zr plasmid miniprep kit  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Zymo Research zr plasmid miniprep kit
    Zr Plasmid Miniprep Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/zr plasmid miniprep kit/product/Zymo Research
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    zr plasmid miniprep kit - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Bait plasmids of UNC-89 Ig53 and UNC-89 Fn2 were created by cloning of PCR-amplified fragments using primers shown in Supplemental Table S3 and inserted into pGBDU-C1. .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: Paragraph title: Cloning of miR-23b promoter region ... The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Paragraph title: Gene cloning and sequencing of TaOr8 and TaORco ... Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. The pVRa32_1122 and pVRb32_1122 plasmids for cloning ECF32 and its cognate promoter pECF32 were purchased from Addgene (ID 49689 and 49722, respectively). sRNA-A was synthesized in a gBlock.

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: The 5′URS were cloned as a Sac I/Spe I fragment, replacing the authentic GPD promoter. .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: Caldicellulosiruptor genomic DNA (gDNA) for cloning, vector construction, and genome sequencing was extracted as described previously ( ). .. Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz).

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: Cycling conditions were as follows: 95°C/10 min; 35 cycles of 95°C/40 s, 58°C/40 s, 72°C/40 s; 72°C/7 min. Products were separated on 1.5% agarose gels, and bands of interest were excised, gel-eluted (Nucleospin extract: Macherey-Nagel) and cloned into pGEM-T Easy vector (Promega). .. The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel). .. We ensured that no other mutation was introduced by sequencing the entire cDNA of NTN1 .

    Amplification:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: T4 DNA ligase (New England Biolabs, cat. no.M0202) T4 DNA Ligase Buffer 10× (New England Biolabs, cat. no. B0202S) T4 Polynucleotide Kinase (New England Biolabs, cat. no. M0201) Deoxyribonucleotide triphosphates (dNTPs; 10 mM each nucleotide; New England Biolabs, cat. no. N0447) DpnI restriction endonuclease (New England Biolabs, cat. no. R0176) Taq polymerase (New England Biolabs, cat. no. M0273) Phusion® High-Fidelity DNA polymerase (New England Biolabs, cat. no. M0530S) ▲CRITICAL – a high-fidelity polymerase should be used for amplification products intended for use in downstream deep-sequencing to limit PCR errors. .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: .. Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. Additionally, Athe_1870 (GenBank accession number ), Calhy_0908 (GenBank accession number ), Calkr_0826 (GenBank accession number ), NA10_0869 (GenBank accession number ), and Calkro_0844 (GenBank accession number ) genes were E. coli codon optimized (without transmembrane domains or signal peptides) with the Integrated DNA Technologies (IDT) Codon Optimization Tool and synthesized by the DOE JGI on a pET-45 plasmid.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: PCR amplification of full-length TaOr8 or TaORco coding sequences was performed with antennal or maxillary palp-derived cDNA templates and the following primers: TaORco forward: 5′CACCATGAATGTTCAACCAACCAAG3′; TaORco reverse: TTACTTCAGCTGCACCAGCAC; TaOr8 forward: 5′CACCATGAGACTCAGAAAGATGAACG3′; TaOr8 reverse: 5′CTATTTCGGTCCATACATTGTT3′. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: ATR1 (Arabidopsis thaliana , Gene ID: 3150037), SrCPR (Stevia rebaudiana , Gene ID: 93211213), and SpGGPPS7 (Synechococcus sp., Gene ID: 86553638) were PCR amplified together with yeast codon optimized PsCYP720B4 [ ]. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol.

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: Genes of interest were amplified by PCR and inserted into vectors by Gibson assembly , using Gibson assembly master mix (New England BioLabs). .. Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz).

