Structured Review

Thermo Fisher xhoi
Xhoi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 434 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xhoi/product/Thermo Fisher
Average 99 stars, based on 434 article reviews
Price from $9.99 to $1999.99
xhoi - by Bioz Stars, 2020-04
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Paragraph title: Cloning and expression of EqCXCL16S, EqCXCL16R, and EqCXCR6 in E . coli ... Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: .. PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Overlapping extension PCR based site directed mutagenesis (Ho et al., 1989) was done to mutate the conserved GDD motif to GAD and GAA, (located at amino acid residues 681 to 683) cloned into pBluebacHis2A and confirmed by sequencing of the positive clones.

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: .. For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. Clones of the expression host E. coli BL21(DE3) containing pWZ427 were cultured to optical density at 600 nm (OD600 ) around 0.6 to 0.8 and then induced by 0.5 mM isopropyl β- d -1-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The 3’-UTR sequences of human LATS1 and MOB1B containing the seed target sequence of miR-135b-5p were amplified by PCR and were cloned into the pmiR-RB-REPORT™ (Guangzhou RiboBio Co., Ltd.) dual luciferase plasmid. .. The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: The resulting plasmid pSARS-S was used as the source of S cDNA for subsequent cloning into mammalian expression vectors. .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

Centrifugation:

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. After induction, the cells were collected by centrifugation, boiled in SDS sample buffer, and subjected to SDS-PAGE and Western blot analysis.

Amplification:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: .. Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Purified fragments encoding aa 17–247 and aa 25–199 of EqCXCL16 and entire EqCXCR6 were ligated into pET15b (Novagen, Temecula, CA, USA) followed by transformation into E . coli NovaBlue (Novagen).

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: Paragraph title: Selective rolling circle amplification (sRCA) and transformation of the N–0, H–0 and C–0 signal sequence libraries ... The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: .. PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Overlapping extension PCR based site directed mutagenesis (Ho et al., 1989) was done to mutate the conserved GDD motif to GAD and GAA, (located at amino acid residues 681 to 683) cloned into pBluebacHis2A and confirmed by sequencing of the positive clones.

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: .. For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. Clones of the expression host E. coli BL21(DE3) containing pWZ427 were cultured to optical density at 600 nm (OD600 ) around 0.6 to 0.8 and then induced by 0.5 mM isopropyl β- d -1-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The mouse cathepsin B and L cDNAs were amplified from a mouse liver cDNA library (BD Clontech) using the following primers: cathepsin B (CGGAATTCACCATGTGGTGG TCCTTGATCCT and CCGCTCGAGTTAGAATCTTCCCCAGTACT), and cathepsin L (ACGCCAATTGACCATGAATCTTTTACTCTTTT and CCGCTCGAGTCAATTCACGACAGGATAGC). .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: After incubating pCMV SPORT-βgal (1 ng) for 2 min at 94 °C to separate the DNA strands, the template DNA was subjected to 30 rounds of amplification consisting of 30 sec at 94 °C (denaturation step), 30 sec at 61 °C (annealing step) and 3¼ min at 68 °C (extension step). .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The 3’-UTR sequences of human LATS1 and MOB1B containing the seed target sequence of miR-135b-5p were amplified by PCR and were cloned into the pmiR-RB-REPORT™ (Guangzhou RiboBio Co., Ltd.) dual luciferase plasmid. .. The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: The DNA sequence coding for the S protein was amplified by PCR with the PWO polymerase (Roche) using pSARS-S plasmid as a template and oligonucleotides 5′-ATAGGATCCA CCATGTTTAT TTTCTTATTA TTTCTTACTC TCACT-3′ and 5′-ATACTCGAGT TATGTG-TAAT GTAATTTGAC ACCCTTG-3′ containing BamHI and XhoI restrictions sites. .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

DNA Ligation:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Ligation and transformation were performed using Rapid DNA Ligation and TransformAid kits (Thermo Scientific), respectively.

Nucleic Acid Electrophoresis:

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA). .. The integrity of in vitro transcribed RNA was monitored by running RNA gel electrophoresis under denaturing conditions in 2.2M formaldehyde using the MOPS buffer system ( ).

Construct:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: A3H mutants (Y112A/Y113A, W115A, R175E/R176E) were made using the WT construct as a template. .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck).

