xhoi  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    XhoI
    Description:
    XhoI 25 000 units
    Catalog Number:
    R0146L
    Price:
    285
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs xhoi
    XhoI
    XhoI 25 000 units
    https://www.bioz.com/result/xhoi/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Analyzing the Branch Migration Activities of Eukaryotic Proteins"

    Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

    Journal:

    doi: 10.1016/j.ymeth.2010.02.010

    Production of joint molecules used to test the branch migration activity of proteins. (A) Joint molecules with a 3′ displaced ssDNA tail are produced by RAD51 using gapped DNA and pBS II K (+) dsDNA linearized with XhoI. (B) Joint molecules with
    Figure Legend Snippet: Production of joint molecules used to test the branch migration activity of proteins. (A) Joint molecules with a 3′ displaced ssDNA tail are produced by RAD51 using gapped DNA and pBS II K (+) dsDNA linearized with XhoI. (B) Joint molecules with

    Techniques Used: Migration, Activity Assay, Produced

    The scheme used to produce gapped DNA. i) pBS II K (+) plasmid DNA is digested with XhoI and AlwNI. ii) The large DNA fragment from this digest is purified by gel electrophoresis in agarose gels, and then iii) annealed to circular ssDNA to generate gapped
    Figure Legend Snippet: The scheme used to produce gapped DNA. i) pBS II K (+) plasmid DNA is digested with XhoI and AlwNI. ii) The large DNA fragment from this digest is purified by gel electrophoresis in agarose gels, and then iii) annealed to circular ssDNA to generate gapped

    Techniques Used: Plasmid Preparation, Purification, Nucleic Acid Electrophoresis

    Illustration of the 0.8% agarose gel used to purify the large (2065 bp) dsDNA fragment of pBS II K (+) following digestion with XhoI and AlwNI. After electrophoresis, lanes A, C, and E are excised from the gel and stained with ethidium bromide (dashed
    Figure Legend Snippet: Illustration of the 0.8% agarose gel used to purify the large (2065 bp) dsDNA fragment of pBS II K (+) following digestion with XhoI and AlwNI. After electrophoresis, lanes A, C, and E are excised from the gel and stained with ethidium bromide (dashed

    Techniques Used: Agarose Gel Electrophoresis, Electrophoresis, Staining

    2) Product Images from "Small Fragment Homologous Replacement: Evaluation of Factors Influencing Modification Efficiency in an Eukaryotic Assay System"

    Article Title: Small Fragment Homologous Replacement: Evaluation of Factors Influencing Modification Efficiency in an Eukaryotic Assay System

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0030851

    Experimental design for SDF and cell clone generation. A) SDF sequence is homologous to the entire wild type eGFP coding sequence. SDF-PCR-WT, 876 bp long was generated by PCR amplification with primer pair 1F/1R ( Table 1 ). SDF-DIG-WT, 752 bp long, was obtained by HindIII and XhoI digestion of pCR-2.1 vector. C/T transition, responsible of fluorescence switching off, is showed. B) Sequencing analysis showing wild type (WT; top panel) and mutated (Mut; bottom panel) pCEP4-eGFP in C1 and D1 cell clones, respectively. Arrows indicate the modified base (C→T). C) FACS density plot of C1 (WT; top) and D1 (Mut; bottom) respectively. D) pCEP4-eGFP copy number determination for each cell clone.
    Figure Legend Snippet: Experimental design for SDF and cell clone generation. A) SDF sequence is homologous to the entire wild type eGFP coding sequence. SDF-PCR-WT, 876 bp long was generated by PCR amplification with primer pair 1F/1R ( Table 1 ). SDF-DIG-WT, 752 bp long, was obtained by HindIII and XhoI digestion of pCR-2.1 vector. C/T transition, responsible of fluorescence switching off, is showed. B) Sequencing analysis showing wild type (WT; top panel) and mutated (Mut; bottom panel) pCEP4-eGFP in C1 and D1 cell clones, respectively. Arrows indicate the modified base (C→T). C) FACS density plot of C1 (WT; top) and D1 (Mut; bottom) respectively. D) pCEP4-eGFP copy number determination for each cell clone.