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: The products of reverse transcription were amplified using 2 μl aliquot of the RT reaction, 25 pmol of each gene specific primer (smd039 for secG ; smd051 for rnr ; smd041 for smpB ) and adapter-specific primer (asp001), 250 μM of each dNTP, 1,25 unit of DreamTaq (Fermentas) and 1x DreamTaq buffer. .. The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: To generate human and mouse netrin-1 AP fusion proteins in the C-terminal, human and mouse NTN1 cDNAs were amplified by PCR and cloned in pAP-Tag-5 (GenHunter, no. Q202) between NheI and BglII sites. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Mass Spectrometry:

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: Tricaine methane sulphonate (MS-222) was purchased from Norsk Medisinaldepot AS. .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    Synthesized:

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. Additionally, Athe_1870 (GenBank accession number ), Calhy_0908 (GenBank accession number ), Calkr_0826 (GenBank accession number ), NA10_0869 (GenBank accession number ), and Calkro_0844 (GenBank accession number ) genes were E. coli codon optimized (without transmembrane domains or signal peptides) with the Integrated DNA Technologies (IDT) Codon Optimization Tool and synthesized by the DOE JGI on a pET-45 plasmid.

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. The pVRa32_1122 and pVRb32_1122 plasmids for cloning ECF32 and its cognate promoter pECF32 were purchased from Addgene (ID 49689 and 49722, respectively). sRNA-A was synthesized in a gBlock.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Artificial 5′URS were synthesized by BioCat GmbH (Heidelberg, Germany). .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    TA Cloning:

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: The original TA Cloning Kit PCR 2.1 vector, INVαF’ cells, TRIzol and Dulbecco’s Modified Eagle Medium (DMEM) with non-essential amino acid and without phenol red, fetal bovine serum (FBS), 0.4% trypan blue and L-glutamine were purchased from Gibco-Invitrogen Life Technologies (Carlsbad, CA, USA). .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    Construct:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Plasmid Construction and Manipulation The multicopy yeast vector p426GPD [ ] was used for the generation of all constructs. .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA).

    SYBR Green Assay:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: Chemicals and reagents Highly pure ( > 98%) linear perfluorooctane sulfonamide (PFOSA; CF3 (CF2 )7 SO2 NH2 ) isomer, as well as isotopically labeled linear PFOSA-13 C8 and linear PFOS-13 C4 were purchased from Wellington Laboratories (Guelph, ON, Canada). iScript cDNA Synthesis Kit and iTaq SYBR Green Supermix with ROX were supplied by BioRad Laboratories (Hercules, CA, USA). .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    cDNA Library Assay:

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Yeast two-hybrid screening of a C. elegans cDNA library was performed as previously described ( ). .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Luciferase:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: Then, the fragment was purified by DNA Clean & Concentrator TM- 5 kit (Zymo Research) and inserted by using T4 DNA ligase (Promega) into the SacI–Xho I sites upstream of the firefly luciferase reporter gene in the linearized pGL3-Basic vector (Promega). .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Expressing:

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Amplicons were cloned into the pENTRTM vector using the GatewayR directional cloning system (Invitrogen Corp., Carlsbad, CA, USA) and subcloned into the Xenopus laevis expression destination vector, pSP64t RFA. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Modification:

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: The original TA Cloning Kit PCR 2.1 vector, INVαF’ cells, TRIzol and Dulbecco’s Modified Eagle Medium (DMEM) with non-essential amino acid and without phenol red, fetal bovine serum (FBS), 0.4% trypan blue and L-glutamine were purchased from Gibco-Invitrogen Life Technologies (Carlsbad, CA, USA). .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    Transformation Assay:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Assembled DNA was transformed into competent cells prepared by the CCMB80 buffer (TekNova, C3132). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. Yeast transformation was performed using the Frozen-EZ Yeast Transformation IITM (Zymo Research).

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: Bacterial colonies obtained after transformation were screened for the presence of inserts of appropriate size by colony PCR. .. The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced.

    Electroporation:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: DNA construct was transformed into Top10 Escherichia coli cells by electroporation according to the standard protocols. .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors.

    Ligation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: A starting plasmid to generate libraries that does not contain sites for the type IIS endonuclease that you plan to use for the cassette ligation strategy, such as pRNDM ( ). .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Genomic Sequencing:

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Quantitative DNA methylation analysis Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    DNA Sequencing:

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. DNA sequencing used Quintarabio DNA basic sequencing service.

