Structured Review

Promega xmai
Xmai, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xmai/product/Promega
Average 92 stars, based on 13 article reviews
Price from $9.99 to $1999.99
xmai - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: v-Myb Mediates Cooperation of a Cell-Specific Enhancer with the mim-1 Promoter
Article Snippet: .. First, the mim-1 promoter region (−240 to +150 bp) was cloned as a XmaI/BglII fragment between the XmaI and BglII sites of pGL3-Basic (Promega). .. The resulting plasmid (pGL3-240-Luc) was then used to insert the mim-1 enhancer fragment upstream of the promoter in both orientations, resulting in plasmids pGL3-mim3mim-Luc (1 to 795) and pGL3-mim4mim-Luc (795 to 1).

Article Title: Epigenetic Control of the foxp3 Locus in Regulatory T Cells
Article Snippet: .. The amplified 1,160-bp element was cloned via Asp718 and XmaI into the pGL3 promoter vector (Promega, Madison, Wisconsin, United States) in front of the minimal SV40 promoter to generate pGL3-Foxp3-CE. .. Luciferase assay.

Article Title: Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements
Article Snippet: .. Plasmids Reporter plasmids to test the effect of candidate sequences on nearby GBSs (‘Negative Regulatory Sequences (NRS) reporters’) were constructed by first inserting the GBS sequence of interest (see Supplementary Table S1) by ligating oligonucleotides with overhangs to facilitate direct cloning into the XmaI and BglII sites of pGL3 promoter (Promega). .. Subsequently, oligonucleotides encoding the candidate or control sequence with overhangs to facilitate direct cloning (see Supplementary Table S1) were ligated into the Asp718 and NotI sites.

Amplification:

Article Title: A chimeric prokaryotic-eukaryotic pentameric ligand gated ion channel reveals interactions between the extracellular and transmembrane domains shape neurosteroid modulation
Article Snippet: .. GABAρ TMD cDNA was PCR amplified between Arg 258 and the C-terminus of the human GABAρ1 subunit using primers with overhanging ends containing XmaI and MluI restriction sites at the 5’ and 3’end, respectively. pUNIV GLIC vector and the amplified GABAρ TMD were digested with the XmaI and MluI enzymes and then ligated overnight using T4 DNA Ligase (Promega). .. After transformation into E.coli, positive colonies containing GLIC-ρ were identified by colony PCR.

Article Title: Epigenetic Control of the foxp3 Locus in Regulatory T Cells
Article Snippet: .. The amplified 1,160-bp element was cloned via Asp718 and XmaI into the pGL3 promoter vector (Promega, Madison, Wisconsin, United States) in front of the minimal SV40 promoter to generate pGL3-Foxp3-CE. .. Luciferase assay.

In Vitro:

Article Title: Multi-protein bridging factor 1(Mbf1), Rps3 and Asc1 prevent stalled ribosomes from frameshifting
Article Snippet: .. The plasmid template for in vitro transcription of GFP and RFP fragments (pEJYW407 and pEJYW409) was constructed by PCR-amplifying pEAW315 with oligos OJYW295/OJYW296 (for GFP) or OJYW297/OJYW299 (for RFP) followed by digestion with SphI and XmaI and integration into these two sites on pSP73 (Promega, cat.# P2221). .. Plasmids expressing tRNAs were obtained from Phizicky and Grayhack lab stocks ( ; ; ).

Polymerase Chain Reaction:

Article Title: Rot and SaeRS Cooperate To Activate Expression of the Staphylococcal Superantigen-Like Exoproteins
Article Snippet: .. The PCR amplicons were digested with XmaI and PstI and assembled into pGEMT-T (Promega). .. To generate the plasmid containing the saeQRS :: spec construct, a spectinomycin resistance cassette ( aad9 ) was amplified from plasmid pBT-S using primers VJT391 and VJT392 and subsequently digested with XmaI and subcloned into the pGEM-T saeQRS plasmid (an internal XmaI site was previously generated between both flanking sequences to facilitate the insertion of antibiotic resistance markers).

Article Title: Multi-protein bridging factor 1(Mbf1), Rps3 and Asc1 prevent stalled ribosomes from frameshifting
Article Snippet: .. The plasmid template for in vitro transcription of GFP and RFP fragments (pEJYW407 and pEJYW409) was constructed by PCR-amplifying pEAW315 with oligos OJYW295/OJYW296 (for GFP) or OJYW297/OJYW299 (for RFP) followed by digestion with SphI and XmaI and integration into these two sites on pSP73 (Promega, cat.# P2221). .. Plasmids expressing tRNAs were obtained from Phizicky and Grayhack lab stocks ( ; ; ).

