xhoi  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    Name:
    XhoI
    Description:
    5'  C ↓T  C  G  A  G   3' 3'  G  A  G  C  T ↑C   5' Thermo Scientific XhoI restriction enzyme recognizes C^TCGAG sites and cuts best at 37°C in R buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes. Note: Also available as a FastDigest enzyme for rapid DNA digestion. Isoschizomers: PaeR7I, Sfr274I, SlaI, StrI, TliI.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: For methylation sensitivity, refer to product specifications.
    Catalog Number:
    ER0691
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Size:
    2 000 units
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher xhoi
    One-Step Cloning and Heterologous Expression of the Conglobatin Gene Cluster (A) A 41-kbp <t>XhoI-EcoRI</t> DNA fragment (black) containing the five genes congA–E is generated by XhoI and EcoRI digestion of total genomic DNA. A 5.3-kbp pSET152 fragment was obtained by PCR amplification using as template the pSET152-derived plasmid pIB139. The resulting linear vector fragment had 39- and 41-bp flanking regions, respectively, identical to the termini of the target DNA (see Experimental Procedures ). (B) Gibson assembly leads to specific cloning of the target fragment, to give the bifunctional E. coli - Streptomyces plasmid pYJ24. The deduced open reading frame functions in the fragment are given in Table S1 . (C) Heterologous expression in S. coelicolor M1154 is confirmed by HPLC-MS and comparison with authentic compound produced by S. <t>conglobatus</t> (see also Figure S1 ). The mass extraction of m / z 499–500 is used to display the data. The y axis scale of S. conglobatus is 20 times larger than that of pYJ24/M1154 or M1154.
    5'  C ↓T  C  G  A  G   3' 3'  G  A  G  C  T ↑C   5' Thermo Scientific XhoI restriction enzyme recognizes C^TCGAG sites and cuts best at 37°C in R buffer. See Reaction Conditions for Restriction Enzymes for a table of enzyme activity, conditions for double digestion, and heat inactivation for this and other restriction enzymes. Note: Also available as a FastDigest enzyme for rapid DNA digestion. Isoschizomers: PaeR7I, Sfr274I, SlaI, StrI, TliI.Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes, optimized to work in one of the buffers of the Five Buffer System. In addition, the universal Tango buffer is provided for convenience in double digestions. All of the enzymes exhibit 100% activity in the recommended buffer and reaction conditions. To ensure consistent performance, Thermo Scientific restriction enzyme reaction buffers contain premixed BSA, which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations.Features• Superior quality—stringent quality control and industry leading manufacturing process• Convenient color-coded Five Buffer System• Includes universal Tango buffer for double-digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism (RFLP)• SNPNote: For methylation sensitivity, refer to product specifications.
    https://www.bioz.com/result/xhoi/product/Thermo Fisher
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2020-01
    75/100 stars

    Images

    1) Product Images from "Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin"

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin

    Journal: Chemistry & Biology

    doi: 10.1016/j.chembiol.2015.05.010

    One-Step Cloning and Heterologous Expression of the Conglobatin Gene Cluster (A) A 41-kbp XhoI-EcoRI DNA fragment (black) containing the five genes congA–E is generated by XhoI and EcoRI digestion of total genomic DNA. A 5.3-kbp pSET152 fragment was obtained by PCR amplification using as template the pSET152-derived plasmid pIB139. The resulting linear vector fragment had 39- and 41-bp flanking regions, respectively, identical to the termini of the target DNA (see Experimental Procedures ). (B) Gibson assembly leads to specific cloning of the target fragment, to give the bifunctional E. coli - Streptomyces plasmid pYJ24. The deduced open reading frame functions in the fragment are given in Table S1 . (C) Heterologous expression in S. coelicolor M1154 is confirmed by HPLC-MS and comparison with authentic compound produced by S. conglobatus (see also Figure S1 ). The mass extraction of m / z 499–500 is used to display the data. The y axis scale of S. conglobatus is 20 times larger than that of pYJ24/M1154 or M1154.
    Figure Legend Snippet: One-Step Cloning and Heterologous Expression of the Conglobatin Gene Cluster (A) A 41-kbp XhoI-EcoRI DNA fragment (black) containing the five genes congA–E is generated by XhoI and EcoRI digestion of total genomic DNA. A 5.3-kbp pSET152 fragment was obtained by PCR amplification using as template the pSET152-derived plasmid pIB139. The resulting linear vector fragment had 39- and 41-bp flanking regions, respectively, identical to the termini of the target DNA (see Experimental Procedures ). (B) Gibson assembly leads to specific cloning of the target fragment, to give the bifunctional E. coli - Streptomyces plasmid pYJ24. The deduced open reading frame functions in the fragment are given in Table S1 . (C) Heterologous expression in S. coelicolor M1154 is confirmed by HPLC-MS and comparison with authentic compound produced by S. conglobatus (see also Figure S1 ). The mass extraction of m / z 499–500 is used to display the data. The y axis scale of S. conglobatus is 20 times larger than that of pYJ24/M1154 or M1154.

    Techniques Used: Clone Assay, Expressing, Generated, Polymerase Chain Reaction, Amplification, Derivative Assay, Plasmid Preparation, High Performance Liquid Chromatography, Mass Spectrometry, Produced

    2) Product Images from "Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris"

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris

    Journal:

    doi: 10.1016/j.pep.2014.08.005

    pJ915-rhChymase vector map The P. pastoris expression plasmid pJ915-rhChymase (4035 bp) encodes a fusion protein that consists of rhChymase linked to yeast α-Mating Factor (a secretion signal peptide) by a kexin cleavage site. The cDNA for rhChymase with the kexin cleavage site was transferred from a previously reported plasmid, pPICzα-rhChymase using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.
    Figure Legend Snippet: pJ915-rhChymase vector map The P. pastoris expression plasmid pJ915-rhChymase (4035 bp) encodes a fusion protein that consists of rhChymase linked to yeast α-Mating Factor (a secretion signal peptide) by a kexin cleavage site. The cDNA for rhChymase with the kexin cleavage site was transferred from a previously reported plasmid, pPICzα-rhChymase using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

    Techniques Used: Plasmid Preparation, Expressing, Marker, Electroporation

    3) Product Images from "Cydia pomonella granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts"

    Article Title: Cydia pomonella granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts

    Journal:

    doi: 10.1128/AEM.01998-08

    DNA restriction profiles for EcoRI, SalI, XhoI, BamHI, and PstI. Lanes M represent the CpGV-M DNA, and lane r4 represents the 2016-r4 DNA. Arrows indicate additional or modified fragments. Lambda-DNA digested with HindIII is included for molecular size
    Figure Legend Snippet: DNA restriction profiles for EcoRI, SalI, XhoI, BamHI, and PstI. Lanes M represent the CpGV-M DNA, and lane r4 represents the 2016-r4 DNA. Arrows indicate additional or modified fragments. Lambda-DNA digested with HindIII is included for molecular size

    Techniques Used: Modification, Lambda DNA Preparation

    4) Product Images from "Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel"