    Polymerase Chain Reaction:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: BsaI restriction endonuclease (New England Biolabs, cat. no.R0535) SphI restriction endonuclease (New Englan Biolabs, cat. no.R0182) MmeI restriction endonuclease (New England Biolabs, cat. no. R0637L) S-adenosyl methionine (SAM; New England Biolabs, cat. no. B9003S) NEB3 buffer (10× with 100× BSA; New England Biolabs, cat. no.B7003) NEB4 buffer (10×; New England Biolabs, cat. no. B7004S) Agarose, PCR grade (Fisher Bioreagents, cat. no. 9012-36-6) Ethidium bromide (Sigma, cat. no. E1510) ! .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ).

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: .. Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. Additionally, Athe_1870 (GenBank accession number ), Calhy_0908 (GenBank accession number ), Calkr_0826 (GenBank accession number ), NA10_0869 (GenBank accession number ), and Calkro_0844 (GenBank accession number ) genes were E. coli codon optimized (without transmembrane domains or signal peptides) with the Integrated DNA Technologies (IDT) Codon Optimization Tool and synthesized by the DOE JGI on a pET-45 plasmid.

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Bait plasmids of UNC-89 Ig53 and UNC-89 Fn2 were created by cloning of PCR-amplified fragments using primers shown in Supplemental Table S3 and inserted into pGBDU-C1. .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Quantitative DNA methylation analysis Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: PCR amplification of full-length TaOr8 or TaORco coding sequences was performed with antennal or maxillary palp-derived cDNA templates and the following primers: TaORco forward: 5′CACCATGAATGTTCAACCAACCAAG3′; TaORco reverse: TTACTTCAGCTGCACCAGCAC; TaOr8 forward: 5′CACCATGAGACTCAGAAAGATGAACG3′; TaOr8 reverse: 5′CTATTTCGGTCCATACATTGTT3′. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: ATR1 (Arabidopsis thaliana , Gene ID: 3150037), SrCPR (Stevia rebaudiana , Gene ID: 93211213), and SpGGPPS7 (Synechococcus sp., Gene ID: 86553638) were PCR amplified together with yeast codon optimized PsCYP720B4 [ ]. .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol.

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: Genes of interest were amplified by PCR and inserted into vectors by Gibson assembly , using Gibson assembly master mix (New England BioLabs). .. Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz).

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: The original TA Cloning Kit PCR 2.1 vector, INVαF’ cells, TRIzol and Dulbecco’s Modified Eagle Medium (DMEM) with non-essential amino acid and without phenol red, fetal bovine serum (FBS), 0.4% trypan blue and L-glutamine were purchased from Gibco-Invitrogen Life Technologies (Carlsbad, CA, USA). .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: Bacterial colonies obtained after transformation were screened for the presence of inserts of appropriate size by colony PCR. .. The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced.

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: To generate human and mouse netrin-1 AP fusion proteins in the C-terminal, human and mouse NTN1 cDNAs were amplified by PCR and cloned in pAP-Tag-5 (GenHunter, no. Q202) between NheI and BglII sites. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Article Title: Markerless Gene Editing in the Hyperthermophilic Archaeon Thermococcus kodakarensis
    Article Snippet: .. Nucleospin Gel and PCR Clean-up Kit (MACHERY-NAGEL, catalog number: 740609) ZR Plasmid Miniprep kit (Zymo Research, catalog number: D4015) T4 DNA polymerase (New England Biolabs, catalog number: M0203) dGTP (Thermo Fisher Scientific, Invitrogen™, catalog number: 10297018) Swa I restriction enzyme (New England Biolabs, catalog number: R0604) dCTP (Thermo Fisher Scientific, Invitrogen™, catalog number: 10297018) NEBuffer 2.1 (New England Biolabs, catalog number: B7202S) Taq DNA polymerase (New England Biolabs, catalog number: M0267) dNTPs (Thermo Fisher Scientific, Invitrogen™, catalog number: 10297018) 700Forward primer (5’ CGCCGCAATAGCGGTCGTCGTCATGTTCCC 3’) 700Reverse primer (5’ AACAATTTCACACAGGAAACAGCTATGACC 3’) Plasmid Miniprep kit Quikchange II (Agilent Technologies, catalog number: 200523) Dpn I Gelzan (Sigma-Aldrich, catalog number: G1910) Phusion DNA polymerase (New England Biolabs, catalog number: M0530) 6-Methylpurine (Sigma-Aldrich, catalog number: M1256) Note: This product has been discontinued. .. Polysulfides Phenol (AMRESCO, catalog number: 0945) Chloroform (Sigma-Aldrich, catalog number: C2432) Isoamyl alcohol (EMD Millipore, catalog number: 1009791000) Tryptone (EMD Millipore, catalog number: 1072131000) Note: T. kodakarensis requires casein peptone that is enzymatically digested using pancreatic enzymes.