Article Title: A chimeric prokaryotic-eukaryotic pentameric ligand gated ion channel reveals interactions between the extracellular and transmembrane domains shape neurosteroid modulation
Article Snippet: .. GABAρ TMD cDNA was PCR amplified between Arg 258 and the C-terminus of the human GABAρ1 subunit using primers with overhanging ends containing XmaI and MluI restriction sites at the 5’ and 3’end, respectively. pUNIV GLIC vector and the amplified GABAρ TMD were digested with the XmaI and MluI enzymes and then ligated overnight using T4 DNA Ligase (Promega). .. After transformation into E.coli, positive colonies containing GLIC-ρ were identified by colony PCR.

Construct:

Article Title: Multi-protein bridging factor 1(Mbf1), Rps3 and Asc1 prevent stalled ribosomes from frameshifting
Article Snippet: .. The plasmid template for in vitro transcription of GFP and RFP fragments (pEJYW407 and pEJYW409) was constructed by PCR-amplifying pEAW315 with oligos OJYW295/OJYW296 (for GFP) or OJYW297/OJYW299 (for RFP) followed by digestion with SphI and XmaI and integration into these two sites on pSP73 (Promega, cat.# P2221). .. Plasmids expressing tRNAs were obtained from Phizicky and Grayhack lab stocks ( ; ; ).

Article Title: Tissue-specific Expression of the L1 Cell Adhesion Molecule Is Modulated by the Neural Restrictive Silencer Element
Article Snippet: .. L1-7 through L1-12, L1lacZ, and L1lacZΔN were prepared using the vector CMVβ (CLONTECH Laboratories, Inc.), after replacing the human cytomegalovirus promoter with a polylinker containing the XmaI and XhoI sites, which allowed the insertion of the L1 genomic fragments. lacZ constructs were converted into luciferase reporters by removing the lacZ gene by digestion with NotI and replacing it with a modified luciferase gene cassette from pGEMluc ( Promega Corp. ) containing an SV-40 polyadenylation signal. .. A promoterless version of this vector, called lucpA, was also prepared to provide a negative control for the luciferase constructs L1-7 through L1-12.

Article Title: Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements
Article Snippet: .. Plasmids Reporter plasmids to test the effect of candidate sequences on nearby GBSs (‘Negative Regulatory Sequences (NRS) reporters’) were constructed by first inserting the GBS sequence of interest (see Supplementary Table S1) by ligating oligonucleotides with overhangs to facilitate direct cloning into the XmaI and BglII sites of pGL3 promoter (Promega). .. Subsequently, oligonucleotides encoding the candidate or control sequence with overhangs to facilitate direct cloning (see Supplementary Table S1) were ligated into the Asp718 and NotI sites.

Modification:

Article Title: Tissue-specific Expression of the L1 Cell Adhesion Molecule Is Modulated by the Neural Restrictive Silencer Element
Article Snippet: .. L1-7 through L1-12, L1lacZ, and L1lacZΔN were prepared using the vector CMVβ (CLONTECH Laboratories, Inc.), after replacing the human cytomegalovirus promoter with a polylinker containing the XmaI and XhoI sites, which allowed the insertion of the L1 genomic fragments. lacZ constructs were converted into luciferase reporters by removing the lacZ gene by digestion with NotI and replacing it with a modified luciferase gene cassette from pGEMluc ( Promega Corp. ) containing an SV-40 polyadenylation signal. .. A promoterless version of this vector, called lucpA, was also prepared to provide a negative control for the luciferase constructs L1-7 through L1-12.

Luciferase:

Article Title: Tissue-specific Expression of the L1 Cell Adhesion Molecule Is Modulated by the Neural Restrictive Silencer Element
Article Snippet: .. L1-7 through L1-12, L1lacZ, and L1lacZΔN were prepared using the vector CMVβ (CLONTECH Laboratories, Inc.), after replacing the human cytomegalovirus promoter with a polylinker containing the XmaI and XhoI sites, which allowed the insertion of the L1 genomic fragments. lacZ constructs were converted into luciferase reporters by removing the lacZ gene by digestion with NotI and replacing it with a modified luciferase gene cassette from pGEMluc ( Promega Corp. ) containing an SV-40 polyadenylation signal. .. A promoterless version of this vector, called lucpA, was also prepared to provide a negative control for the luciferase constructs L1-7 through L1-12.