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The rNEIL3∆291 expression construct was prepared by PCR amplifying the NEIL3 glycosylase domain from a X. laevis cDNA library (a gift from T.G.W. .. The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: In the resulting constructs, the cap genes were fused in-frame with a Gal4 DNA-binding domain. .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The construct pcDNA3.1-nls.lacZ(+) ( ) was generated by insertion of the 3.2-kb nls.βgal-coding KpnI fragment of plasmid pMX1-nls.lacZ(+) (unpublished data) into the KpnI site of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: Paragraph title: Luciferase reporter constructs and assay ... The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Nested PCR:

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: Briefly, after reverse transcription of the RNA, overlapping S cDNA fragments were produced by nested PCR and the cDNA fragment representing the complete S gene sequence (nt 21406-25348) was assembled from clones harboring the consensus protein sequence as deduced by direct sequencing of the amplicons from specimen #031589 (Nal et al., 2005) . .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

Incubation:

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific). .. Reactions were incubated at 37 °C for 2 h, purified with PCR purification kit and eluted into 30 µl.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The construct pcDNA3.1-nls.lacZ(+) ( ) was generated by insertion of the 3.2-kb nls.βgal-coding KpnI fragment of plasmid pMX1-nls.lacZ(+) (unpublished data) into the KpnI site of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Luciferase:

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: Paragraph title: Luciferase reporter constructs and assay ... The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Infection:

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Culture medium was collected 72 h post infection and after infecting fresh Sf 9 cells with this culture supernatant, recombinant baculovirus were isolated by plaque purification.

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific). .. Baculoviruses expressing rNEIL3 were then prepared using the Bac-to-Bac system (Thermo Fisher Scientific) according to the manufacturer’s protocols. rNEIL3 protein was expressed in 250 ml suspension cultures of Sf9 insect cells (Expression Systems) by infection with baculovirus expressing NEIL3-FLAG for 48 to 72 hr.

Expressing:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Paragraph title: Cloning and expression of EqCXCL16S, EqCXCL16R, and EqCXCR6 in E . coli ... Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: Paragraph title: Expression and purification of wild and mutant AmCPV RdRp in insect cells ... PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2.

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: .. For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. Clones of the expression host E. coli BL21(DE3) containing pWZ427 were cultured to optical density at 600 nm (OD600 ) around 0.6 to 0.8 and then induced by 0.5 mM isopropyl β- d -1-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The rNEIL3∆291 expression construct was prepared by PCR amplifying the NEIL3 glycosylase domain from a X. laevis cDNA library (a gift from T.G.W. .. The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. In addition to the lacZ expression unit, pcDNA3.1-nls.lacZ(+) contains a SV40 promoter-driven recombinant aphA1 gene that can be used to select stably transduced mammalian cells with the aid of the antibiotic G418 (also known as geneticin).

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: Paragraph title: S gene expression plasmids ... After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

Modification:

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: BHK21 [C-13], Vero E6, and SW-13 cells (ATCC) were grown in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies) supplemented with 5 % fetal bovine serum (FBS). .. Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA).

Western Blot:

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. After induction, the cells were collected by centrifugation, boiled in SDS sample buffer, and subjected to SDS-PAGE and Western blot analysis.

Transformation Assay:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Purified fragments encoding aa 17–247 and aa 25–199 of EqCXCL16 and entire EqCXCR6 were ligated into pET15b (Novagen, Temecula, CA, USA) followed by transformation into E . coli NovaBlue (Novagen).

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: Paragraph title: Selective rolling circle amplification (sRCA) and transformation of the N–0, H–0 and C–0 signal sequence libraries ... The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific).

Chloramphenicol Acetyltransferase Assay:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Derivative Assay:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Countercurrent Chromatography:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Electroporation:

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA). .. Full-length RNA transcripts YFV17D (wild type), rYFV DTM, and rYFV STM were transfected into BHK21 or Vero E6 cells via electroporation (BioRad Gene Pulser Xcell Electroporation Systems, Hercules CA).

Transfection:

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: Paragraph title: 2.2. Cell culture, in vitro transcription, transfection and viral stocks ... Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA).

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The plasmid pcDNA3.1-nls.lacZ(-), which served as a negative control in the transfection experiment is identical to pcDNA3.1-nls.lacZ(+), except that the nls.βgal-coding KpnI fragment was inserted in the negative orientation with respect to the hCMV-IE promoter.

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The XhoI and NotI (Invitrogen) restriction sites were underlined above. .. A non-target control vector was used as a transfection control.

Subrenal Capsule Assay:

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: .. The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific). .. Reactions were incubated at 37 °C for 2 h, purified with PCR purification kit and eluted into 30 µl.

Stable Transfection:

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. In addition to the lacZ expression unit, pcDNA3.1-nls.lacZ(+) contains a SV40 promoter-driven recombinant aphA1 gene that can be used to select stably transduced mammalian cells with the aid of the antibiotic G418 (also known as geneticin).

Ligation:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Ligation and transformation were performed using Rapid DNA Ligation and TransformAid kits (Thermo Scientific), respectively.

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The PCR products were digested with BamHI and EcoRI for AAV2, or BglII and EcoRI for AAV5 and AAV8, before ligation into the BamHI-/EcoRI-linearized plasmid pGBK-T7 (BD Clontech, Palo Alto, CA). .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Protease Inhibitor:

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific). .. Sf9 cells were collected and suspended in 10 ml NEIL3 Lysis Buffer (50 mM Tris-HCl [pH 7.5], 300 mM NaCl, 10% glycerol, 1× Roche EDTA-free cOmplete protease inhibitor cocktail, 0.5 mM PMSF, and 0.2% Triton X-100).