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel

    Journal:

    doi: 10.1128/AAC.49.3.1150-1156.2005

    Southern blot analysis of plasmid DNA from Enterobacter sp. strains 1061 and 1434 and their transconjugants. Plasmid DNA was digested with the SmaI, XhoI, and BamHI endonucleases in lanes 1 to 3, 4 to 6, 7 to 9, and 10 to 12, respectively, and hybridized
    Figure Legend Snippet: Southern blot analysis of plasmid DNA from Enterobacter sp. strains 1061 and 1434 and their transconjugants. Plasmid DNA was digested with the SmaI, XhoI, and BamHI endonucleases in lanes 1 to 3, 4 to 6, 7 to 9, and 10 to 12, respectively, and hybridized

    Techniques Used: Southern Blot, Plasmid Preparation

    5) Product Images from "Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model"

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model

    Journal: International Journal of Nanomedicine

    doi: 10.2147/IJN.S139126

    Analysis of the inserted gene (H5-GFP) by using restriction enzyme digestion and polymerase chain reaction. Notes: M: GeneRulerTM DNA ladder Kit, 1 Kbp (Fermentas, Burlington, Canada); lane 1, 2, 3: single digestion with XhoI; lane 4, 5: double digestion with NotI and XhoI. Single digestion of pBud-H5-GFP with XhoI produced a single fragment of about 7,672 bp, which correlate with the expected size of the recombinant DNA plasmid. Double digestion of the plasmid with NotI and XhoI, resulted in two fragments, 4,546 and 3,126 bp related to pBud CE4.1 and the H5-GFP gene, respectively. Abbreviations: DNA, deoxyribonucleic acid; GFP, green fluorescent protein.
    Figure Legend Snippet: Analysis of the inserted gene (H5-GFP) by using restriction enzyme digestion and polymerase chain reaction. Notes: M: GeneRulerTM DNA ladder Kit, 1 Kbp (Fermentas, Burlington, Canada); lane 1, 2, 3: single digestion with XhoI; lane 4, 5: double digestion with NotI and XhoI. Single digestion of pBud-H5-GFP with XhoI produced a single fragment of about 7,672 bp, which correlate with the expected size of the recombinant DNA plasmid. Double digestion of the plasmid with NotI and XhoI, resulted in two fragments, 4,546 and 3,126 bp related to pBud CE4.1 and the H5-GFP gene, respectively. Abbreviations: DNA, deoxyribonucleic acid; GFP, green fluorescent protein.

    Techniques Used: Polymerase Chain Reaction, Produced, Recombinant, Plasmid Preparation

    6) Product Images from "Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris"

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris

    Journal:

    doi: 10.1016/j.pep.2014.08.005

    pJ915-rhChymase vector map The P. pastoris expression plasmid pJ915-rhChymase (4035 bp) encodes a fusion protein that consists of rhChymase linked to yeast α-Mating Factor (a secretion signal peptide) by a kexin cleavage site. The cDNA for rhChymase with the kexin cleavage site was transferred from a previously reported plasmid, pPICzα-rhChymase using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.
    Figure Legend Snippet: pJ915-rhChymase vector map The P. pastoris expression plasmid pJ915-rhChymase (4035 bp) encodes a fusion protein that consists of rhChymase linked to yeast α-Mating Factor (a secretion signal peptide) by a kexin cleavage site. The cDNA for rhChymase with the kexin cleavage site was transferred from a previously reported plasmid, pPICzα-rhChymase using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

    Techniques Used: Plasmid Preparation, Expressing, Marker, Electroporation

    Related Articles

    Clone Assay:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The H5-GFP genes were first cloned into the pBud expression vector downstream of the elongation factor (EF)-1α promoter to generate pBud-H5-GFP. .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada).

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: Paragraph title: Single-Step Cloning of the Conglobatin Gene Cluster ... S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: Paragraph title: Cloning and Selection ... The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest).

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: Paragraph title: Cloning of 5′ flanking region of ERRβ gene ... Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Decoy Receptor Interactions as Novel Drug Targets against EKC-Causing Human Adenovirus
    Article Snippet: Briefly, for the production of His-tagged FKs, HAdV-C5 and HAdV-D37 FK genes were cloned into a pQE30-Xa expression vector encoding a His-tag (N-terminal) using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. For the production of GST-tagged 37FKs, HAdV-D37 FK gene was cloned into a pGEX-6P expression vector encoding a GST-tag (N-terminal) using restriction sites for NcoI and XhoI (Thermo Scientific, Waltham, MA, USA). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant truncated PVX110940 ... PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ).

    Article Title: Sulfated Glycosaminoglycans as Viral Decoy Receptors for Human Adenovirus Type 37
    Article Snippet: Briefly, the fiber knob genes of HAdV-C5 and HAdV-D37 were cloned into a pQE30-Xa expression vector encoding an N-terminal His-tag using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Article Title: Conserved Pbp1/Ataxin-2 regulates retrotransposon activity and connects polyglutamine expansion-driven protein aggregation to lifespan-controlling rDNA repeats
    Article Snippet: The vector pRS303 was used as a backbone for cloning. .. First, a TAP tag was cloned into the vector using the restriction enzymes PdiI and XhoI (Thermo Fisher Scientific). .. Next, a full length Pbp1 including the native promoter (460 bp upstream of Pbp1 start site) PCR product was generated from W303 genomic DNA using Phusion (NEB) and cloned into the TAP-tagged vector using PdiI and PauI (Thermo Fisher Scientific).

    Article Title: Influenza A viruses escape from MxA restriction at the expense of efficient nuclear vRNP import
    Article Snippet: pHW2000 rescue plasmids were used for site directed mutagenesis. .. The mutated ORF were cloned into pCAGGS expression plasmids using restriction enzymes NotI and XhoI (Fermentas). .. Cells were seeded on glass coverslips.

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: At 48 h after transfection, the cellular lysates were collected to analyze the expression of genes of interest. .. To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. To produce constructs that bear mutations at a putative miR-141-binding site in WT SIRT1 3′UTR, site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: Paragraph title: WDR1 mRNA cloning ... The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: L. lactis B1157 kdcA [AY548760.1] and L. lactis IFPL730 kivD [AJ746364.1] open reading frames were codon optimized (co) for S. cerevisiae using the JCat algorithm [ ], synthesized and cloned into pMA vectors (AmpR ) resulting in pUD342 and pUD350, respectively (GeneArt, Bleiswijk, The Netherlands; Table , Additional file ). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: The PCR product was cloned into pMD18T vector (Takara, Dalian) to construct vector luxS -pMD18T. .. Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid.

    Centrifugation:

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr. .. S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr.

    Amplification:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The H5-GFP gene was amplified from the recombinant plasmid pIRES as a template using a pair of H5 specific primers listed in . .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada).

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr. .. The mixture was incubated at −20°C for 10 min before precipitating the DNA by centrifugation for 10 min. After washing with 80% ethanol, the DNA was dissolved in 20 μl of water, giving a concentration of 67 ng/μl.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Based on Bebipred score, a region of 407 aa corresponding to amino acids 261 and 667 was amplified from genomic DNA of the P. vivax Sal-I strain using the primers: PVX110940-Tr-F: 5′-TAAGAAT GCGGCCGC GAGGATGTGCTGCCAAGTGT-3′ and PVX110940-Tr-R: 5′- TTA CTCGAG TCATTCATCCTCCGCTTCATCCTC-3′. .. PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ). .. After cloning, the construct was analyzed by DNA sequencing.

