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid [HEPES]–KOH, pH 7.5, 100 mM KCl, 11 mM MgOAc, and 25 µM ATP) for 30 min at 4°C, and HSPA8–32 P-ATP complex was obtained by centrifugation through a Microspin G-25 column (GE Healthcare, Chicago, IL).

    Techniques: Mutagenesis, Activity Assay, Fluorescence, Binding Assay, Labeling, Centrifugation, SDS Page, Staining, Quantitation Assay

    Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Journal: Nucleic Acids Research

    Article Title: Efficient incorporation of CoA, NAD and FAD into RNA by in vitro transcription

    doi:

    Figure Lengend Snippet: Separation of CoA–RNA and pppRNA by PAGE after a specific cleavage by a DNazyme (13). ( A ) Scheme of RNA from transcription and after DNazyme cleavage. In the presence of De-P-CoA, transcription produces a mixture of pppRNA ( N , N +1 and N +2 bands, N = 35mer) and CoA–RNA ( N , N +1 and N +2 bands). A DNazyme (5′-TGATC GGCTAGGCTAGCTACAACGAGGCTGGCCGC) cuts at a specific location (marked by an arrow), resulting in both pppRNA and CoA–RNA with a defined length of 25 nt. The bold A is the initiating nucleotide of transcription. RNA portions removed by the DNazyme are boxed. ( B ) Effect of ATP and De-P-CoA on transcription. After transcription, RNA was digested by the DNazyme and then fractionated by 12% denaturing gel electrophoresis. All transcription reactions were performed with the same concentration of [α- 32 P]ATP (0.1 µM). The relative ratios of [α- 32 P]ATP/ATP from lane 1 to 5 were 1, 1, 2, 5, and 10, respectively. These different ratios were considered in the calculation of total RNA yields (relative to lane 1).

    Article Snippet: For quantitation purposes, [α-32 P]ATP (NEN Life Science, Boston, MA) was also added to transcription solutions to internally label RNA transcripts.

    Techniques: Polyacrylamide Gel Electrophoresis, Nucleic Acid Electrophoresis, Concentration Assay

    UV-induced cross-linking of the complete 3 ′ UTR and the 3 ′ UTR (A) of NV and S10 extract from HeLa cells. (A) [α- 32 P]ATP labeled 3 ′ UTR (lanes 1 and 2) and 3 ′ UTR(A) (lane 3) RNAs were UV-crosslinked without (lane 1) or with 60 μg of S10 extract from HeLa cells (lanes 2–3). (B) Forty micrograms of S10 extract from HeLa cells were preincubated 15 min with 25-fold molar excess of heterologous (lane 2), homologous (lane 3), and non-related heterologous (lane 5) RNAs prior to the addition of [α- 32 P]ATP labeled 3 ′ UTR(A). Free RNA was loaded on lane 1. (C) [α- 32 P]UTP labeled 3 ′ UTR RNA was cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) and immunoprecipitated with anti-La (lane 3) or anti-actin antibodies (lane 2). (D) [α- 32 P]UTP labeled 3 ′ UTR RNA was UV-cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) or 100 and 500 ng of recombinant PTB protein (lanes 2 and 3, respectively). After UV-cross-linking, the reaction was followed by RNase treatment. Crosslinked proteins were loaded on an SDS–10% polyacrylamide gel and detected by autoradiography. The migration of the UV-crosslinked 68 kDa, rPTB, and the immunoprecipitated La proteins is indicated by an arrow.