Cell Culture:

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. Clones of the expression host E. coli BL21(DE3) containing pWZ427 were cultured to optical density at 600 nm (OD600 ) around 0.6 to 0.8 and then induced by 0.5 mM isopropyl β- d -1-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: Paragraph title: 2.2. Cell culture, in vitro transcription, transfection and viral stocks ... Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA).

Generated:

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: .. Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA). .. RNA was purified using phenol/chloroform/isoamyl alcohol extraction and precipitated by ethanol.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The construct pcDNA3.1-nls.lacZ(+) ( ) was generated by insertion of the 3.2-kb nls.βgal-coding KpnI fragment of plasmid pMX1-nls.lacZ(+) (unpublished data) into the KpnI site of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Sequencing:

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: Paragraph title: Selective rolling circle amplification (sRCA) and transformation of the N–0, H–0 and C–0 signal sequence libraries ... The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Overlapping extension PCR based site directed mutagenesis (Ho et al., 1989) was done to mutate the conserved GDD motif to GAD and GAA, (located at amino acid residues 681 to 683) cloned into pBluebacHis2A and confirmed by sequencing of the positive clones.

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific). .. All mutations and truncations were confirmed by Sanger sequencing.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Materials and Methods Molecular cloning procedures To generate the plasmid pcDNA3.1-cyt.lacZ , the cyt.βgal-coding sequence of pCMV SPORT-βgal (Invitrogen) was amplified by polymerase chain reaction (PCR) using primers cyt.βgal.F #720 (5’ CTA GGATCC GTCACC ATG TCGTTTACTTTGACC 3’; lacZ initiation codon shown in boldface) and cyt.βgal.R #721 (5’ GAA CTCGAG TTA TTTTTGACACCAGACCAACTGG 3’; complement of lacZ termination codon shown in boldface) containing extragenic BamHI and XhoI recognition sites (underlined), respectively. .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The 3’-UTR sequences of human LATS1 and MOB1B containing the seed target sequence of miR-135b-5p were amplified by PCR and were cloned into the pmiR-RB-REPORT™ (Guangzhou RiboBio Co., Ltd.) dual luciferase plasmid. .. The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: The DNA sequence coding for the S protein was amplified by PCR with the PWO polymerase (Roche) using pSARS-S plasmid as a template and oligonucleotides 5′-ATAGGATCCA CCATGTTTAT TTTCTTATTA TTTCTTACTC TCACT-3′ and 5′-ATACTCGAGT TATGTG-TAAT GTAATTTGAC ACCCTTG-3′ containing BamHI and XhoI restrictions sites. .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

Recombinant:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: In order to produce recombinant plasmids encoding the full size of S and R versions of CXCL16, synthetic sequences flanked by PstI and XhoI were also produced. .. Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. The resultant recombinant baculovirus transfer vectors (4 µg) and BsuI digested linearized Autographaea californica nuclear polyhedrosis viral DNA (0.5 µg) were cotransfected into Sf 9 (10 6 ) cells using insectin plus according to the manufacturer's protocol (Invitrogen).

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: Paragraph title: Purification of Recombinant Xenopus NEIL3 ... The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. In addition to the lacZ expression unit, pcDNA3.1-nls.lacZ(+) contains a SV40 promoter-driven recombinant aphA1 gene that can be used to select stably transduced mammalian cells with the aid of the antibiotic G418 (also known as geneticin).

Molecular Cloning:

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Materials and Methods Molecular cloning procedures To generate the plasmid pcDNA3.1-cyt.lacZ , the cyt.βgal-coding sequence of pCMV SPORT-βgal (Invitrogen) was amplified by polymerase chain reaction (PCR) using primers cyt.βgal.F #720 (5’ CTA GGATCC GTCACC ATG TCGTTTACTTTGACC 3’; lacZ initiation codon shown in boldface) and cyt.βgal.R #721 (5’ GAA CTCGAG TTA TTTTTGACACCAGACCAACTGG 3’; complement of lacZ termination codon shown in boldface) containing extragenic BamHI and XhoI recognition sites (underlined), respectively. .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

IA:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Synthetic sequences encoding the predicted exposed part of EqCXCL16 (aa 25–199) [ ] and the entire EqCXCR6 were produced by IDT (Coralville, IA, USA). .. Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA).

Mutagenesis:

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: Paragraph title: Expression and purification of wild and mutant AmCPV RdRp in insect cells ... PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2.

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: Paragraph title: Cloning and site-directed mutagenesis ... Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck).

