Structured Review

Promega xmai restriction sequences
Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for <t>XhoI,</t> SnaBI (located within the leader peptide region [LP]), <t>XmaI</t> (located in
Xmai Restriction Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xmai restriction sequences/product/Promega
Average 85 stars, based on 1 article reviews
Price from $9.99 to $1999.99
xmai restriction sequences - by Bioz Stars, 2020-08
85/100 stars

Images

1) Product Images from "Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma ▿"

Article Title: Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma ▿

Journal: Journal of Virology

doi: 10.1128/JVI.01743-08

Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for XhoI, SnaBI (located within the leader peptide region [LP]), XmaI (located in
Figure Legend Snippet: Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for XhoI, SnaBI (located within the leader peptide region [LP]), XmaI (located in

Techniques Used: Modification

Related Articles

Clone Assay:

Article Title: Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma ▿
Article Snippet: .. Additionally, a subclone containing a 1.3-kb N-terminal env fragment incorporating the XhoI, SnaBI, and XmaI restriction sequences was created in the pGEM-T Easy cloning vector according to the manufacturer's protocol (Promega, Madison, WI) and is designated pGEM HIV-2KR.X4 (forward primer, GGGACTCGGGATATGTTATGAACGG; reverse primer, CCTTATATGGCACGGTGCATAATTGC). .. Molt 4/8 cells chronically infected with a chimeric virus containing an HIV-2KR genome and an HIV-1MN V3 loop substitution (pHIV-2KR-MNV3 ) were obtained as a gift from D. Looney and cultured in RPMI 1640 medium (Gibco/Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT) and 1% l -glutamine and penicillin-streptomycin (PS; Gibco/Invitrogen, Carlsbad, CA) at 37°C with 5% CO2 .

Plasmid Preparation:

Article Title: Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma ▿
Article Snippet: .. Additionally, a subclone containing a 1.3-kb N-terminal env fragment incorporating the XhoI, SnaBI, and XmaI restriction sequences was created in the pGEM-T Easy cloning vector according to the manufacturer's protocol (Promega, Madison, WI) and is designated pGEM HIV-2KR.X4 (forward primer, GGGACTCGGGATATGTTATGAACGG; reverse primer, CCTTATATGGCACGGTGCATAATTGC). .. Molt 4/8 cells chronically infected with a chimeric virus containing an HIV-2KR genome and an HIV-1MN V3 loop substitution (pHIV-2KR-MNV3 ) were obtained as a gift from D. Looney and cultured in RPMI 1640 medium (Gibco/Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS; HyClone, Logan, UT) and 1% l -glutamine and penicillin-streptomycin (PS; Gibco/Invitrogen, Carlsbad, CA) at 37°C with 5% CO2 .

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Promega xmai restriction sequences
    Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for <t>XhoI,</t> SnaBI (located within the leader peptide region [LP]), <t>XmaI</t> (located in
    Xmai Restriction Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xmai restriction sequences/product/Promega
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xmai restriction sequences - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results


    Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for XhoI, SnaBI (located within the leader peptide region [LP]), XmaI (located in

    Journal: Journal of Virology

    Article Title: Human Immunodeficiency Virus Type 2 (HIV-2)/HIV-1 Envelope Chimeras Detect High Titers of Broadly Reactive HIV-1 V3-Specific Antibodies in Human Plasma ▿

    doi: 10.1128/JVI.01743-08

    Figure Lengend Snippet: Construction of HIV-2 KR.X7 Env scaffold and HIV-2/HIV-1 V3 chimeras. (A) The parental pHIV-2 KR.P1 env backbone was modified to include unique silent restriction sequences for XhoI, SnaBI (located within the leader peptide region [LP]), XmaI (located in

    Article Snippet: Additionally, a subclone containing a 1.3-kb N-terminal env fragment incorporating the XhoI, SnaBI, and XmaI restriction sequences was created in the pGEM-T Easy cloning vector according to the manufacturer's protocol (Promega, Madison, WI) and is designated pGEM HIV-2KR.X4 (forward primer, GGGACTCGGGATATGTTATGAACGG; reverse primer, CCTTATATGGCACGGTGCATAATTGC).

    Techniques: Modification