    Nucleic Acid Electrophoresis:

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Mutagenesis:

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Paragraph title: Site-directed mutagenesis ... Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    Isolation:

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Gene cloning and sequencing of TaOr8 and TaORco RNA was isolated from antennae or maxillary palps of adult female Toxorhynchites amboinensis by trizol extraction. .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: .. Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz). ..

    Labeling:

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: Chemicals and reagents Highly pure ( > 98%) linear perfluorooctane sulfonamide (PFOSA; CF3 (CF2 )7 SO2 NH2 ) isomer, as well as isotopically labeled linear PFOSA-13 C8 and linear PFOS-13 C4 were purchased from Wellington Laboratories (Guelph, ON, Canada). iScript cDNA Synthesis Kit and iTaq SYBR Green Supermix with ROX were supplied by BioRad Laboratories (Hercules, CA, USA). .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    Purification:

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research). .. The minimum regions of PPTR-1 (75-543) and PPTR-2 (10-558) for interaction with UNC-89, as determined by yeast two-hybrid analysis, were expressed as His-tagged proteins in Escherichia coli . cDNAs encoding these two proteins were PCR-amplified using primers shown in Supplemental Table S3 from yeast two-hybrid clones, and their sequences were confirmed to be error-free.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Quantitative DNA methylation analysis Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland). ..

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: DNA fragments to be assembled were amplified by PCR using Phusion High-Fidelity PCR Master Mix with GC Buffer (NEB, M0532S), purified with gel electrophoresis and Zymoclean Gel DNA Recovery Kit (Zymo Research, D4002), quantified with the nanophotometer (Implen, P330), and assembled with Gibson assembly protocol using NEBuilder HiFi DNA Assembly Master Mix (NEB, E2621S). .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015).

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. The nucleotide sequence of the cloned fragments was verified by sequencing.

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: .. The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced. ..

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel). .. We ensured that no other mutation was introduced by sequencing the entire cDNA of NTN1 .

    Sequencing:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. Sequences of all plasmids and edited portions of final strains were confirmed with Sanger sequencing (Genewiz).

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Quantitative DNA methylation analysis Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: Paragraph title: Gene cloning and sequencing of TaOr8 and TaORco ... Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland).

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. DNA sequencing used Quintarabio DNA basic sequencing service.

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. The nucleotide sequence of the cloned fragments was verified by sequencing.

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: .. Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz). ..

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: Mutations were introduced by site-directed mutagenesis (QuikChange II Site-Directed Mutagenesis Kit; Agilent Technologies) with primers (listed in ) containing the mutations and verified by Sanger sequencing. .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel).

    IA:

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz). .. Cave-in-Rock, field grown in Monroe County, IA, obtained from the National Renewable Energy Laboratory (NREL), ground using a Wiley mill (Thomas Scientific), and sieved using 40/80 mesh; and poplars from 4-year-old Poplar trichocarpa variants GW-9947 and GW-9762, grown in Clatskanie, OR, milled using a 20-mesh screen on a Wiley mill (Thomas Scientific), and obtained as such from Gerald A. Tuskan (Oak Ridge National Laboratory).

    Rapid Amplification of cDNA Ends:

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: Paragraph title: Rapid amplification of cDNA ends (RACE) experiments ... The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced.

    Plasmid Preparation:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: .. Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. Additionally, Athe_1870 (GenBank accession number ), Calhy_0908 (GenBank accession number ), Calkr_0826 (GenBank accession number ), NA10_0869 (GenBank accession number ), and Calkro_0844 (GenBank accession number ) genes were E. coli codon optimized (without transmembrane domains or signal peptides) with the Integrated DNA Technologies (IDT) Codon Optimization Tool and synthesized by the DOE JGI on a pET-45 plasmid.