Article Title: Gateway cloning is compatible with protein secretion from Pichia pastoris.
Article Snippet: Methods The P. pastoris secretion vector pPICZ (Invitrogen) was converted into a Gateway destination vector by cutting with XhoI, Wlling in the ends with Klenow polymerase, and ligating in the Gateway reading frame B cassette (Invitrogen). .. Methods An internal XhoI site in the Hy3 gene was removed by site-directed mutagenesis (QuickChange, Strategene).

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The XhoI and NotI (Invitrogen) restriction sites were underlined above. .. The mutation of these sequences from AAGCCAU to AAGCGUA and from AAAAGCCAUA to AAAAGCGUAA was performed using the Quick Change Site-Directed Mutagenesis kit (Agilent Technologies, Edinburgh, UK).

Isolation:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Recombinant plasmids p15-16A (aa 17–247), p15-16B (aa 25–199), and p15-R6 were isolated from ampicillin-resistant clones using ZR Plasmid Miniprep™ Kit (Zymo Research).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Culture medium was collected 72 h post infection and after infecting fresh Sf 9 cells with this culture supernatant, recombinant baculovirus were isolated by plaque purification.

Size-exclusion Chromatography:

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: After incubating pCMV SPORT-βgal (1 ng) for 2 min at 94 °C to separate the DNA strands, the template DNA was subjected to 30 rounds of amplification consisting of 30 sec at 94 °C (denaturation step), 30 sec at 61 °C (annealing step) and 3¼ min at 68 °C (extension step). .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Labeling:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Purification:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Purified fragments encoding aa 17–247 and aa 25–199 of EqCXCL16 and entire EqCXCR6 were ligated into pET15b (Novagen, Temecula, CA, USA) followed by transformation into E . coli NovaBlue (Novagen).

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific). .. Reactions were incubated at 37 °C for 2 h, purified with PCR purification kit and eluted into 30 µl.

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: Paragraph title: Expression and purification of wild and mutant AmCPV RdRp in insect cells ... PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2.

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: Paragraph title: Purification of Recombinant Xenopus NEIL3 ... The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA). .. RNA was purified using phenol/chloroform/isoamyl alcohol extraction and precipitated by ethanol.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: The resulting 3.2-kilobase (kb) PCR fragment was purified with the aid of SureClean (Bioline) to remove dNTPs, primers and thermostable DNA polymerase molecules. .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Polymerase Chain Reaction:

Article Title: Improvement of Fab expression by screening combinatorial synonymous signal sequence libraries
Article Snippet: The sRCA products were digested into linear single-plasmid segments with XhoI in 100 µl reactions containing 50 µl of DNA (sRCA reaction), 1× Buffer R (Thermo Scientific) and 100 U XhoI (Thermo Scientific). .. Reactions were incubated at 37 °C for 2 h, purified with PCR purification kit and eluted into 30 µl.

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: .. PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Overlapping extension PCR based site directed mutagenesis (Ho et al., 1989) was done to mutate the conserved GDD motif to GAD and GAA, (located at amino acid residues 681 to 683) cloned into pBluebacHis2A and confirmed by sequencing of the positive clones.

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: .. For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. Clones of the expression host E. coli BL21(DE3) containing pWZ427 were cultured to optical density at 600 nm (OD600 ) around 0.6 to 0.8 and then induced by 0.5 mM isopropyl β- d -1-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The rNEIL3∆291 expression construct was prepared by PCR amplifying the NEIL3 glycosylase domain from a X. laevis cDNA library (a gift from T.G.W. .. The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

Article Title: Gateway cloning is compatible with protein secretion from Pichia pastoris.
Article Snippet: Methods The P. pastoris secretion vector pPICZ (Invitrogen) was converted into a Gateway destination vector by cutting with XhoI, Wlling in the ends with Klenow polymerase, and ligating in the Gateway reading frame B cassette (Invitrogen). .. The product of this mutagenesis was used as the template for PCR ampliWcation.

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The construct pcDNA3.1-nls.lacZ(+) ( ) was generated by insertion of the 3.2-kb nls.βgal-coding KpnI fragment of plasmid pMX1-nls.lacZ(+) (unpublished data) into the KpnI site of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The 3’-UTR sequences of human LATS1 and MOB1B containing the seed target sequence of miR-135b-5p were amplified by PCR and were cloned into the pmiR-RB-REPORT™ (Guangzhou RiboBio Co., Ltd.) dual luciferase plasmid. .. The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: The DNA sequence coding for the S protein was amplified by PCR with the PWO polymerase (Roche) using pSARS-S plasmid as a template and oligonucleotides 5′-ATAGGATCCA CCATGTTTAT TTTCTTATTA TTTCTTACTC TCACT-3′ and 5′-ATACTCGAGT TATGTG-TAAT GTAATTTGAC ACCCTTG-3′ containing BamHI and XhoI restrictions sites. .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

Lysis:

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific). .. Sf9 cells were collected and suspended in 10 ml NEIL3 Lysis Buffer (50 mM Tris-HCl [pH 7.5], 300 mM NaCl, 10% glycerol, 1× Roche EDTA-free cOmplete protease inhibitor cocktail, 0.5 mM PMSF, and 0.2% Triton X-100).

cDNA Library Assay:

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The rNEIL3∆291 expression construct was prepared by PCR amplifying the NEIL3 glycosylase domain from a X. laevis cDNA library (a gift from T.G.W. .. The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The mouse cathepsin B and L cDNAs were amplified from a mouse liver cDNA library (BD Clontech) using the following primers: cathepsin B (CGGAATTCACCATGTGGTGG TCCTTGATCCT and CCGCTCGAGTTAGAATCTTCCCCAGTACT), and cathepsin L (ACGCCAATTGACCATGAATCTTTTACTCTTTT and CCGCTCGAGTCAATTCACGACAGGATAGC). .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI.

Two Hybrid Screening:

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Activated Clotting Time Assay:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

SDS Page:

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. After induction, the cells were collected by centrifugation, boiled in SDS sample buffer, and subjected to SDS-PAGE and Western blot analysis.

Plasmid Preparation:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA). .. Recombinant plasmids p15-16A (aa 17–247), p15-16B (aa 25–199), and p15-R6 were isolated from ampicillin-resistant clones using ZR Plasmid Miniprep™ Kit (Zymo Research).

Article Title: Molecular characterization of genome segment 2 encoding RNA dependent RNA polymerase of Antheraea mylitta cytoplasmic polyhedrosis virus.
Article Snippet: .. PCR amplified product was digested with XhoI and PstI, and cloned into pBluebacHis2A baculovirus transfer vector (Invitrogen) downstream of the baculovirus polyhedrin promoter to generate pBluebacHis2A/AmCPV S2. .. Overlapping extension PCR based site directed mutagenesis (Ho et al., 1989) was done to mutate the conserved GDD motif to GAD and GAA, (located at amino acid residues 681 to 683) cloned into pBluebacHis2A and confirmed by sequencing of the positive clones.

Article Title: Blocking HIV-1 Infection by Chromosomal Integrative Expression of Human CD4 on the Surface of Lactobacillus acidophilus ATCC 4356
Article Snippet: .. For fusion expression of GFP-CD4 in E. coli , the fusion DNA fragments were amplified by overlapping PCR with primer pairs 118 + 120 and 119 + 057 , then digested with SacI and XhoI, and cloned into the expression vector pET28a (Invitrogen), resulting in pWZ427. .. Clones of the expression host E. coli BL21(DE3) containing pWZ427 were cultured to optical density at 600 nm (OD600 ) around 0.6 to 0.8 and then induced by 0.5 mM isopropyl β- d -1-thiogalactopyranoside (IPTG) for 3 h at 37°C.

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Article Title: Gateway cloning is compatible with protein secretion from Pichia pastoris.
Article Snippet: .. Methods The P. pastoris secretion vector pPICZ (Invitrogen) was converted into a Gateway destination vector by cutting with XhoI, Wlling in the ends with Klenow polymerase, and ligating in the Gateway reading frame B cassette (Invitrogen). .. The new destination vector was named pDest-910.

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: .. The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. MATERIALS AND METHODS Yeast two-hybrid screen.

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Materials and Methods Molecular cloning procedures To generate the plasmid pcDNA3.1-cyt.lacZ , the cyt.βgal-coding sequence of pCMV SPORT-βgal (Invitrogen) was amplified by polymerase chain reaction (PCR) using primers cyt.βgal.F #720 (5’ CTA GGATCC GTCACC ATG TCGTTTACTTTGACC 3’; lacZ initiation codon shown in boldface) and cyt.βgal.R #721 (5’ GAA CTCGAG TTA TTTTTGACACCAGACCAACTGG 3’; complement of lacZ termination codon shown in boldface) containing extragenic BamHI and XhoI recognition sites (underlined), respectively. .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Article Title: miR-135b-5p regulates human mesenchymal stem cell osteogenic differentiation by facilitating the Hippo signaling pathway
Article Snippet: The 3’-UTR sequences of human LATS1 and MOB1B containing the seed target sequence of miR-135b-5p were amplified by PCR and were cloned into the pmiR-RB-REPORT™ (Guangzhou RiboBio Co., Ltd.) dual luciferase plasmid. .. The XhoI and NotI (Invitrogen) restriction sites were underlined above.

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S. .. S gene expression plasmids Plasmids containing the constitutive transport element of Mazon-Pfizer Monkey Virus (CTE) (Ernst et al., 1997b) or the post-regulatory element of the Woodchuck Hepatitis Virus (WPRE) (Donello et al., 1998) were kindly provided by Y. Jacob and P. Charneau respectively (Institut Pasteur, Paris, France).