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: WDR1 transcript was PCR amplified, and restriction sites were added using Phusion high fidelity polymerase (NEB), and the following primers: forward (XhoI) 5′-CGCTCGAGATGCCGTACGAGATCAAG-3′; and reverse (BamHI) 5′-CCGGATCCTCTGAGGTGATTGTCC-3′. .. The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: To construct the overexpression plasmids pUDE321 (TDH3 P -cokdcA -CYC1 t ) and pUDE336 (TDH3 P -cokivD -CYC1 t ), co-kdcA and co-kivD were PCR amplified from pUD342 and pUD350, respectively, with primer pairs “KdcA fwd GPDP homology/KdcA rev CYC1T homology” and “KivD fwd GPDP homology/KivD rev CYC1T homology” (Table ). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: Gene luxS was amplified by PCR using primers 5′-TGCTCTAGAATGGCTAAAGTAGAAAGTTT-3′ (forward) and 5′-CCGCTCGAGCTATTCAACGACTTTGCGAA-3′ (reverse) containing restriction sites XbaI and XhoI. .. Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid.

    Reporter Assay:

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: Paragraph title: Luciferase reporter assay ... To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion.

    Expressing:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The polymerase chain reaction (PCR) product of pIRES-H5-GFP was purified using PCR clean up Kit (Qiagen, Germantown, MD, USA), prior to double digestion with restriction enzymes. .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada). .. Thereafter, the DNA plasmid pBud-IRF3-H5-GFP was constructed by insertion of the IRF3 into pBud downstream of the cytomegalovirus (CMV) promoter in the pBud-H5-GFP to construct the pBud-IRF3-H5-GFP.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest).

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: Transformants were screened for Zeocin™-resistance in low-salt LB agar, as described in the EasySelect™ Pichia Expression Kit manual (Life Technologies). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Article Title: Decoy Receptor Interactions as Novel Drug Targets against EKC-Causing Human Adenovirus
    Article Snippet: Briefly, for the production of His-tagged FKs, HAdV-C5 and HAdV-D37 FK genes were cloned into a pQE30-Xa expression vector encoding a His-tag (N-terminal) using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. For the production of GST-tagged 37FKs, HAdV-D37 FK gene was cloned into a pGEX-6P expression vector encoding a GST-tag (N-terminal) using restriction sites for NcoI and XhoI (Thermo Scientific, Waltham, MA, USA). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant truncated PVX110940 ... PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ).

    Article Title: Sulfated Glycosaminoglycans as Viral Decoy Receptors for Human Adenovirus Type 37
    Article Snippet: Briefly, the fiber knob genes of HAdV-C5 and HAdV-D37 were cloned into a pQE30-Xa expression vector encoding an N-terminal His-tag using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Article Title: Influenza A viruses escape from MxA restriction at the expense of efficient nuclear vRNP import
    Article Snippet: pHW2000 rescue plasmids were used for site directed mutagenesis. .. The mutated ORF were cloned into pCAGGS expression plasmids using restriction enzymes NotI and XhoI (Fermentas). .. Cells were seeded on glass coverslips.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: The primers included a 5′ extension homologous to either the TDH3 promoter or CYC1 terminator regions of p426GPD [ ] to allow for Gibson assembly with the vector backbone [ ]. .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator. .. The expression vectors were assembled using Gibson assembly® Master Mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions.

    Synthesized:

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: L. lactis B1157 kdcA [AY548760.1] and L. lactis IFPL730 kivD [AJ746364.1] open reading frames were codon optimized (co) for S. cerevisiae using the JCat algorithm [ ], synthesized and cloned into pMA vectors (AmpR ) resulting in pUD342 and pUD350, respectively (GeneArt, Bleiswijk, The Netherlands; Table , Additional file ). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Construct:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The expression vector pBudCE4.1 was used to construct recombinant DNA plasmids expressing the H5-GFP and IRF3 genes. .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada).

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: Forward (F) and reverse (R) primers' sequences were designed as follows: for the WT target site F 5′CATCTTTCTACCTCTTTTTTCTATCTGCCAAATTGAGATAAT3′ R 5′CTAGATTATCTCAATTTGGCAGATAGAAAAAAGAGGTAGAAAGATGAGCT3′ and for the MT target site F 5′CATCTTTCTACCTCTTTTTTCTATCATTGAGATAAT3′ R 5′CTAGATTATCTCAATGATAGAAAAAAGAGGTAGAAAGATGAGCT3′. .. To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion. .. Since the XhoI restriction site is located between SacI and XbaI restriction sites, only the empty pmiRGlo vector was digested with XhoI enzyme, while the ligated pmirGLO constructs harboring the WT/MT inserts were not digested, confirming insert ligation.

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: At 48 h after transfection, the cellular lysates were collected to analyze the expression of genes of interest. .. To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. To produce constructs that bear mutations at a putative miR-141-binding site in WT SIRT1 3′UTR, site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: To construct the overexpression plasmids pUDE321 (TDH3 P -cokdcA -CYC1 t ) and pUDE336 (TDH3 P -cokivD -CYC1 t ), co-kdcA and co-kivD were PCR amplified from pUD342 and pUD350, respectively, with primer pairs “KdcA fwd GPDP homology/KdcA rev CYC1T homology” and “KivD fwd GPDP homology/KivD rev CYC1T homology” (Table ). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: The PCR product was cloned into pMD18T vector (Takara, Dalian) to construct vector luxS -pMD18T. .. Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid.

    Electrophoresis:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. P. pastoris expression plasmid pJ915 (DNA 2.0), which provides secretion directed by α-mating factor and the GAP promoter for constitutive expression, was separately treated in the same manner.

    Article Title: Cydia pomonella granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts
    Article Snippet: Resulting pellets were washed with 70% cold ethanol, dried, and resuspended into distilled water. .. Approximately 500 ng of purified virus DNA was digested with EcoRI, BamHI, PstI, SalI, or XhoI (Fermentas) in the supplied buffer at 37°C for 3 h. The DNA restriction fragments were separated by electrophoresis in 1% agarose gels in Tris-acetate-EDTA buffer at 80 V for approximately 4 h. λ-phage DNA/HindIII fragments were used as standards for size determination. .. Fragments were visualized under UV light by ethidium bromide staining.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The pJ915 plasmid and Kex2-hChymase insert were purified separately by electrophoresis with a 1% (w/v) LE agarose gel and subsequent isolated with a gel DNA recovery kit (Zymo Research). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Incubation:

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr. .. S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr.

    Article Title: Cydia pomonella granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts
    Article Snippet: DNA was then precipitated in cold ethanol (70%, vol/vol) in the presence of 0.2 M sodium acetate and incubated overnight at −20°C. .. Approximately 500 ng of purified virus DNA was digested with EcoRI, BamHI, PstI, SalI, or XhoI (Fermentas) in the supplied buffer at 37°C for 3 h. The DNA restriction fragments were separated by electrophoresis in 1% agarose gels in Tris-acetate-EDTA buffer at 80 V for approximately 4 h. λ-phage DNA/HindIII fragments were used as standards for size determination.