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research). .. The minimum regions of PPTR-1 (75-543) and PPTR-2 (10-558) for interaction with UNC-89, as determined by yeast two-hybrid analysis, were expressed as His-tagged proteins in Escherichia coli . cDNAs encoding these two proteins were PCR-amplified using primers shown in Supplemental Table S3 from yeast two-hybrid clones, and their sequences were confirmed to be error-free.

    Article Title: miR-23b/SP1/c-myc forms a feed-forward loop supporting multiple myeloma cell growth
    Article Snippet: .. The pGL3/miR-23b promoter plasmid was purified using ZR Plasmid Miniprep Classic (Zymo Research) and analyzed by automated sequencing in ABI PRISM 310 with the BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) to confirm that the sequence matched the original genomic sequences without PCR-generated errors. .. Quantitative DNA methylation analysis Primers for quantitative DNA methylation experiments were designed by using EpiDesigner, a specialized tool for Sequenom'sEpiTYPER technology.

    Article Title: Evolutionarily conserved odorant receptor function questions ecological context of octenol role in mosquitoes
    Article Snippet: .. Plasmids were purified using the The ZR Plasmid Miniprep™-Classic (Zymo Research, Irvine, CA, USA) and sequenced by Macrogen Europe (Amsterdam, the Netherland). ..

    Article Title: A quasi-integral controller for adaptation of genetic modules to variable ribosome demand
    Article Snippet: .. Plasmid DNA was prepared by the plasmid miniprep-classic kit (Zymo Research, D4015). .. DNA sequencing used Quintarabio DNA basic sequencing service.

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: .. Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Article Title: Tuning the Sensitivity of the PDR5 Promoter-Based Detection of Diclofenac in Yeast Biosensors
    Article Snippet: .. Plasmid DNA was purified with ZR Plasmid MiniprepTM —Classic (Zymo Research Corp., Irvine, CA, USA). .. The nucleotide sequence of the cloned fragments was verified by sequencing.

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: .. Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz). ..

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA). .. Animals, exposure and sampling All necessary permits were obtained from the Norwegian Animal Research Authority for the described study, which complied with all relevant regulations.

    Article Title: Synergies between RNA degradation and trans-translation in Streptococcus pneumoniae: cross regulation and co-transcription of RNase R and SmpB
    Article Snippet: .. The plasmids with inserts of interest were purified (ZR plasmid miniprep–classic: Zymo Research) and sequenced. ..

    Article Title: Mutations in the netrin-1 gene cause congenital mirror movements
    Article Snippet: .. Clones were then selected and purified (ZR Plasmid Miniprep Classic from Zymo Research and NucleoBondXtra Midi/Maxi from Macherey-Nagel). .. We ensured that no other mutation was introduced by sequencing the entire cDNA of NTN1 .

    Article Title: Markerless Gene Editing in the Hyperthermophilic Archaeon Thermococcus kodakarensis
    Article Snippet: .. Nucleospin Gel and PCR Clean-up Kit (MACHERY-NAGEL, catalog number: 740609) ZR Plasmid Miniprep kit (Zymo Research, catalog number: D4015) T4 DNA polymerase (New England Biolabs, catalog number: M0203) dGTP (Thermo Fisher Scientific, Invitrogen™, catalog number: 10297018) Swa I restriction enzyme (New England Biolabs, catalog number: R0604) dCTP (Thermo Fisher Scientific, Invitrogen™, catalog number: 10297018) NEBuffer 2.1 (New England Biolabs, catalog number: B7202S) Taq DNA polymerase (New England Biolabs, catalog number: M0267) dNTPs (Thermo Fisher Scientific, Invitrogen™, catalog number: 10297018) 700Forward primer (5’ CGCCGCAATAGCGGTCGTCGTCATGTTCCC 3’) 700Reverse primer (5’ AACAATTTCACACAGGAAACAGCTATGACC 3’) Plasmid Miniprep kit Quikchange II (Agilent Technologies, catalog number: 200523) Dpn I Gelzan (Sigma-Aldrich, catalog number: G1910) Phusion DNA polymerase (New England Biolabs, catalog number: M0530) 6-Methylpurine (Sigma-Aldrich, catalog number: M1256) Note: This product has been discontinued. .. Polysulfides Phenol (AMRESCO, catalog number: 0945) Chloroform (Sigma-Aldrich, catalog number: C2432) Isoamyl alcohol (EMD Millipore, catalog number: 1009791000) Tryptone (EMD Millipore, catalog number: 1072131000) Note: T. kodakarensis requires casein peptone that is enzymatically digested using pancreatic enzymes.