Sequencing:

Article Title: Identification and characterization of DNA sequences that prevent glucocorticoid receptor binding to nearby response elements
Article Snippet: .. Plasmids Reporter plasmids to test the effect of candidate sequences on nearby GBSs (‘Negative Regulatory Sequences (NRS) reporters’) were constructed by first inserting the GBS sequence of interest (see Supplementary Table S1) by ligating oligonucleotides with overhangs to facilitate direct cloning into the XmaI and BglII sites of pGL3 promoter (Promega). .. Subsequently, oligonucleotides encoding the candidate or control sequence with overhangs to facilitate direct cloning (see Supplementary Table S1) were ligated into the Asp718 and NotI sites.

Plasmid Preparation:

Article Title: Multi-protein bridging factor 1(Mbf1), Rps3 and Asc1 prevent stalled ribosomes from frameshifting
Article Snippet: .. The plasmid template for in vitro transcription of GFP and RFP fragments (pEJYW407 and pEJYW409) was constructed by PCR-amplifying pEAW315 with oligos OJYW295/OJYW296 (for GFP) or OJYW297/OJYW299 (for RFP) followed by digestion with SphI and XmaI and integration into these two sites on pSP73 (Promega, cat.# P2221). .. Plasmids expressing tRNAs were obtained from Phizicky and Grayhack lab stocks ( ; ; ).

Article Title: A chimeric prokaryotic-eukaryotic pentameric ligand gated ion channel reveals interactions between the extracellular and transmembrane domains shape neurosteroid modulation
Article Snippet: .. GABAρ TMD cDNA was PCR amplified between Arg 258 and the C-terminus of the human GABAρ1 subunit using primers with overhanging ends containing XmaI and MluI restriction sites at the 5’ and 3’end, respectively. pUNIV GLIC vector and the amplified GABAρ TMD were digested with the XmaI and MluI enzymes and then ligated overnight using T4 DNA Ligase (Promega). .. After transformation into E.coli, positive colonies containing GLIC-ρ were identified by colony PCR.

Article Title: Tissue-specific Expression of the L1 Cell Adhesion Molecule Is Modulated by the Neural Restrictive Silencer Element
Article Snippet: .. L1-7 through L1-12, L1lacZ, and L1lacZΔN were prepared using the vector CMVβ (CLONTECH Laboratories, Inc.), after replacing the human cytomegalovirus promoter with a polylinker containing the XmaI and XhoI sites, which allowed the insertion of the L1 genomic fragments. lacZ constructs were converted into luciferase reporters by removing the lacZ gene by digestion with NotI and replacing it with a modified luciferase gene cassette from pGEMluc ( Promega Corp. ) containing an SV-40 polyadenylation signal. .. A promoterless version of this vector, called lucpA, was also prepared to provide a negative control for the luciferase constructs L1-7 through L1-12.

Article Title: Epigenetic Control of the foxp3 Locus in Regulatory T Cells
Article Snippet: .. The amplified 1,160-bp element was cloned via Asp718 and XmaI into the pGL3 promoter vector (Promega, Madison, Wisconsin, United States) in front of the minimal SV40 promoter to generate pGL3-Foxp3-CE. .. Luciferase assay.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Promega xmai restriction sequences
    Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for <t>XhoI,</t> SnaBI (located within the leader peptide region [LP]), <t>XmaI</t> (located in
    Xmai Restriction Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xmai restriction sequences/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xmai restriction sequences - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    92
    Promega xmai
    Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for <t>XhoI,</t> SnaBI (located within the leader peptide region [LP]), <t>XmaI</t> (located in
    Xmai, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xmai/product/Promega
    Average 92 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    xmai - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results


    Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for XhoI, SnaBI (located within the leader peptide region [LP]), XmaI (located in

    Journal: Journal of Virology

    Article Title: Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma ▿

    doi: 10.1128/JVI.01743-08

    Figure Lengend Snippet: Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for XhoI, SnaBI (located within the leader peptide region [LP]), XmaI (located in

    Article Snippet: Additionally, a subclone containing a 1.3-kb N-terminal env fragment incorporating the XhoI, SnaBI, and XmaI restriction sequences was created in the pGEM-T Easy cloning vector according to the manufacturer's protocol (Promega, Madison, WI) and is designated pGEM HIV-2KR.X4 (forward primer, GGGACTCGGGATATGTTATGAACGG; reverse primer, CCTTATATGGCACGGTGCATAATTGC).

    Techniques: Modification