    Article Title: Decoy Receptor Interactions as Novel Drug Targets against EKC-Causing Human Adenovirus
    Article Snippet: For the production of GST-tagged 37FKs, HAdV-D37 FK gene was cloned into a pGEX-6P expression vector encoding a GST-tag (N-terminal) using restriction sites for NcoI and XhoI (Thermo Scientific, Waltham, MA, USA). .. For the production of GST-tagged 37FKs, HAdV-D37 FK gene was cloned into a pGEX-6P expression vector encoding a GST-tag (N-terminal) using restriction sites for NcoI and XhoI (Thermo Scientific, Waltham, MA, USA).

    Article Title: Sulfated Glycosaminoglycans as Viral Decoy Receptors for Human Adenovirus Type 37
    Article Snippet: GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific). .. GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific).

    Luciferase:

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3-ERRβ .

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: Paragraph title: Luciferase reporter assay ... To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion.

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: At 48 h after transfection, the cellular lysates were collected to analyze the expression of genes of interest. .. To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. To produce constructs that bear mutations at a putative miR-141-binding site in WT SIRT1 3′UTR, site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3 -ERRβ .

    Activity Assay:

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion. .. After 24 h, cells were either co-transfected with miR-182 mimics using Hiperfect transfection reagent (Qiagen, Germany) or kept untransfected.

    In Silico:

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: The complementary target site for miR-182 on CLDN1 3′UTR, predicted using in silico analysis, was flanked by sticky ended 5′SacI and 3′XbaI restriction sites to form the wild-type (WT) insert, or the binding site was deleted to form the mutant type insert (MT). pmirGLO was double digested using XbaI and SacI (Thermo Scientific; Waltham, MA, USA) restriction enzymes. .. To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion.

    Mass Spectrometry:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest). .. Purified pJ915-rhChymase was linearized with SwaI (Thermo Scientific) prior to electroporation using an ECM 600 electroporation system (BTX Technologies) and the BioGrammatics protocol.

    Transformation Assay:

    Article Title: l-xylo-3-Hexulose Reductase Is the Missing Link in the Oxidoreductive Pathway for
    Article Snippet: A T. reesei Δ tku70 strain was used as the parental strain for transformation ( , ). .. Both fragments were ligated into the vector pBluescript SK(+) (Stratagene) after digestion with XbaI and XhoI (Fermentas) for the promoter fragment and with XhoI and Acc65I (Fermentas) for the terminator fragment using ligation mix III (Takara).

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. The PCR mixture had 0.7 μL of expand long-range enzyme mix (Roche, Mannheim, Germany), 10 μL of 5× expand long-range buffer, 100 ng of plasmid template, 100 nM of primers, 3 μL of dimethyl sulfoxide, and 2.5 μL of dNTPs (10 mM).

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C. .. 50 ng of plasmid was annealed with 60 ng PCR insert (a molar ratio of 1:3) using T4 DNA ligase (NEB).

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator. .. The expression vectors were assembled using Gibson assembly® Master Mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions.

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid. .. The luxS gene fragment was inserted into the linearized pMG76e plasmid using Rapid DNA Ligation Kit (Thermo Scientific).

    Over Expression:

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: To construct the overexpression plasmids pUDE321 (TDH3 P -cokdcA -CYC1 t ) and pUDE336 (TDH3 P -cokivD -CYC1 t ), co-kdcA and co-kivD were PCR amplified from pUD342 and pUD350, respectively, with primer pairs “KdcA fwd GPDP homology/KdcA rev CYC1T homology” and “KivD fwd GPDP homology/KivD rev CYC1T homology” (Table ). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Hybridization:

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel
    Article Snippet: Plasmid DNA was digested with SmaI, XhoI, and BamHI endonucleases (MBI Fermentas); and the resulting restriction pattern was visualized in a 1% agarose gel by ethidium bromide staining. .. DNA was transferred from the agarose gel to a positively charged Hybond N+ membrane (Amersham Biosciences, Little Chalfont, United Kingdom) and cross-linked with UV light.

    High Performance Liquid Chromatography:

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: PCR amplification was performed using Phusion® Hot Start II High Fidelity Polymerase (Thermo scientific, Waltham, MA) according to manufacturer’s instructions using HPLC or PAGE purified, custom synthesized oligonucleotide primers (Sigma Aldrich, Zwijndrecht, The Netherlands) in a Biometra TGradient Thermocycler (Biometra, Göttingen, Germany). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Electroporation:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Transfection:

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion. .. Since the XhoI restriction site is located between SacI and XbaI restriction sites, only the empty pmiRGlo vector was digested with XhoI enzyme, while the ligated pmirGLO constructs harboring the WT/MT inserts were not digested, confirming insert ligation.

    Ligation:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. The pJ915 plasmid and Kex2-hChymase insert were purified separately by electrophoresis with a 1% (w/v) LE agarose gel and subsequent isolated with a gel DNA recovery kit (Zymo Research).

    Article Title: l-xylo-3-Hexulose Reductase Is the Missing Link in the Oxidoreductive Pathway for
    Article Snippet: The promoter and terminator regions were obtained by PCR from the genomic DNA of the T. reesei strain QM9414 using primers Trire22771_XbaI-Ups-fw, Trire22771_XhoI-Ups-rev, Trire22771_XhoI-Dws-fw, and Trire22771_Acc-Dws-rev ( ) and the proofreading DNA polymerase Phusion (Finnzymes). .. Both fragments were ligated into the vector pBluescript SK(+) (Stratagene) after digestion with XbaI and XhoI (Fermentas) for the promoter fragment and with XhoI and Acc65I (Fermentas) for the terminator fragment using ligation mix III (Takara). .. The SalI fragment of pyr4 served as the selection marker and was cloned via XhiI restriction between the promoter and terminator regions of lxr4 in pBluescript SK(+).

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The plasmid and insert were ligated with Quick-Stick ligase (Bioline) and the ligation mixture was used to transform DH5α E. coli (Zymo Research). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid. .. The luxS gene fragment was inserted into the linearized pMG76e plasmid using Rapid DNA Ligation Kit (Thermo Scientific).

    Sequencing:

    Article Title: l-xylo-3-Hexulose Reductase Is the Missing Link in the Oxidoreductive Pathway for
    Article Snippet: Both fragments were ligated into the vector pBluescript SK(+) (Stratagene) after digestion with XbaI and XhoI (Fermentas) for the promoter fragment and with XhoI and Acc65I (Fermentas) for the terminator fragment using ligation mix III (Takara). .. The SalI fragment of pyr4 served as the selection marker and was cloned via XhiI restriction between the promoter and terminator regions of lxr4 in pBluescript SK(+).

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: A 1014 bp genomic fragment of the ERRβ gene, from − 988 to + 26 bp relative to the start sequence of exon1 (designated as + 1) was amplified by PCR using 50–100 nanograms of genomic DNA as a template. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: The protein sequence of PVX110940 was retrieved from Plasmodium Genomic Database (PlasmoDB) ( http://plasmodb.org/ ). .. PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ).

    Article Title: Conserved Pbp1/Ataxin-2 regulates retrotransposon activity and connects polyglutamine expansion-driven protein aggregation to lifespan-controlling rDNA repeats
    Article Snippet: First, a TAP tag was cloned into the vector using the restriction enzymes PdiI and XhoI (Thermo Fisher Scientific). .. First, a TAP tag was cloned into the vector using the restriction enzymes PdiI and XhoI (Thermo Fisher Scientific).