    Journal: Biochemical and Biophysical Research Communications

    Article Title: La, PTB, and PAB proteins bind to the 3′ untranslated region of Norwalk virus genomic RNA

    doi: 10.1016/j.bbrc.2003.10.066

    Figure Lengend Snippet: UV-induced cross-linking of the complete 3 ′ UTR and the 3 ′ UTR (A) of NV and S10 extract from HeLa cells. (A) [α- 32 P]ATP labeled 3 ′ UTR (lanes 1 and 2) and 3 ′ UTR(A) (lane 3) RNAs were UV-crosslinked without (lane 1) or with 60 μg of S10 extract from HeLa cells (lanes 2–3). (B) Forty micrograms of S10 extract from HeLa cells were preincubated 15 min with 25-fold molar excess of heterologous (lane 2), homologous (lane 3), and non-related heterologous (lane 5) RNAs prior to the addition of [α- 32 P]ATP labeled 3 ′ UTR(A). Free RNA was loaded on lane 1. (C) [α- 32 P]UTP labeled 3 ′ UTR RNA was cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) and immunoprecipitated with anti-La (lane 3) or anti-actin antibodies (lane 2). (D) [α- 32 P]UTP labeled 3 ′ UTR RNA was UV-cross-linked with 60 μg of S10 extract from HeLa cells (lane 1) or 100 and 500 ng of recombinant PTB protein (lanes 2 and 3, respectively). After UV-cross-linking, the reaction was followed by RNase treatment. Crosslinked proteins were loaded on an SDS–10% polyacrylamide gel and detected by autoradiography. The migration of the UV-crosslinked 68 kDa, rPTB, and the immunoprecipitated La proteins is indicated by an arrow.

    Article Snippet: For synthesis of radiolabeled RNA transcripts, [α-32 P]UTP or [α-32 P]ATP (Dupont) was included in the transcription reaction.

    Techniques: Labeling, Immunoprecipitation, Recombinant, Autoradiography, Migration

    Specificity of RNA–protein complexes formed with the complete 3 ′ UTR and the 3 ′ UTR(A) of NV with S10 extract from HeLa cells. (A) [α- 32 P]ATP labeled 3 ′ UTR(A) RNA was incubated with 10 μg of S10 extract from HeLa cells in the absence (lanes 1 and 2) or presence of 25-fold molar excess of unlabeled homologous (lane 3), heterologous (lane 4), and non-related heterologous competitors (lane 5). (B) Ten micrograms of S10 extract from HeLa cells was incubated in the absence (lanes 1 and 2) or in the presence of 1.5 μl of polyclonal antibodies to human PAB protein (lane 3) or an anti-GADPH antibody (lane 4) before the addition of [α- 32 P]ATP labeled 3 ′ UTR(A) RNA. The antibody–RNA–protein supercomplex was further processed under the same conditions described for the RNA–protein complex. (C) [α- 32 P]ATP labeled 3 ′ UTR RNA (lane 2) or 3 ′ UTR(A) (lanes 1 and 3) was incubated in the absence (lane 1) or presence of 100 ng of recombinant PAB protein (lanes 2 and 3) followed by RNase treatment. Complex formation was assayed by electrophoresis on native polyacrylamide gels and detected by autoradiography. Free RNA was loaded on lane 1. Mobility of complexes formed with S10 HeLa cell extract and with the rPABP is indicated on the right-hand side of the figure.

    Journal: Biochemical and Biophysical Research Communications

    Article Title: La, PTB, and PAB proteins bind to the 3′ untranslated region of Norwalk virus genomic RNA

    doi: 10.1016/j.bbrc.2003.10.066

    Figure Lengend Snippet: Specificity of RNA–protein complexes formed with the complete 3 ′ UTR and the 3 ′ UTR(A) of NV with S10 extract from HeLa cells. (A) [α- 32 P]ATP labeled 3 ′ UTR(A) RNA was incubated with 10 μg of S10 extract from HeLa cells in the absence (lanes 1 and 2) or presence of 25-fold molar excess of unlabeled homologous (lane 3), heterologous (lane 4), and non-related heterologous competitors (lane 5). (B) Ten micrograms of S10 extract from HeLa cells was incubated in the absence (lanes 1 and 2) or in the presence of 1.5 μl of polyclonal antibodies to human PAB protein (lane 3) or an anti-GADPH antibody (lane 4) before the addition of [α- 32 P]ATP labeled 3 ′ UTR(A) RNA. The antibody–RNA–protein supercomplex was further processed under the same conditions described for the RNA–protein complex. (C) [α- 32 P]ATP labeled 3 ′ UTR RNA (lane 2) or 3 ′ UTR(A) (lanes 1 and 3) was incubated in the absence (lane 1) or presence of 100 ng of recombinant PAB protein (lanes 2 and 3) followed by RNase treatment. Complex formation was assayed by electrophoresis on native polyacrylamide gels and detected by autoradiography. Free RNA was loaded on lane 1. Mobility of complexes formed with S10 HeLa cell extract and with the rPABP is indicated on the right-hand side of the figure.