    Software:

    Article Title: Fitness Analyses of All Possible Point-Mutants for Regions of Genes in Yeast
    Article Snippet: .. SYBR Green I (10000×; Invitrogen, cat. no. S-7563) Tris Base (Fisher Bioreagents, cat. no. BP152-500) Acetic acid, glacial (Fisher Scientific, cat. no. A38-500) Bromophenol Blue (Sigma-Aldrich, cat. no. B0126) Ethylenediaminetetraacetic acid (EDTA; Sigma-Aldrich, cat. no. E6758) DNA ladder – 1 KB (New England Biolabs, cat. no. N3232) DNA ladder – 100 BP(New England Biolabs, cat. no. N3231) Zymoclean Gel DNA Recovery Kit (Zymoresearch, cat. no. D4001) ZR Plasmid Miniprep Kit (Zymoresearch, cat. no. D4015) OmniMax competent E. coli strain (Invitrogen, cat. no. C854003) Kanamycin-A monosulfate (or bacterial antibiotic matching vector marker)(Sigma-Aldrich, cat. no. K4000) Ampicillin sodium salt (Sigma-Aldrich, cat. no. A9518-100G) G418 disulfate salt (Sigma-Aldrich, cat. no. A1720) Polyethylene Glycol 3350 (PEG 3350; Hampton Research cat. no. HR2-591) Lithium acetate dihydrate (Sigma-Aldrich, cat. no. L4158) Salmon Sperm DNA (Sigma-Aldrich, cat. no. D1626) Yeast nitrogenous base without Amino Acids (VWR, cat. no. 61000-200) Ammonium Sulfate (Sigma-Aldrich, cat. no. A5132) Sodium Chloride (Fisher Bioreagents, cat. no. 5271-3) Zymolyase (Zymoresearch, cat. No E1004) Bacto- Tryptone (Becton Dickison, cat. no. 211705) Bacto- Peptone (Becton Dickison, cat. no. 211677) Bacto- Yeast Extract (Becton Dickison, cat. no. 212750) Bacto- Agar (Becton Dickison, cat. no. 214010) Adenine Hemisulfate (Sigma-Aldrich, cat. no. A9126-100g) L-Aspartic acid (Sigma-Aldrich, cat. no. A8949) L-Arginine (Sigma-Aldrich, cat. no. A5006) L-Valine (Sigma-Aldrich, cat. no. V0513) L-Glutamic Acid (Sigma-Aldrich, cat. no. G1251) L-Serine (Sigma-Aldrich, cat. no. S4311) L-Threonine (Sigma-Aldrich, cat. no. T8625) L-Isoleucine (Sigma-Aldrich, cat. no. I2752) L-Phenylalanine (Sigma-Aldrich, cat. no. P2126) L-Tyrosine (Sigma-Aldrich, cat. no. T8566) L-Histidine (Sigma-Aldrich, cat. no. H8000) L-Methionine (Sigma-Aldrich, cat. no. M5308) L-Leucine (Sigma-Aldrich, cat. no. L8000) L-Lysine (Sigma-Aldrich, cat. no. L5501) Oligonucleotides (IDT DNA Technologies) see for oligonucleotides used to study a 10 amino acid sequence of Hsp90 (DNA sequence: 5’ GCTAGTGAAACTTTTGAATTTCAAGCTGAA 3’) in pRNDM Custom bio-informatics software (available from ). .. Incubator set to 37°C (Fisher Scientific, Model 655D) 1.7 mL microcentrifuge tubes (Sorenson Biosciences, cat. no. 16070) Microcentrifuge (Beckman Coulter, Microfuge 18) UV trans-illuminator (UVP, Model M-15) Razor blades (VWR, cat. no. 55411-050) Heatblock set to 42 °C (VWR, cat. no. 13259-030) Shaking incubator (Infors HT, Multitron Standard) Spectrophotometer capable of measuring absorbance at 600 nm. (Cary, 50 UV) Thermocycler for PCR (Applied Biosystems, cat. no. 2720) −80 °C freezer for storage of yeast pellets (Sanyo, cat. no. MDF-U76VC) Heat block set at 50 °C (VWR, cat. no. 13259-030) Autoclave (Brinkmann, cat. no. 023210100) 100×15 mm Petri dishes (VWR, cat. no. 25384-088) 125ml flasks (Corning, cat. no. 29136-048) BD Falcon 14ml culture tubes (BD Falcon cat. no.352057) Tabletop centrifuge capable of spinning 14ml culture tubes at 3000 g (Sorvall, Legend RT) Electrophoresis power supply (Fisher Scientific, cat. no. FB300Q) Agaraose gel system (Hoefer, cat. no. HE33) Nanodrop spectrometer (Thermo Scientific, Nanodrop2000)