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. PCR cycling conditions were as follows: 92 °C for 30 s, 55 °C for 1 min, 68 °C for 10 min, and a final extension at 68 °C for 10 min. After PCR, 20 μL of the reaction was digested with DpnI at 37 °C for 1 h and 10 μL was transformed into DH5 alpha Escherichia coli to prepare the mutant construct plasmids.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator. .. The expression vectors were assembled using Gibson assembly® Master Mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: A 1014 bp genomic fragment of the ERRβ gene, from − 988 to + 26 bp relative to the start sequence of exon1 (designated as + 1) was amplified by PCR using 50–100 nanograms of genomic DNA as a template. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Binding Assay:

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: The complementary target site for miR-182 on CLDN1 3′UTR, predicted using in silico analysis, was flanked by sticky ended 5′SacI and 3′XbaI restriction sites to form the wild-type (WT) insert, or the binding site was deleted to form the mutant type insert (MT). pmirGLO was double digested using XbaI and SacI (Thermo Scientific; Waltham, MA, USA) restriction enzymes. .. To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion.

    Transmission Electron Microscopy:

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel
    Article Snippet: Plasmid DNA was digested with SmaI, XhoI, and BamHI endonucleases (MBI Fermentas); and the resulting restriction pattern was visualized in a 1% agarose gel by ethidium bromide staining. .. DNA was transferred from the agarose gel to a positively charged Hybond N+ membrane (Amersham Biosciences, Little Chalfont, United Kingdom) and cross-linked with UV light.

    DNA Extraction:

    Article Title: Cydia pomonella granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts
    Article Snippet: Paragraph title: DNA extraction and restriction endonuclease (REN) analysis of CpGV isolates. ... Approximately 500 ng of purified virus DNA was digested with EcoRI, BamHI, PstI, SalI, or XhoI (Fermentas) in the supplied buffer at 37°C for 3 h. The DNA restriction fragments were separated by electrophoresis in 1% agarose gels in Tris-acetate-EDTA buffer at 80 V for approximately 4 h. λ-phage DNA/HindIII fragments were used as standards for size determination.

    Mutagenesis:

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: Forward (F) and reverse (R) primers' sequences were designed as follows: for the WT target site F 5′CATCTTTCTACCTCTTTTTTCTATCTGCCAAATTGAGATAAT3′ R 5′CTAGATTATCTCAATTTGGCAGATAGAAAAAAGAGGTAGAAAGATGAGCT3′ and for the MT target site F 5′CATCTTTCTACCTCTTTTTTCTATCATTGAGATAAT3′ R 5′CTAGATTATCTCAATGATAGAAAAAAGAGGTAGAAAGATGAGCT3′. .. To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion. .. Since the XhoI restriction site is located between SacI and XbaI restriction sites, only the empty pmiRGlo vector was digested with XhoI enzyme, while the ligated pmirGLO constructs harboring the WT/MT inserts were not digested, confirming insert ligation.

    Article Title: Influenza A viruses escape from MxA restriction at the expense of efficient nuclear vRNP import
    Article Snippet: pHW2000 rescue plasmids were used for site directed mutagenesis. .. The mutated ORF were cloned into pCAGGS expression plasmids using restriction enzymes NotI and XhoI (Fermentas).

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific).

    Isolation:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The biochemical properties of (Man)5 -rhChymase closely resemble those of the native human enzyme and this provides a starting point for future efforts to generate rhChymase with true human-type glycosylation in P. pastoris . .. The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. P. pastoris expression plasmid pJ915 (DNA 2.0), which provides secretion directed by α-mating factor and the GAP promoter for constitutive expression, was separately treated in the same manner.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The pJ915 plasmid and Kex2-hChymase insert were purified separately by electrophoresis with a 1% (w/v) LE agarose gel and subsequent isolated with a gel DNA recovery kit (Zymo Research). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel
    Article Snippet: Paragraph title: Plasmid isolation and Southern analysis. ... Plasmid DNA was digested with SmaI, XhoI, and BamHI endonucleases (MBI Fermentas); and the resulting restriction pattern was visualized in a 1% agarose gel by ethidium bromide staining.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: Genomic DNA was isolated from MCF7 cells as per the standard protocol [ ]. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: Genomic DNA was isolated from MCF7 cells as per the standard protocol [ ]. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: Chromosomal DNA of L. paraplantarum L-ZS9 was isolated using TIANamp Bacteria DNA Kit (Tiangen Biotech, Beijing). .. Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid.

    Purification:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The polymerase chain reaction (PCR) product of pIRES-H5-GFP was purified using PCR clean up Kit (Qiagen, Germantown, MD, USA), prior to double digestion with restriction enzymes. .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada). .. Thereafter, the DNA plasmid pBud-IRF3-H5-GFP was constructed by insertion of the IRF3 into pBud downstream of the cytomegalovirus (CMV) promoter in the pBud-H5-GFP to construct the pBud-IRF3-H5-GFP.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. P. pastoris expression plasmid pJ915 (DNA 2.0), which provides secretion directed by α-mating factor and the GAP promoter for constitutive expression, was separately treated in the same manner.

    Article Title: Cydia pomonella granulovirus Genotypes Overcome Virus Resistance in the Codling Moth and Improve Virus Efficiency by Selection against Resistant Hosts
    Article Snippet: Resulting pellets were washed with 70% cold ethanol, dried, and resuspended into distilled water. .. Approximately 500 ng of purified virus DNA was digested with EcoRI, BamHI, PstI, SalI, or XhoI (Fermentas) in the supplied buffer at 37°C for 3 h. The DNA restriction fragments were separated by electrophoresis in 1% agarose gels in Tris-acetate-EDTA buffer at 80 V for approximately 4 h. λ-phage DNA/HindIII fragments were used as standards for size determination. .. Fragments were visualized under UV light by ethidium bromide staining.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The pJ915 plasmid and Kex2-hChymase insert were purified separately by electrophoresis with a 1% (w/v) LE agarose gel and subsequent isolated with a gel DNA recovery kit (Zymo Research). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3-ERRβ .

    Article Title: Decoy Receptor Interactions as Novel Drug Targets against EKC-Causing Human Adenovirus
    Article Snippet: Paragraph title: 2.2. Cloning, Expression, and Purification of the Fiber Knob ... For the production of GST-tagged 37FKs, HAdV-D37 FK gene was cloned into a pGEX-6P expression vector encoding a GST-tag (N-terminal) using restriction sites for NcoI and XhoI (Thermo Scientific, Waltham, MA, USA).

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant truncated PVX110940 ... PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ).

    Article Title: Sulfated Glycosaminoglycans as Viral Decoy Receptors for Human Adenovirus Type 37
    Article Snippet: Paragraph title: 2.3. Cloning, Expression, and Purification of Fiber Knobs ... GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific).

    Article Title: Conserved Pbp1/Ataxin-2 regulates retrotransposon activity and connects polyglutamine expansion-driven protein aggregation to lifespan-controlling rDNA repeats
    Article Snippet: First, a TAP tag was cloned into the vector using the restriction enzymes PdiI and XhoI (Thermo Fisher Scientific). .. To generate the polyglutamine plasmids, Pbp1 polyglutamine sequence plasmids (460 bp upstream to ClaI cut site within Pbp1 downstream of polyglutamine site) were ordered from Thermo Fisher Scientific.