    Techniques Used: Sequencing, Polymerase Chain Reaction, Generated, Amplification, Plasmid Preparation, Fluorescence, Clone Assay, Modification, FACS

    3) Product Images from "Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)"

    Article Title: Topoisomerase 2 Is Dispensable for the Replication and Segregation of Small Yeast Artificial Chromosomes (YACs)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0104995

    Construction of pYAC_MEM and YAC_MEM. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear maps of the circular minichromosome’s restriction fragments and their sizes are indicated. At the bottom the genetic map of YAC_MEM. C: Circular and linear DNAs analyzed in unidirectional gel electrophoresis run in the presence of 0.1 µgr/ml chloroquine. The relative positions for linear size markers are indicated to the left. The number for each lane is shown on top and the nature of each band is shown to the right. Intact DNA isolated from S. cerevisiae transformed with pYAC_MEM (lane 1); DNA isolated from E. coli cells transformed with pYAC_MEM digested with BamHI (lane 2); Intact DNA from S. cerevisiae transformed with YAC_MEM (lane 3). Hybridized with L2. D: Genomic and extra-chromosomal DNA fragments analyzed by unidirectional gel electrophoresis after digestion with BamHI and XhoI, hybridized with URA3. DNA from untransformed cells (lane 1); DNA from cells transformed with pYAC_MEM (lane 2); DNA from cells transformed with YAC_MEM (lane 3). Note the relative intensities of the genomic (chromosomal) and extrachromosomal bands in each lane.
    Figure Legend Snippet: Construction of pYAC_MEM and YAC_MEM. A: Name, mass and genetic map of the circular minichromosome. The relative positions of its most relevant features are indicated inside: The centromeric sequence CEN6, the autonomous replication sequence (ARS4), URA3, the lambda DNA marker sequence (L1), Tetrahymena telomeric repeats, HIS3, the lambda DNA marker sequence (L2), the ColE1 unidirectional origin (ColE1 Ori) and the ampicillin-resistance gene (AmpR). Outside, the relative positions of sites recognized by specific restriction endonucleases are indicated. B: The corresponding linear maps of the circular minichromosome’s restriction fragments and their sizes are indicated. At the bottom the genetic map of YAC_MEM. C: Circular and linear DNAs analyzed in unidirectional gel electrophoresis run in the presence of 0.1 µgr/ml chloroquine. The relative positions for linear size markers are indicated to the left. The number for each lane is shown on top and the nature of each band is shown to the right. Intact DNA isolated from S. cerevisiae transformed with pYAC_MEM (lane 1); DNA isolated from E. coli cells transformed with pYAC_MEM digested with BamHI (lane 2); Intact DNA from S. cerevisiae transformed with YAC_MEM (lane 3). Hybridized with L2. D: Genomic and extra-chromosomal DNA fragments analyzed by unidirectional gel electrophoresis after digestion with BamHI and XhoI, hybridized with URA3. DNA from untransformed cells (lane 1); DNA from cells transformed with pYAC_MEM (lane 2); DNA from cells transformed with YAC_MEM (lane 3). Note the relative intensities of the genomic (chromosomal) and extrachromosomal bands in each lane.

    Techniques Used: Sequencing, Lambda DNA Preparation, Marker, Nucleic Acid Electrophoresis, Isolation, Transformation Assay

    4) Product Images from "Chaperokine Function of Recombinant Hsp72 Produced in Insect Cells Using a Baculovirus Expression System Is Retained"

    Article Title: Chaperokine Function of Recombinant Hsp72 Produced in Insect Cells Using a Baculovirus Expression System Is Retained

    Journal:

    doi: 10.1074/jbc.M109.024612

    Schematic representation of the pBACgus-70 transfer vector construct. The coding sequence of the human hsp72 gene was cloned into baculovirus transfer plasmid pBACgus-2cp between HindIII and XhoI restriction sites to form the pBACgus-70 transfer vector.
    Figure Legend Snippet: Schematic representation of the pBACgus-70 transfer vector construct. The coding sequence of the human hsp72 gene was cloned into baculovirus transfer plasmid pBACgus-2cp between HindIII and XhoI restriction sites to form the pBACgus-70 transfer vector.