Negative Control:

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The plasmid pcDNA3.1-nls.lacZ(-), which served as a negative control in the transfection experiment is identical to pcDNA3.1-nls.lacZ(+), except that the nls.βgal-coding KpnI fragment was inserted in the negative orientation with respect to the hCMV-IE promoter.

Agarose Gel Electrophoresis:

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The construct pcDNA3.1-nls.lacZ(+) ( ) was generated by insertion of the 3.2-kb nls.βgal-coding KpnI fragment of plasmid pMX1-nls.lacZ(+) (unpublished data) into the KpnI site of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

In Vitro:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Article Title: Development of a Recombinant Yellow Fever Vector Expressing a HIV Clade C Founder Envelope gp120
Article Snippet: Paragraph title: 2.2. Cell culture, in vitro transcription, transfection and viral stocks ... Full-length pACNR-FLYF-17Dx (WT), pFLYF17Dx_CH505_DTM, and pFLYF17Dx_CH505_STM vectors were linearized by XhoI and capped transcripts were generated using SP6 RNA polymerase (Life Technologies, Cat # AM2071, Carlsbad, CA).

Produced:

Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion
Article Snippet: In order to produce recombinant plasmids encoding the full size of S and R versions of CXCL16, synthetic sequences flanked by PstI and XhoI were also produced. .. Following digestion with BamHI and XhoI or PstI and XhoI (Thermo Scientific, Rockford, IL, USA), fragments of amplicon and synthetic DNA were separated in E-Gel EX 1% agarose (Life Technologies) and extracted from gel using Zymoclean Gel Recovery Kit (Zymo Research, Irvine, CA, USA).

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Article Title: Heterologous viral RNA export elements improve expression of severe acute respiratory syndrome (SARS) coronavirus spike protein and protective efficacy of DNA vaccines against SARS.
Article Snippet: Briefly, after reverse transcription of the RNA, overlapping S cDNA fragments were produced by nested PCR and the cDNA fragment representing the complete S gene sequence (nt 21406-25348) was assembled from clones harboring the consensus protein sequence as deduced by direct sequencing of the amplicons from specimen #031589 (Nal et al., 2005) . .. After digestion with BamHI and XhoI, the resulting DNA fragment was inserted at the corresponding sites of the pcDNA3.1(+) vector (Invitrogen), yielding plasmid pcDNA-S. Next, the S insert was subcloned between the NheI and XhoI sites of the pCI plasmid (Promega) , yielding plasmid pCI-S.

Concentration Assay:

Article Title: A two-hybrid screen identifies cathepsins B and L as uncoating factors for adeno-associated virus 2 and 8.
Article Snippet: The cathepsin B and L PCR products were digested with EcoRI and XhoI, or MfeI and XhoI, respectively, and then cloned into the pcDNA3 (Invitrogen, Carlsbad, CA) vector digested with EcoRI and XhoI. .. Clones were selected for growth on SD media (0.67% yeast nitrogen base without amino acids, 2% glucose, and supplemented with the appropriate amino acids at a concentration of 0.004%), lacking Shown are the proteins recovered in our screen for which we subsequently confirmed the ability to bind to AAV2 and AAV8 particles.

BAC Assay:

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific). .. Baculoviruses expressing rNEIL3 were then prepared using the Bac-to-Bac system (Thermo Fisher Scientific) according to the manufacturer’s protocols. rNEIL3 protein was expressed in 250 ml suspension cultures of Sf9 insect cells (Expression Systems) by infection with baculovirus expressing NEIL3-FLAG for 48 to 72 hr.

FLAG-tag:

Article Title: TRAIP is a master regulator of DNA interstrand cross-link repair
Article Snippet: Briefly, constructs for expression of rNEIL3NZF-C to A , rNEIL3TL310-311LV , rNEIL3K500E , rNEIL3K546E , rNEIL3K500E K546E , and rNEIL3∆92 were prepared by digesting Integrated DNA Technologies gene blocks encompassing the C-terminal domain of NEIL3 (with FLAG epitope tag) and containing the indicated mutations with BbvCI and XhoI and then ligating the fragments into similarly digested pFastBac1-NEIL3-FLAG . .. The fragment was then digested with EcoRI and XhoI and ligated into similarly digested pFastBac1 (Thermo Fisher Scientific).