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C. .. The pmCherry-N1 plasmid was also digested with BamHI and XhoI.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: PCR amplification was performed using Phusion® Hot Start II High Fidelity Polymerase (Thermo scientific, Waltham, MA) according to manufacturer’s instructions using HPLC or PAGE purified, custom synthesized oligonucleotide primers (Sigma Aldrich, Zwijndrecht, The Netherlands) in a Biometra TGradient Thermocycler (Biometra, Göttingen, Germany). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3 -ERRβ .

    Polymerase Chain Reaction:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The polymerase chain reaction (PCR) product of pIRES-H5-GFP was purified using PCR clean up Kit (Qiagen, Germantown, MD, USA), prior to double digestion with restriction enzymes. .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada). .. Thereafter, the DNA plasmid pBud-IRF3-H5-GFP was constructed by insertion of the IRF3 into pBud downstream of the cytomegalovirus (CMV) promoter in the pBud-H5-GFP to construct the pBud-IRF3-H5-GFP.

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr. .. The mixture was incubated at −20°C for 10 min before precipitating the DNA by centrifugation for 10 min. After washing with 80% ethanol, the DNA was dissolved in 20 μl of water, giving a concentration of 67 ng/μl.

    Article Title: l-xylo-3-Hexulose Reductase Is the Missing Link in the Oxidoreductive Pathway for
    Article Snippet: The promoter and terminator regions were obtained by PCR from the genomic DNA of the T. reesei strain QM9414 using primers Trire22771_XbaI-Ups-fw, Trire22771_XhoI-Ups-rev, Trire22771_XhoI-Dws-fw, and Trire22771_Acc-Dws-rev ( ) and the proofreading DNA polymerase Phusion (Finnzymes). .. Both fragments were ligated into the vector pBluescript SK(+) (Stratagene) after digestion with XbaI and XhoI (Fermentas) for the promoter fragment and with XhoI and Acc65I (Fermentas) for the terminator fragment using ligation mix III (Takara).

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3-ERRβ .

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Based on Bebipred score, a region of 407 aa corresponding to amino acids 261 and 667 was amplified from genomic DNA of the P. vivax Sal-I strain using the primers: PVX110940-Tr-F: 5′-TAAGAAT GCGGCCGC GAGGATGTGCTGCCAAGTGT-3′ and PVX110940-Tr-R: 5′- TTA CTCGAG TCATTCATCCTCCGCTTCATCCTC-3′. .. PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ). .. After cloning, the construct was analyzed by DNA sequencing.

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: At 48 h after transfection, the cellular lysates were collected to analyze the expression of genes of interest. .. To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. To produce constructs that bear mutations at a putative miR-141-binding site in WT SIRT1 3′UTR, site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: WDR1 transcript was PCR amplified, and restriction sites were added using Phusion high fidelity polymerase (NEB), and the following primers: forward (XhoI) 5′-CGCTCGAGATGCCGTACGAGATCAAG-3′; and reverse (BamHI) 5′-CCGGATCCTCTGAGGTGATTGTCC-3′. .. The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C. .. The pmCherry-N1 plasmid was also digested with BamHI and XhoI.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: To construct the overexpression plasmids pUDE321 (TDH3 P -cokdcA -CYC1 t ) and pUDE336 (TDH3 P -cokivD -CYC1 t ), co-kdcA and co-kivD were PCR amplified from pUD342 and pUD350, respectively, with primer pairs “KdcA fwd GPDP homology/KdcA rev CYC1T homology” and “KivD fwd GPDP homology/KivD rev CYC1T homology” (Table ). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3 -ERRβ .

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: The PCR product was cloned into pMD18T vector (Takara, Dalian) to construct vector luxS -pMD18T. .. Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid.

    Affinity Chromatography:

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ). .. Briefly, 4 μg of plasmidic DNA from two positive clones was used as a template in 50 μl of in vitro transcription/translation reaction.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: PCR amplification was performed using Phusion® Hot Start II High Fidelity Polymerase (Thermo scientific, Waltham, MA) according to manufacturer’s instructions using HPLC or PAGE purified, custom synthesized oligonucleotide primers (Sigma Aldrich, Zwijndrecht, The Netherlands) in a Biometra TGradient Thermocycler (Biometra, Göttingen, Germany). .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator.

    Staining:

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel
    Article Snippet: Plasmid DNA was isolated from two selected clinical Enterobacter strains and their E . coli transconjugants by using a Plasmid Midi kit (Qiagen). .. Plasmid DNA was digested with SmaI, XhoI, and BamHI endonucleases (MBI Fermentas); and the resulting restriction pattern was visualized in a 1% agarose gel by ethidium bromide staining. .. DNA was transferred from the agarose gel to a positively charged Hybond N+ membrane (Amersham Biosciences, Little Chalfont, United Kingdom) and cross-linked with UV light.

    Plasmid Preparation:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: The polymerase chain reaction (PCR) product of pIRES-H5-GFP was purified using PCR clean up Kit (Qiagen, Germantown, MD, USA), prior to double digestion with restriction enzymes. .. The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada). .. Thereafter, the DNA plasmid pBud-IRF3-H5-GFP was constructed by insertion of the IRF3 into pBud downstream of the cytomegalovirus (CMV) promoter in the pBud-H5-GFP to construct the pBud-IRF3-H5-GFP.

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr. .. The mixture was incubated at −20°C for 10 min before precipitating the DNA by centrifugation for 10 min. After washing with 80% ethanol, the DNA was dissolved in 20 μl of water, giving a concentration of 67 ng/μl.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The biochemical properties of (Man)5 -rhChymase closely resemble those of the native human enzyme and this provides a starting point for future efforts to generate rhChymase with true human-type glycosylation in P. pastoris . .. The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. P. pastoris expression plasmid pJ915 (DNA 2.0), which provides secretion directed by α-mating factor and the GAP promoter for constitutive expression, was separately treated in the same manner.

    Article Title: l-xylo-3-Hexulose Reductase Is the Missing Link in the Oxidoreductive Pathway for
    Article Snippet: The promoter and terminator regions were obtained by PCR from the genomic DNA of the T. reesei strain QM9414 using primers Trire22771_XbaI-Ups-fw, Trire22771_XhoI-Ups-rev, Trire22771_XhoI-Dws-fw, and Trire22771_Acc-Dws-rev ( ) and the proofreading DNA polymerase Phusion (Finnzymes). .. Both fragments were ligated into the vector pBluescript SK(+) (Stratagene) after digestion with XbaI and XhoI (Fermentas) for the promoter fragment and with XhoI and Acc65I (Fermentas) for the terminator fragment using ligation mix III (Takara). .. The SalI fragment of pyr4 served as the selection marker and was cloned via XhiI restriction between the promoter and terminator regions of lxr4 in pBluescript SK(+).

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The plasmid and insert were ligated with Quick-Stick ligase (Bioline) and the ligation mixture was used to transform DH5α E. coli (Zymo Research). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel
    Article Snippet: Plasmid DNA was isolated from two selected clinical Enterobacter strains and their E . coli transconjugants by using a Plasmid Midi kit (Qiagen). .. Plasmid DNA was digested with SmaI, XhoI, and BamHI endonucleases (MBI Fermentas); and the resulting restriction pattern was visualized in a 1% agarose gel by ethidium bromide staining. .. DNA was transferred from the agarose gel to a positively charged Hybond N+ membrane (Amersham Biosciences, Little Chalfont, United Kingdom) and cross-linked with UV light.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3-ERRβ .