    Article Snippet: For synthesis of radiolabeled RNA transcripts, [α-32 P]UTP or [α-32 P]ATP (Dupont) was included in the transcription reaction.

    Techniques: Labeling, Incubation, Recombinant, Electrophoresis, Autoradiography

    Mobility-shift analysis of the complete 3 ′ UTR and the 3 ′ UTR (A) of NV and S10 extract from HeLa cells. (A) [α- 32 P]UTP labeled 3 ′ UTR (lanes 1 and 2) or 3 ′ UTR(A) RNAs were incubated in the absence (lane 1) or presence of 20 μg of S10 extract from HeLa cells (lane 2 and 3) followed by RNAse treatment. (B) [α- 32 P]ATP labeled 3 ′ UTR (lane 3) or 3 ′ UTR(A) RNAs (lanes 1 and 2) were incubated in the absence (lane 1) or presence of 10 μg of S10 extract from HeLa cells (lanes 2 and 3) followed by RNAse treatment. Complex formation was assayed by electrophoresis on native polyacrylamide gels and detected by autoradiography. Mobility of complexes is indicated on both sides of the figure.

    Journal: Biochemical and Biophysical Research Communications

    Article Title: La, PTB, and PAB proteins bind to the 3′ untranslated region of Norwalk virus genomic RNA

    doi: 10.1016/j.bbrc.2003.10.066

    Figure Lengend Snippet: Mobility-shift analysis of the complete 3 ′ UTR and the 3 ′ UTR (A) of NV and S10 extract from HeLa cells. (A) [α- 32 P]UTP labeled 3 ′ UTR (lanes 1 and 2) or 3 ′ UTR(A) RNAs were incubated in the absence (lane 1) or presence of 20 μg of S10 extract from HeLa cells (lane 2 and 3) followed by RNAse treatment. (B) [α- 32 P]ATP labeled 3 ′ UTR (lane 3) or 3 ′ UTR(A) RNAs (lanes 1 and 2) were incubated in the absence (lane 1) or presence of 10 μg of S10 extract from HeLa cells (lanes 2 and 3) followed by RNAse treatment. Complex formation was assayed by electrophoresis on native polyacrylamide gels and detected by autoradiography. Mobility of complexes is indicated on both sides of the figure.

    Article Snippet: For synthesis of radiolabeled RNA transcripts, [α-32 P]UTP or [α-32 P]ATP (Dupont) was included in the transcription reaction.

    Techniques: Mobility Shift, Labeling, Incubation, Electrophoresis, Autoradiography

    Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 P]ATP-labeled pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in

    Journal: RNA

    Article Title: Dynamic guide-target interactions contribute to sequential 2?-O-methylation by a unique archaeal dual guide box C/D sRNP

    doi: 10.1261/rna.1003308

    Figure Lengend Snippet: Methylation activity of RNPs assembled on WT and box mutant guide RNAs are not similar. TLC analyses of RNase T2-digested [α- 32 P]ATP-labeled pre-tRNA Trp Δ67 after methylation by RNP containing wild-type or box mutant intron are shown in

    Article Snippet: A typical 100 μL transcription reaction performed at 37°C for 3–4 h contained 40 mM Tris-Cl, pH 7.9, 6 mM MgCl2 , 10 mM DTT (dithiothreitol), 2 mM spermidine, 20 μCi of [α-32 P]ATP (MP Biomedicals, sp. act.