    Positron Emission Tomography:

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. Additionally, Athe_1870 (GenBank accession number ), Calhy_0908 (GenBank accession number ), Calkr_0826 (GenBank accession number ), NA10_0869 (GenBank accession number ), and Calkro_0844 (GenBank accession number ) genes were E. coli codon optimized (without transmembrane domains or signal peptides) with the Integrated DNA Technologies (IDT) Codon Optimization Tool and synthesized by the DOE JGI on a pET-45 plasmid.

    Two Hybrid Screening:

    Article Title: Protein phosphatase 2A is crucial for sarcomere organization in Caenorhabditis elegans striated muscle
    Article Snippet: Yeast two-hybrid screening of a C. elegans cDNA library was performed as previously described ( ). .. Purification of plasmids from bacterial cells was done using ZR Plasmid Miniprep-Classic (Zymo Research).

    Produced:

    Article Title: Comparative Biochemical and Structural Analysis of Novel Cellulose Binding Proteins (Tāpirins) from Extremely Thermophilic Caldicellulosiruptor Species
    Article Snippet: Genes of interest were PCR amplified from extracted genomic DNA, as described previously , and Gibson assembly ( ) (Gibson assembly master mix; New England BioLabs) or a KLD (kinase, ligase, DpnI) reaction (KLD Enzyme Mix, New England BioLabs) was used to insert the fragments into plasmids that had been extracted with ZymoPure midiprep and Zymo Research plasmid miniprep classic kits (Zymo Research). .. All proteins produced included an N-terminal hexahistidine affinity tag.

    Concentration Assay:

    Article Title: Production of Putative Diterpene Carboxylic Acid Intermediates of Triptolide in Yeast
    Article Snippet: Cloned constructs were transformed into Mix and Go® X10 Gold Escherichia coli competent cells (Zymo Research Europe GmbH, Feiburg im Breisgau, Germany) following standard protocol and plasmids were recovered using a ZR Plasmid Miniprep™—Classic (Zymo Research Europe GmbH) following included protocol. .. Purity and concentration were controlled by NanoDrop2000 (Thermofisher Scientific) and all constructs were sequence verified.

    Staining:

    Article Title: Modulation of Membrane Lipid Composition and Homeostasis in Salmon Hepatocytes Exposed to Hypoxia and Perfluorooctane Sulfonamide, Given Singly or in Combination
    Article Snippet: GelRed Nucleic Acid Gel Stain was purchased from Biothium (Hayward, CA, USA). .. The ZR Plasmid Miniprep-Classic was purchased from Zymo Research (Orange, CA, USA).

    Variant Assay:

    Article Title: Functional Analysis of the Glucan Degradation Locus in Caldicellulosiruptor bescii Reveals Essential Roles of Component Glycoside Hydrolases in Plant Biomass Deconstruction
    Article Snippet: Plasmids were isolated using Zymo Research plasmid miniprep classic and ZymoPURE midiprep kits (Zymo Research); sequences were confirmed by Sanger sequencing (Genewiz). .. The growth conditions for the natural variant poplars were described previously ( , ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Zymo Research pcr clean up kit
    Pcr Clean Up Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 90/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr clean up kit/product/Zymo Research
    Average 90 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    pcr clean up kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results