    Techniques Used: Plasmid Preparation, Construct, Sequencing, Clone Assay

    5) Product Images from "An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein"

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0043527

    Construction of plasmid pRLuc42R. The DmpR (1.692 kb) and its promoter (Pr) and operator (Po) were cloned from Pseudomonas sp. CF600. DNA segment was digested with XhoI and Hind III and introduced upstream of the luciferase gene in the pGL3 basic expression vector. The arrows indicate the transcription or processing direction for genes. (a) Digested and gel purified pGL3 vector and Gel Purified DmpR+Po Promoter for Ligation (b) Double digestion of pRLuc42R. (c) Vector drawing of pRLuc42R Fig (a) I-500 bp ladder, II-2377 bp (insert), III-4818 bp (vector) Fig (b) I-500 bp ladder, II-Double digested pRLuc42R.
    Figure Legend Snippet: Construction of plasmid pRLuc42R. The DmpR (1.692 kb) and its promoter (Pr) and operator (Po) were cloned from Pseudomonas sp. CF600. DNA segment was digested with XhoI and Hind III and introduced upstream of the luciferase gene in the pGL3 basic expression vector. The arrows indicate the transcription or processing direction for genes. (a) Digested and gel purified pGL3 vector and Gel Purified DmpR+Po Promoter for Ligation (b) Double digestion of pRLuc42R. (c) Vector drawing of pRLuc42R Fig (a) I-500 bp ladder, II-2377 bp (insert), III-4818 bp (vector) Fig (b) I-500 bp ladder, II-Double digested pRLuc42R.

    Techniques Used: Plasmid Preparation, Clone Assay, Luciferase, Expressing, Purification, Ligation

    6) Product Images from "Nucleotide-resolution DNA double-strand breaks mapping by next-generation sequencing"

    Article Title: Nucleotide-resolution DNA double-strand breaks mapping by next-generation sequencing

    Journal: Nature methods

    doi: 10.1038/nmeth.2408

    BLESS workflow and specificity. ( a ) DSBs are ligated in situ to a proximal linker (red arch) covalently linked to biotin (orange oval) (1), gDNA is extracted and fragmented (2), and labeled fragments are captured on streptavidin beads (gray ovals) (3). A distal linker (blue arch) is then ligated to the free extremity of captured fragments (4), and fragments are released by linker digestion with I-SceI (5). Released fragments are amplified by PCR using linker-specific primers (6), and sequenced (7). ( b ) Structure of linkers. Both proximal (P) and distal (D) linkers share an XhoI site (yellow), the I-SceI endonuclease minimal recognition site (non-highlighted letters), and a seven-thymine loop (bold). Each linker contains a specific barcode sequence marking the ligation site (orange and brown). The proximal linker is biotinylated (orange oval). ( c ) Proportion of fragments with proximal (P) and distal (D) barcodes in single-end (SE) and pair-end (PE) Illumina sequencing experiments. Mean ± s.d. is shown.
    Figure Legend Snippet: BLESS workflow and specificity. ( a ) DSBs are ligated in situ to a proximal linker (red arch) covalently linked to biotin (orange oval) (1), gDNA is extracted and fragmented (2), and labeled fragments are captured on streptavidin beads (gray ovals) (3). A distal linker (blue arch) is then ligated to the free extremity of captured fragments (4), and fragments are released by linker digestion with I-SceI (5). Released fragments are amplified by PCR using linker-specific primers (6), and sequenced (7). ( b ) Structure of linkers. Both proximal (P) and distal (D) linkers share an XhoI site (yellow), the I-SceI endonuclease minimal recognition site (non-highlighted letters), and a seven-thymine loop (bold). Each linker contains a specific barcode sequence marking the ligation site (orange and brown). The proximal linker is biotinylated (orange oval). ( c ) Proportion of fragments with proximal (P) and distal (D) barcodes in single-end (SE) and pair-end (PE) Illumina sequencing experiments. Mean ± s.d. is shown.