    Techniques: Methylation, Activity Assay, Mutagenesis, Thin Layer Chromatography, Labeling

    Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P α-ATP/α-UTP and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.

    Journal: Nature Communications

    Article Title: Tailing and degradation of Argonaute-bound small RNAs protect the genome from uncontrolled RNAi

    doi: 10.1038/ncomms15332

    Figure Lengend Snippet: Cid14/Cid16 and Rrp6 degrade Argonaute-bound sRNAs. ( a ) Western blotting analysis of co-immunoprecipitation assay showing that Argonaute interacts with Cid14 in vivo . ( b ) Autoradiograph of denaturing polyacrylamide gel showing Cid14 and Cid16 activity on Argonaute-bound sRNA. 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells 9 . Argonaute was incubated with Cid14/Cid16 and 32 P α-ATP/α-UTP and sRNA was analysed on denaturing polyacrylamide gel. ( c ) Quantification of Argonaute-bound sRNAs that have non-templated nucleotides at the 3′ end in indicated strains. ( d , e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14, Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1 Δ cells. Argonaute was incubated with Cid14, Cid16 and Triman or Rrp6. ( e ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Cid16 and Triman or Rrp6. ( f ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid14 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 and Cid14DADA. 30 nucleotide long DNA was used as a loading control. ( g ) Autoradiograph of denaturing polyacrylamide gel showing degradation of Argonaute-bound sRNA by Cid16 and Rrp6. 5′ 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid16 and Cid16DADA. 30 nucleotide long DNA was used as a loading control. ( h , i ) Autoradiograph of denaturing polyacrylamide gel showing time course of Argonaute-bound sRNA degradation by Cid14/Cid16 and Rrp6. 32 P-labelled 22 nucleotide long sRNA was loaded onto empty Argonaute purified from dcr1Δtri1Δ cells. Argonaute was incubated with Rrp6, Cid14 ( h ) or Cid16 ( i ). Time when reaction was stopped is indicated above the image.

    Article Snippet: sRNAs tailing assay Overall, 500 fmol to 1 pmol of double-strand or single strand 22 nucleotides long RNAs were incubated with 80 ng of Cid14 and Cid16 in buffer containing 1 mM Hepes pH 7.5, 0.5 mM MgCl2 , 0.5 mM MnCl2 , 25 mM KCl, 0.2 mM DTT, 40U Ribolock (Thermo Scientific) and 150 nM α-32 P-ATP/UTP (Hartmann Analytic) for 2 h at 32 °C.

    Techniques: Western Blot, Co-Immunoprecipitation Assay, In Vivo, Autoradiography, Activity Assay, Purification, Incubation

    Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. UTP/CTP/ATP and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.

    Journal: Nucleic Acids Research

    Article Title: Formation of the conserved pseudouridine at position 55 in archaeal tRNA

    doi: 10.1093/nar/gkl530

    Figure Lengend Snippet: Analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. ( A ) Cloverleaf structure of tRNA Asp of P.furiosus used as the wild-type tRNA substrate in this work. The universal numbering system for nucleotides in tRNA corresponds to that of ( 4 ). U55 is indicated. C75 and A76 (missing in −3′CA substrates) are indicated by a dashed box. The portion of the tRNA sequence included in the miniS substrate is indicated by the plain box. ( B ) The expected patterns of nuclease P1 and RNase T2 cleavage in the U55 region of an [α- 32 P]UTP- and [α- 32 P]CTP-labeled tRNA, respectively. Nuclease P1 generates 5′-phosphate-nucleosides while RNase T2 generates 3′phosphate-nucleosides. ( C ) 2D-TLC analysis of pfu Cbf5 and pfu Pus10 modification of various tRNA substrates. WT indicates wild-type pfu tRNA Asp (panels 1–4, 9–12); U55C indicates U55 replacement mutant (panels 5,6,13,14); miniS indicates mini-substrate (panels 7,15) and −3′CA indicates 3′ terminal CA deletion (panels 8,16). See text for more details. UTP/CTP/ATP and GTP refer to the ( 32 P)-labeled nucleotide incorporated at transcription. Incubation was for 1 h at 70°C in the presence of 0.12 nmol (5 µg) of pfu Cbf5 (panels 1–8) and 0.01 nmol (0.5 µg) of pfu Pus10 (panels 9–16). After incubation, the RNA was digested by nuclease P1 or RNase T2 (as indicated in each panel) and the resulting nucleotides were analyzed by 2D-TLC on cellulose plates and autoradiography. Circles in dotted lines show the migration of the canonical nucleotides used as UV markers.