CTG Assay:

Article Title: RNA-mediated dimerization of the human deoxycytidine deaminase APOBEC3H influences enzyme activity and interaction with nucleic acids
Article Snippet: .. Specifically, A3H Y112A/Y113A was made using the forward primer 5′ATC TTC GCC TCC CGC CTG GCC GCT CAC TGG TGC AAG CCC CAG and the reverse primer 5′ CTG GGG CTT GCA CCA GTG AGC GGC CAG GCG GGA GGC GAA GAT, A3H W115A was made using the forward primer 5′ GCC TCC CGC CTG TAC TAC CAC GCT TGC AAG CCC CAG CAG and the reverse primer 5′ CTG CTG GGG CTT GCA AGC GTG GTA GTA CAG GCG GGA GGC, and R175E/R176E was made using the forward primer 5′ CAG TCG AGC CAT AAA GGA AGA GCT TGA CAG GAT AAA G and the reverse primer 5′ CTT TAT CCT GTC AAG CTC TTC CTT TAT GGC TCG ACT G. For producing RNA in vitro , the 91 nt Alu sequence derived from 7SL RNA [ ] was cloned into pSP72 vector (Promega) using XhoI and HindIII sites and the RNA was produced by SP6 RNA polymerase-directed in vitro transcription (Ambion) with a fluorescein RNA labeling NTP mix containing Fluorescein-12-UTP (Merck). ..

Gel Extraction:

Article Title: Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants
Article Snippet: .. Next, the PCR fragment was incubated with the restriction enzymes (REs) BamHI and XhoI (Fermentas), the 3.2-kb digestion product was extracted from agarose gel using JETSORB Gel Extraction Kit (GENOMED) and inserted downstream of the human cytomegalovirus immediate early gene (hCMV-IE) promoter, between the unique BamHI and XhoI of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020). .. The construct pcDNA3.1-nls.lacZ(+) ( ) was generated by insertion of the 3.2-kb nls.βgal-coding KpnI fragment of plasmid pMX1-nls.lacZ(+) (unpublished data) into the KpnI site of pcDNA3.1(+)/myc-His C (Invitrogen, catalog No.V80020).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher xhoi
    <t>pJ915-rhChymase</t> vector map The P. pastoris ] using 5’ <t>XhoI</t> and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.
    Xhoi, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 434 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi/product/Thermo Fisher
    Average 99 stars, based on 434 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher xhoi restriction enzymes
    (A) Digestion on extracted plasmid of one of positive clones with NheI and <t>XhoI</t> confirmed HBsAg fragment insertion in <t>pcDNA</t> vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.
    Xhoi Restriction Enzymes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi restriction enzymes/product/Thermo Fisher
    Average 99 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    xhoi restriction enzymes - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    pJ915-rhChymase vector map The P. pastoris ] using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

    Journal: Protein expression and purification

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris

    doi: 10.1016/j.pep.2014.08.005

    Figure Lengend Snippet: pJ915-rhChymase vector map The P. pastoris ] using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest).

    Techniques: Plasmid Preparation, Expressing, Marker, Electroporation

    CBX3 subfragments and lentiviral vectors. ( A ) Schematic representation of the CBX3 element with its CpG-sites (black bars) and deleted splice sites (red bars) as well as the CBX3 subfragments obtained by PCR (CBX3(1-339) - CBX3(340-508)) and the CBX3(503-679) subfragment generated by restriction digestion with XhoI and ApaI. ( B ) Third-generation self-inactivating (SIN) lentiviral constructs expressing an eGFP cDNA from the spleen focus forming virus (SFFV) promoter in the absence or presence of either the 1.5 kb A2UCOE, the 679 bp CBX3 or any of the CBX3 subfragments. Abbreviations: ΔLTR: Long terminal repeat harboring the SIN mutation in the U3 region of the LTR; ψ: extended encapsidation signal; RRE: Rev-response element; cPPT: central polypurine tract; GFP: (enhanced) green fluorescent protein; wPRE: woodchuck hepatitis virus post-transcriptional element.

    Journal: Scientific Reports

    Article Title: The CpG-sites of the CBX3 ubiquitous chromatin opening element are critical structural determinants for the anti-silencing function

    doi: 10.1038/s41598-017-04212-8

    Figure Lengend Snippet: CBX3 subfragments and lentiviral vectors. ( A ) Schematic representation of the CBX3 element with its CpG-sites (black bars) and deleted splice sites (red bars) as well as the CBX3 subfragments obtained by PCR (CBX3(1-339) - CBX3(340-508)) and the CBX3(503-679) subfragment generated by restriction digestion with XhoI and ApaI. ( B ) Third-generation self-inactivating (SIN) lentiviral constructs expressing an eGFP cDNA from the spleen focus forming virus (SFFV) promoter in the absence or presence of either the 1.5 kb A2UCOE, the 679 bp CBX3 or any of the CBX3 subfragments. Abbreviations: ΔLTR: Long terminal repeat harboring the SIN mutation in the U3 region of the LTR; ψ: extended encapsidation signal; RRE: Rev-response element; cPPT: central polypurine tract; GFP: (enhanced) green fluorescent protein; wPRE: woodchuck hepatitis virus post-transcriptional element.

    Article Snippet: The CBX3(503-679) subfragment was generated by digesting the CBX3.SFFV.eGFP with XhoI and ApaI, filling the ends by using Klenow fragment (ThermoFisher Scientific) and subsequently self-ligating the vector to generate the construct CBX3(503-679).SFFV.eGFP.