    Techniques Used: In Situ, Labeling, Amplification, Polymerase Chain Reaction, Sequencing, Ligation

    7) Product Images from "Association of Novel and Highly Diverse Acid-Tolerant Denitrifiers with N2O Fluxes of an Acidic Fen"

    Article Title: Association of Novel and Highly Diverse Acid-Tolerant Denitrifiers with N2O Fluxes of an Acidic Fen

    Journal:

    doi: 10.1128/AEM.02256-09

    Comparative TRFLP analyses of narG (A to C) and nosZ (D to F) amplified from different soil layers of the acidic fen. PCR products were digested with CfoI (A), HaeIII (B), XhoI (C), BtgI (D), NlaIV (E), and PvuI and SacI (F). Mean values of three replicates
    Figure Legend Snippet: Comparative TRFLP analyses of narG (A to C) and nosZ (D to F) amplified from different soil layers of the acidic fen. PCR products were digested with CfoI (A), HaeIII (B), XhoI (C), BtgI (D), NlaIV (E), and PvuI and SacI (F). Mean values of three replicates

    Techniques Used: Terminal Restriction Fragment Length Polymorphism, Amplification, Polymerase Chain Reaction

    8) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1124/dmd.114.059188

    Confirmation that CYP2F1 was inactivated and not expressed. (A) DNA sequence determined for WT and mutant CYP2F1 exon-10 region. The CYS codon (blue) and three additional nucleotides in WT CYP2F1 was replaced by an XhoI restriction site (red) and a loxP
    Figure Legend Snippet: Confirmation that CYP2F1 was inactivated and not expressed. (A) DNA sequence determined for WT and mutant CYP2F1 exon-10 region. The CYS codon (blue) and three additional nucleotides in WT CYP2F1 was replaced by an XhoI restriction site (red) and a loxP

    Techniques Used: Sequencing, Mutagenesis

    9) Product Images from "Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells"

    Article Title: Multiresidue Method for Analysis of β Agonists in Swine Urine by Enzyme Linked Receptor Assay Based on β2 Adrenergic Receptor Expressed in HEK293 Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0139176

    Agarose gel electrophoresis analysis of 3 combinant expression plasmid. The plasmid was confirmed by PCR and double digestion using NcoI and XhoI. Lane 1 was the fragment of recombinant plasmid DNA pTriEx-1.1 Hygro-β 2 -AR. Lane 2 was the electrophoresis results of digested products containing 2 fragments (6951 bp and 1257 bp). A 3300 bp fragment (lane 3 and lane 4) was amplified by PCR from the recombinant plasmid, which was identical with the sum of the size of target gene and vector sequences between NcoI and XhoI.
    Figure Legend Snippet: Agarose gel electrophoresis analysis of 3 combinant expression plasmid. The plasmid was confirmed by PCR and double digestion using NcoI and XhoI. Lane 1 was the fragment of recombinant plasmid DNA pTriEx-1.1 Hygro-β 2 -AR. Lane 2 was the electrophoresis results of digested products containing 2 fragments (6951 bp and 1257 bp). A 3300 bp fragment (lane 3 and lane 4) was amplified by PCR from the recombinant plasmid, which was identical with the sum of the size of target gene and vector sequences between NcoI and XhoI.

    Techniques Used: Agarose Gel Electrophoresis, Expressing, Plasmid Preparation, Polymerase Chain Reaction, Recombinant, Electrophoresis, Amplification

    10) Product Images from "Biochemical Analysis of the Human Mismatch Repair Proteins hMutSα MSH2G674A-MSH6 and MSH2-MSH6T1219D"

    Article Title: Biochemical Analysis of the Human Mismatch Repair Proteins hMutSα MSH2G674A-MSH6 and MSH2-MSH6T1219D