    Article Snippet: [α-32 P]UTP, [α-32 P]CTP, [α-32 P]ATP and [α-32 P]GTP (400 Ci/mmol) were from ICN Biomedicals and T7 RNA polymerase was from Roche Diagnostics.

    Techniques: Modification, Sequencing, Labeling, Thin Layer Chromatography, Mutagenesis, Incubation, Autoradiography, Migration

    FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 P-ATP. A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .

    Journal: Nature structural & molecular biology

    Article Title: FICD acts bi-functionally to AMPylate and de-AMPylate the endoplasmic reticulum chaperone BiP

    doi: 10.1038/nsmb.3337

    Figure Lengend Snippet: FICD de-AMPylates BiP in vitro ( a ) Autoradiograph of an SDS-PAGE gel loaded with AMPylated BiP (BiP- 32 P-AMP) that had been exposed to wildtype of mutant FICD for the indicated time Wildtype FICD-dependent de-AMPylation of BiP- 32 P-AMP was observed in four independent experiments. ( b ) IEF immunoblots of endogenous BiP from lysates of untreated or cycloheximide-treated (CHX) CHO-K1 cells that had been reacted in vitro with the indicated FICD enzymes. ( c ) Autoradiograph and Coomassie stain (CBB) of an SDS-PAGE gel of BiP after exposure to wildtype or mutant versions of FICD in presence of α- 32 P-ATP. A representative of three independent experiments is shown ( n = 3). ( d ) Time-dependent plot of fluorescence polarization (FP) of BiP AMPylated with FAM-labeled AMP (BiP T518-AMP-FAM ) following exposure to the indicated FICD proteins. The decrease in the FP signal reflects release of the fluorophore from BiP. A representative of five independent experiments is shown ( n = 5). Uncropped autoradiograph, gel and blot images are shown in Supplementary Data Set 1 .

    Article Snippet: Radioactive in vitro AMPylation ( ) reactions were set up in a final volume of 37.5 µl containing 1 µM of ATP hydrolysis-deficient mutant BiP protein (BiPT229A ) , 0.1 µM wildtype or mutant FICD proteins, 40 µM ATP, and 0.023 MBq α-32 P-ATP (EasyTide; Perkin Elmer).

    Techniques: In Vitro, Autoradiography, SDS Page, Mutagenesis, Electrofocusing, Western Blot, Staining, Fluorescence, Labeling

    ATP hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Negative cooperativity in the nitrogenase Fe protein electron delivery cycle

    doi: 10.1073/pnas.1613089113

    Figure Lengend Snippet: ATP hydrolysis data fits. Presteady-state, quench-flow measurements of the time course of ATP hydrolysis by rapidly mixing MoFe protein (10 μM) and Fe protein (40 μM) with [α- 32 P]ATP (2 mM) (●). Dashed black line: half-sites model, Scheme B, using rate constants, k ET = 140 s −1 , k ATP = 36 s −1 , k Pi = 16 s −1 , and k off = 11.9 s −1 , as derived from the phenomenological fits to the experimental data, along with the recharging model. Solid black line: independent-sites model, Scheme A, calculated analogously. Red line: calculated from the rate parameters obtained by the global fit to negative cooperativity Scheme C, as given in the scheme. ( Inset ) Data and simulations to longer times.

    Article Snippet: [α-32 P]ATP radionucleotide was purchased from PerkinElmer.

    Techniques: Flow Cytometry, Derivative Assay