    Article Title: Decoy Receptor Interactions as Novel Drug Targets against EKC-Causing Human Adenovirus
    Article Snippet: Briefly, for the production of His-tagged FKs, HAdV-C5 and HAdV-D37 FK genes were cloned into a pQE30-Xa expression vector encoding a His-tag (N-terminal) using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. For the production of GST-tagged 37FKs, HAdV-D37 FK gene was cloned into a pGEX-6P expression vector encoding a GST-tag (N-terminal) using restriction sites for NcoI and XhoI (Thermo Scientific, Waltham, MA, USA). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
    Article Snippet: To confirm binding of miR-182 to CLDN1 3′UTR, firefly luciferase reporter vector was used (pmirGLO) (Promega; Madison, WI, USA). .. To ensure insert ligation, the empty, as well as wild and mutant ligated pmirGLO constructs were subjected to XhoI (Thermo Scientific; USA) digestion.

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Based on Bebipred score, a region of 407 aa corresponding to amino acids 261 and 667 was amplified from genomic DNA of the P. vivax Sal-I strain using the primers: PVX110940-Tr-F: 5′-TAAGAAT GCGGCCGC GAGGATGTGCTGCCAAGTGT-3′ and PVX110940-Tr-R: 5′- TTA CTCGAG TCATTCATCCTCCGCTTCATCCTC-3′. .. PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ). .. After cloning, the construct was analyzed by DNA sequencing.

    Article Title: Sulfated Glycosaminoglycans as Viral Decoy Receptors for Human Adenovirus Type 37
    Article Snippet: Briefly, the fiber knob genes of HAdV-C5 and HAdV-D37 were cloned into a pQE30-Xa expression vector encoding an N-terminal His-tag using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Article Title: Conserved Pbp1/Ataxin-2 regulates retrotransposon activity and connects polyglutamine expansion-driven protein aggregation to lifespan-controlling rDNA repeats
    Article Snippet: The vector pRS303 was used as a backbone for cloning. .. First, a TAP tag was cloned into the vector using the restriction enzymes PdiI and XhoI (Thermo Fisher Scientific). .. Next, a full length Pbp1 including the native promoter (460 bp upstream of Pbp1 start site) PCR product was generated from W303 genomic DNA using Phusion (NEB) and cloned into the TAP-tagged vector using PdiI and PauI (Thermo Fisher Scientific).

    Article Title: Influenza A viruses escape from MxA restriction at the expense of efficient nuclear vRNP import
    Article Snippet: Paragraph title: Plasmid construction ... The mutated ORF were cloned into pCAGGS expression plasmids using restriction enzymes NotI and XhoI (Fermentas).

    Article Title: Preclinical development of a microRNA-based therapy for intervertebral disc degeneration
    Article Snippet: At 48 h after transfection, the cellular lysates were collected to analyze the expression of genes of interest. .. To construct the WT SIRT1 3’UTR-Luc reporter plasmid (SIRT1 3′UTR), a fragment of the 3′UTR of the SIRT1 gene, including the predicted miR-141-binding site, was PCR-amplified and then cloned into the psi-CHECKTM-2 vector (Promega, Madison, WI) downstream of the firefly luciferase gene with XhoI and NotI (Thermo Fisher Scientific). .. To produce constructs that bear mutations at a putative miR-141-binding site in WT SIRT1 3′UTR, site-directed mutagenesis was performed using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, CA, USA).

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C. .. The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C.

    Article Title: Comparative assessment of native and heterologous 2-oxo acid decarboxylases for application in isobutanol production by Saccharomyces cerevisiae
    Article Snippet: The primers included a 5′ extension homologous to either the TDH3 promoter or CYC1 terminator regions of p426GPD [ ] to allow for Gibson assembly with the vector backbone [ ]. .. The p426GPD expression vector was digested with the restriction endonucleases SpeI and XhoI (Life Technologies Europe BV, Bleiswijk, The Netherlands), creating a linear vector backbone flanked by the TDH3 promoter and CYC1 terminator. .. The expression vectors were assembled using Gibson assembly® Master Mix (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified. .. The restriction digested PCR product and PGL3 vectors were ligated using T4 DNA ligase (New England BioLabs, Inc., Ipswich, MA, USA) and clone was confirmed by sequencing and designated as pGL3 -ERRβ .

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: The PCR product was cloned into pMD18T vector (Takara, Dalian) to construct vector luxS -pMD18T. .. Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid. .. The luxS gene fragment was inserted into the linearized pMG76e plasmid using Rapid DNA Ligation Kit (Thermo Scientific).

    Recombinant:

    Article Title: Induction of a robust immune response against avian influenza virus following transdermal inoculation with H5-DNA vaccine formulated in modified dendrimer-based delivery system in mouse model
    Article Snippet: Paragraph title: Construction of recombinant DNA plasmids ... The purified PCR product and the expression vector pBudCE4.1 were digested with NotI and XhoI (Fermentas, Burlington, Canada).

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: Paragraph title: Cloning, expression and purification of recombinant truncated PVX110940 ... PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ).

    Article Title: Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes
    Article Snippet: Subsequently, luxS -pMD18T vector (Plac as the promoter) and pMG76e vector (P32 as the promoter) (kindly provided by Professor Shangwu Chen, China Agricultural University) were digested with fastDigest enzymes XbaI and XhoI (Thermo Scientific) at 37°C for 5 min to obtain luxS gene fragment and dual-enzyme digested linearized pMG76e plasmid. .. The ligation product was transformed into E. coli DH5α and verified by PCR using primers 5′-TTCGGTCCTCGGGATATG-3′ (forward) and 5′-CTGTCTTGGCCGCTTCAA-3′ (reverse). luxS -pMG76e and empty pMG76e plasmids were electro-transformed into L. paraplantarum L-ZS9 competence cells.

    Agarose Gel Electrophoresis:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest). .. P. pastoris expression plasmid pJ915 (DNA 2.0), which provides secretion directed by α-mating factor and the GAP promoter for constitutive expression, was separately treated in the same manner.

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: The pJ915 plasmid and Kex2-hChymase insert were purified separately by electrophoresis with a 1% (w/v) LE agarose gel and subsequent isolated with a gel DNA recovery kit (Zymo Research). .. Plasmids were recovered by miniprep (Zymo Research) and analyzed on a 1.2% agarose FlashGel™ (Lonza) following XhoI and NotI dual restriction digestion (ThermoFisher, FastDigest).

    Article Title: Extended-Spectrum Beta-Lactamases among Enterobacter Isolates Obtained in Tel Aviv, Israel
    Article Snippet: Plasmid DNA was isolated from two selected clinical Enterobacter strains and their E . coli transconjugants by using a Plasmid Midi kit (Qiagen). .. Plasmid DNA was digested with SmaI, XhoI, and BamHI endonucleases (MBI Fermentas); and the resulting restriction pattern was visualized in a 1% agarose gel by ethidium bromide staining. .. DNA was transferred from the agarose gel to a positively charged Hybond N+ membrane (Amersham Biosciences, Little Chalfont, United Kingdom) and cross-linked with UV light.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C. .. The pmCherry-N1 plasmid was also digested with BamHI and XhoI.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    In Vitro:

    Article Title: Characterization of Plasmodium vivax Proteins in Plasma-Derived Exosomes From Malaria-Infected Liver-Chimeric Humanized Mice
    Article Snippet: PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ). .. PCR amplified fragment was digested with NotI and XhoI (Thermo scientific) and directly ligated into the pIVEX1.4-GST vector from which N-terminal GST-tagged fusion proteins are expressed (Rui et al., ).