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.316919

    MutSα mutants block excision. A , MutSα G674A ( GA ) and T1219D ( TD ) are defective for 5′-nick-directed mismatch-provoked excision assayed by hybridization of probes to the un-excised strand. Upper panel , the schematic depicts the 5′-nick-directed excision assay measured by annealing probe 1 or 2 identical to the excised strand. Lower panel , excision assays were performed as described for MMR assays but with the omission of exogenous dNTPs using pSCW02_GT or pSCW02 homoduplex (A:T) DNA substrates. B , MutSα G674A and T1219D were defective for 5′-nick-directed excision assayed by Southern blotting after cleavage with AflII. Upper panel , 5′ nick-directed excision assay by Southern blotting. The distance from the AflII cleavage site to the Nb.BbvCI nick site on the top strand is 664 nt. The position of the G:T mismatch is denoted by the triangle and is located 537 nt from the AflII site (denoted by an asterisk in the lower panel ). Lower panel , excision assays were monitored by Southern blotting. Nicked A:T homoduplex was used to measure random excision. C , MutSα G674A and T1219D are defective for 5′-nick-directed excision assayed by Southern blotting after cleavage with PciI. 5′-Nick-directed excision assays were performed as in B , but the gapped 5′-nicked DNA substrates were digested with PciI. D , MutSα G674A and T1219D were defective for 3′-nick-directed excision assayed by Southern blotting after cleavage with PvuI. Upper panel , the schematic depicts multiple cleavage sites generated by MutLα. The distance from the PvuI cleavage site to the 3′-nick generated by Nt.BspQI is 600 nt. The distance from the PvuI site to the mismatch is 550 nt (denoted by an asterisk ). E , MutSα G674A and T1219D are defective for 3′-nick-directed excision, assayed by Southern blotting after cleavage with XhoI. The bracket indicates incision intermediates, and the triangle represents a larger 3′ incision (see “Results”).
    Figure Legend Snippet: MutSα mutants block excision. A , MutSα G674A ( GA ) and T1219D ( TD ) are defective for 5′-nick-directed mismatch-provoked excision assayed by hybridization of probes to the un-excised strand. Upper panel , the schematic depicts the 5′-nick-directed excision assay measured by annealing probe 1 or 2 identical to the excised strand. Lower panel , excision assays were performed as described for MMR assays but with the omission of exogenous dNTPs using pSCW02_GT or pSCW02 homoduplex (A:T) DNA substrates. B , MutSα G674A and T1219D were defective for 5′-nick-directed excision assayed by Southern blotting after cleavage with AflII. Upper panel , 5′ nick-directed excision assay by Southern blotting. The distance from the AflII cleavage site to the Nb.BbvCI nick site on the top strand is 664 nt. The position of the G:T mismatch is denoted by the triangle and is located 537 nt from the AflII site (denoted by an asterisk in the lower panel ). Lower panel , excision assays were monitored by Southern blotting. Nicked A:T homoduplex was used to measure random excision. C , MutSα G674A and T1219D are defective for 5′-nick-directed excision assayed by Southern blotting after cleavage with PciI. 5′-Nick-directed excision assays were performed as in B , but the gapped 5′-nicked DNA substrates were digested with PciI. D , MutSα G674A and T1219D were defective for 3′-nick-directed excision assayed by Southern blotting after cleavage with PvuI. Upper panel , the schematic depicts multiple cleavage sites generated by MutLα. The distance from the PvuI cleavage site to the 3′-nick generated by Nt.BspQI is 600 nt. The distance from the PvuI site to the mismatch is 550 nt (denoted by an asterisk ). E , MutSα G674A and T1219D are defective for 3′-nick-directed excision, assayed by Southern blotting after cleavage with XhoI. The bracket indicates incision intermediates, and the triangle represents a larger 3′ incision (see “Results”).

    Techniques Used: Blocking Assay, Hybridization, Excision Assay, Southern Blot, Generated

    11) Product Images from "Replication fork collapse is a major cause of the high mutation frequency at three-base lesion clusters"

    Article Title: Replication fork collapse is a major cause of the high mutation frequency at three-base lesion clusters

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt731

    Duplexes carrying damaged sites used in this study. Oligonucleotides carrying oG, hU and U. The modified bases are indicated in bold. oG was separated by 3 bp from hU located on the complementary strand in MDS/+1, MDS/−5. Uracil was positioned at +1 position relatively to hU in MDS/+1 and at −5 position in MDS/−5. The control U/U oligonucleotide consists of two bistranded Us separated by 5 bp. Undamaged and MDS-containing 56-mers duplexes harbor EcoRI and XhoI restriction sites at each extremity as indicated.
    Figure Legend Snippet: Duplexes carrying damaged sites used in this study. Oligonucleotides carrying oG, hU and U. The modified bases are indicated in bold. oG was separated by 3 bp from hU located on the complementary strand in MDS/+1, MDS/−5. Uracil was positioned at +1 position relatively to hU in MDS/+1 and at −5 position in MDS/−5. The control U/U oligonucleotide consists of two bistranded Us separated by 5 bp. Undamaged and MDS-containing 56-mers duplexes harbor EcoRI and XhoI restriction sites at each extremity as indicated.