    Techniques: Polymerase Chain Reaction, Generated, Construct, Expressing, Mutagenesis

    (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Journal: Research in Pharmaceutical Sciences

    Article Title: Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression

    doi: 10.4103/1735-5362.192485

    Figure Lengend Snippet: (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Article Snippet: The extracted plasmid of one of the resulted clones and pcDNA 3.1 Hygro (+) plasmid (Invitrogen, USA) were digested by NheI and XhoI restriction enzymes (Thermoscience, USA) separately.

    Techniques: Plasmid Preparation, Clone Assay, Recombinant

    mtDNA replication is reduced in 16-cell cysts of homoplasmic mt:CoI T300I germaria at 29°C. ( a ) Mutated nucleotide and amino acid residue (red) in mt:CoI T300I , including XhoI site (yellow). ( b ) Eclosion rate (mean±s.d., from total > 50 animals in 5 groups) of wt, homoplasmic and heteroplasmic mt:CoI T300I animals at 18°C and 29°C. * indicates zero mt:CoI T300I eclosed at 29°C. ( c ) COX activities of wt and mt:CoI T300I flies were examined on consecutive days shifting to 29°C. Data represent 3 biological replicates. Values were normalized with average COX activities of wt at 29°C 0 day and shown as mean±s.d. ( d ) Quantification of EdU puncta (mean±s.d.) in posterior cyst of region 2B at 18°C (wt n= 7, mt:CoI T300I n= 7) or 29°C (wt n= 5, mt:CoI T300I n= 8). The number of EdU puncta in mt:CoI T300I at 29°C is significantly less than that at 18°C or wild type at 29°C ( P

    Journal: Nature genetics

    Article Title: Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant

    doi: 10.1038/ng.2920

    Figure Lengend Snippet: mtDNA replication is reduced in 16-cell cysts of homoplasmic mt:CoI T300I germaria at 29°C. ( a ) Mutated nucleotide and amino acid residue (red) in mt:CoI T300I , including XhoI site (yellow). ( b ) Eclosion rate (mean±s.d., from total > 50 animals in 5 groups) of wt, homoplasmic and heteroplasmic mt:CoI T300I animals at 18°C and 29°C. * indicates zero mt:CoI T300I eclosed at 29°C. ( c ) COX activities of wt and mt:CoI T300I flies were examined on consecutive days shifting to 29°C. Data represent 3 biological replicates. Values were normalized with average COX activities of wt at 29°C 0 day and shown as mean±s.d. ( d ) Quantification of EdU puncta (mean±s.d.) in posterior cyst of region 2B at 18°C (wt n= 7, mt:CoI T300I n= 7) or 29°C (wt n= 5, mt:CoI T300I n= 8). The number of EdU puncta in mt:CoI T300I at 29°C is significantly less than that at 18°C or wild type at 29°C ( P

    Article Snippet: Molecular confirmation and quantification of heteroplasmy A 4 kb mtDNA fragment spanning the XhoI site in mt:CoI was PCR amplified from total animal DNA as described previously , and purified using the Thermo Scientific gel purification kit.

    Techniques:

    Germline selection against mt:CoI T300I at the restrictive temperature. ( a ) Frequency of mt:CoI T300I mutation in heteroplasmic flies maintained at 29°C or 18°C over generations. ( b ) XhoI digestion of PCR fragment spanning mt:CoI , amplified from single larvae produced by the same heteroplasmic mother at 18°C or 29°C. ( c ) Proportion of mutant mtDNA in 10 single larvae at 18°C or 29°C, calculated by quantifying band intensity in b . Average level of mutant mtDNA, 18°C, 83±5%; 29°C, 60±9%, n=10, P

    Journal: Nature genetics

    Article Title: Selective propagation of functional mtDNA during oogenesis restricts the transmission of a deleterious mitochondrial variant

    doi: 10.1038/ng.2920

    Figure Lengend Snippet: Germline selection against mt:CoI T300I at the restrictive temperature. ( a ) Frequency of mt:CoI T300I mutation in heteroplasmic flies maintained at 29°C or 18°C over generations. ( b ) XhoI digestion of PCR fragment spanning mt:CoI , amplified from single larvae produced by the same heteroplasmic mother at 18°C or 29°C. ( c ) Proportion of mutant mtDNA in 10 single larvae at 18°C or 29°C, calculated by quantifying band intensity in b . Average level of mutant mtDNA, 18°C, 83±5%; 29°C, 60±9%, n=10, P

    Article Snippet: Molecular confirmation and quantification of heteroplasmy A 4 kb mtDNA fragment spanning the XhoI site in mt:CoI was PCR amplified from total animal DNA as described previously , and purified using the Thermo Scientific gel purification kit.

    Techniques: Selection, Mutagenesis, Polymerase Chain Reaction, Amplification, Produced