    Selection:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris
    Article Snippet: Paragraph title: Cloning and Selection ... The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest).

    Produced:

    Article Title: Sulfated Glycosaminoglycans as Viral Decoy Receptors for Human Adenovirus Type 37
    Article Snippet: Briefly, the fiber knob genes of HAdV-C5 and HAdV-D37 were cloned into a pQE30-Xa expression vector encoding an N-terminal His-tag using restriction sites for BamHI and XmaI (Thermo Scientific, Waltham, MA, USA). .. GST-tagged HAdV-D37 fiber knob was produced as following; HAdV-D37 fiber knob gene was cloned into a pGEX-6P expression vector encoding an N-terminal GST-tag using restriction sites for NcoI and XhoI (Thermo Scientific). .. All constructs were confirmed by sequencing (Eurofins MWG Operon, Ebersberg, Germany).

    Concentration Assay:

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin
    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr. .. S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr.

    Gel Extraction:

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% (w /v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Article Title: Autoinflammatory periodic fever, immunodeficiency, and thrombocytopenia (PFIT) caused by mutation in actin-regulatory gene WDR1
    Article Snippet: The resultant PCR product was digested with FastDigest BamHI and XhoI (Thermo Fisher Scientific) for 15 min at 37°C. .. The pmCherry-N1 plasmid was also digested with BamHI and XhoI.

    Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
    Article Snippet: The amplified samples were resolved in 0.8% ( w / v ) agarose gel and purified using Gene elute gel extraction kit (Sigma-Aldrich) according to manufacturer’s protocol. .. Both the purified PCR product and PGL3 basic luciferase vector were digested using KpnI and XhoI (Thermo Scientific, Waltham, MA, USA) restriction enzymes for 4 h at 37 °C and purified.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Thermo Fisher xhoi restriction enzymes
    (A) Digestion on extracted plasmid of one of positive clones with NheI and <t>XhoI</t> confirmed HBsAg fragment insertion in <t>pcDNA</t> vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.
    Xhoi Restriction Enzymes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 98/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi restriction enzymes/product/Thermo Fisher
    Average 98 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    xhoi restriction enzymes - by Bioz Stars, 2020-01
    98/100 stars
      Buy from Supplier

    Image Search Results


    (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Journal: Research in Pharmaceutical Sciences

    Article Title: Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression

    doi: 10.4103/1735-5362.192485

    Figure Lengend Snippet: (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Article Snippet: The extracted plasmid of one of the resulted clones and pcDNA 3.1 Hygro (+) plasmid (Invitrogen, USA) were digested by NheI and XhoI restriction enzymes (Thermoscience, USA) separately.

    Techniques: Plasmid Preparation, Clone Assay, Recombinant

    One-Step Cloning and Heterologous Expression of the Conglobatin Gene Cluster (A) A 41-kbp XhoI-EcoRI DNA fragment (black) containing the five genes congA–E is generated by XhoI and EcoRI digestion of total genomic DNA. A 5.3-kbp pSET152 fragment was obtained by PCR amplification using as template the pSET152-derived plasmid pIB139. The resulting linear vector fragment had 39- and 41-bp flanking regions, respectively, identical to the termini of the target DNA (see Experimental Procedures ). (B) Gibson assembly leads to specific cloning of the target fragment, to give the bifunctional E. coli - Streptomyces plasmid pYJ24. The deduced open reading frame functions in the fragment are given in Table S1 . (C) Heterologous expression in S. coelicolor M1154 is confirmed by HPLC-MS and comparison with authentic compound produced by S. conglobatus (see also Figure S1 ). The mass extraction of m / z 499–500 is used to display the data. The y axis scale of S. conglobatus is 20 times larger than that of pYJ24/M1154 or M1154.

    Journal: Chemistry & Biology

    Article Title: Iterative Mechanism of Macrodiolide Formation in the Anticancer Compound Conglobatin

    doi: 10.1016/j.chembiol.2015.05.010

    Figure Lengend Snippet: One-Step Cloning and Heterologous Expression of the Conglobatin Gene Cluster (A) A 41-kbp XhoI-EcoRI DNA fragment (black) containing the five genes congA–E is generated by XhoI and EcoRI digestion of total genomic DNA. A 5.3-kbp pSET152 fragment was obtained by PCR amplification using as template the pSET152-derived plasmid pIB139. The resulting linear vector fragment had 39- and 41-bp flanking regions, respectively, identical to the termini of the target DNA (see Experimental Procedures ). (B) Gibson assembly leads to specific cloning of the target fragment, to give the bifunctional E. coli - Streptomyces plasmid pYJ24. The deduced open reading frame functions in the fragment are given in Table S1 . (C) Heterologous expression in S. coelicolor M1154 is confirmed by HPLC-MS and comparison with authentic compound produced by S. conglobatus (see also Figure S1 ). The mass extraction of m / z 499–500 is used to display the data. The y axis scale of S. conglobatus is 20 times larger than that of pYJ24/M1154 or M1154.

    Article Snippet: S. conglobatus genomic DNA was digested with XhoI and EcoRI (FastDigest, Thermo Scientific) at 37°C for 3.5 hr.

    Techniques: Clone Assay, Expressing, Generated, Polymerase Chain Reaction, Amplification, Derivative Assay, Plasmid Preparation, High Performance Liquid Chromatography, Mass Spectrometry, Produced

    pJ915-rhChymase vector map The P. pastoris expression plasmid pJ915-rhChymase (4035 bp) encodes a fusion protein that consists of rhChymase linked to yeast α-Mating Factor (a secretion signal peptide) by a kexin cleavage site. The cDNA for rhChymase with the kexin cleavage site was transferred from a previously reported plasmid, pPICzα-rhChymase using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

    Journal:

    Article Title: Expression of Recombinant Human Mast Cell Chymase with Asn-linked Glycans in Glycoengineered Pichia pastoris

    doi: 10.1016/j.pep.2014.08.005

    Figure Lengend Snippet: pJ915-rhChymase vector map The P. pastoris expression plasmid pJ915-rhChymase (4035 bp) encodes a fusion protein that consists of rhChymase linked to yeast α-Mating Factor (a secretion signal peptide) by a kexin cleavage site. The cDNA for rhChymase with the kexin cleavage site was transferred from a previously reported plasmid, pPICzα-rhChymase using 5’ XhoI and 3’ NotI restriction sites. The GAP promoter provides constitutive expression of the fusion protein and the plasmid contains a Zeocin resistance selectable marker gene. The plasmid is linearized at the SwaI restriction site prior to electroporation.

    Article Snippet: The DNA encoding human Chymase (hChymase) with an added N-terminal Kex2 protease cleavage site was isolated from the previously described plasmid pPICzα-rhChymase [ ] using simultaneous digestion with XhoI and NotI restriction endonucleases (Thermo Scientific, FastDigest).

    Techniques: Plasmid Preparation, Expressing, Marker, Electroporation