    Techniques Used: Modification

    12) Product Images from "Overexpression of Neuregulin-1 (NRG-1) Gene Contributes to Surgical Repair of Brachial Plexus Injury After Contralateral C7 Nerve Root Transfer in Rats"

    Article Title: Overexpression of Neuregulin-1 (NRG-1) Gene Contributes to Surgical Repair of Brachial Plexus Injury After Contralateral C7 Nerve Root Transfer in Rats

    Journal: Medical Science Monitor : International Medical Journal of Experimental and Clinical Research

    doi: 10.12659/MSM.908144

    NRG-1 recombinant plasmid was constructed by double-enzyme digestion and identified by PCR. ( A ) 8 clones (5–12) were selected randomly and identified by PCR, 1: blank control, 2: empty plasmid control, 3: positive control (GAPDH), 4: marker; ( B ) plasmid enzyme detachment, M: marker, after: after HindIII and XhoI double-enzyme digestion, before: before double-enzyme digestion.
    Figure Legend Snippet: NRG-1 recombinant plasmid was constructed by double-enzyme digestion and identified by PCR. ( A ) 8 clones (5–12) were selected randomly and identified by PCR, 1: blank control, 2: empty plasmid control, 3: positive control (GAPDH), 4: marker; ( B ) plasmid enzyme detachment, M: marker, after: after HindIII and XhoI double-enzyme digestion, before: before double-enzyme digestion.

    Techniques Used: Recombinant, Plasmid Preparation, Construct, Polymerase Chain Reaction, Clone Assay, Positive Control, Marker

    13) Product Images from "Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena"

    Article Title: Resistance to 6-Methylpurine is Conferred by Defective Adenine Phosphoribosyltransferase in Tetrahymena

    Journal: Genes

    doi: 10.3390/genes9040179

    Effect on cell sensitivity to 6mp of replacing wild-type APRT1 with the mutant gene. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pD127N-FZZ-PAC, with the mutant gene, FZZ tag containing polyA signal, and puromycin resistant cassette ( PAC ) (middle), and after homologous recombination (lower). Control plasmid carries wild-type APRT1 instead of the mutated version. ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and FZZ-tagged APRTase-expressing transformants. The molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Western blot analysis of FZZ-tagged APRTases. FZZ tag and APRTase were 17 kDa and 20 kDa, respectively, resulting in a single 37 kDa band. Tubulin-alpha was the loading control. ( D ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h.
    Figure Legend Snippet: Effect on cell sensitivity to 6mp of replacing wild-type APRT1 with the mutant gene. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pD127N-FZZ-PAC, with the mutant gene, FZZ tag containing polyA signal, and puromycin resistant cassette ( PAC ) (middle), and after homologous recombination (lower). Control plasmid carries wild-type APRT1 instead of the mutated version. ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and FZZ-tagged APRTase-expressing transformants. The molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Western blot analysis of FZZ-tagged APRTases. FZZ tag and APRTase were 17 kDa and 20 kDa, respectively, resulting in a single 37 kDa band. Tubulin-alpha was the loading control. ( D ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h.

    Techniques Used: Mutagenesis, Plasmid Preparation, Homologous Recombination, Southern Blot, Expressing, Molecular Weight, Western Blot

    Effect of partial APRT1 knockout on cell sensitivity to 6mp. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pΔAPRT1-NEO5, with paromomycin resistance cassette ( NEO5 ) (middle), and after homologous recombination (lower). ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and partial APRT1 knockout cells. Molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h. ( D ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after measurement of cell growth rates in 6mp. ( E ) Southern blot analysis of XhoI-and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after the induction of phenotypic assortment with 5 mg/mL paromomycin for 2 months. Molecular weight of signals against the probe corresponds to that predicted in the schematic in ( A ).
    Figure Legend Snippet: Effect of partial APRT1 knockout on cell sensitivity to 6mp. ( A ) A schematic showing the APRT1 genomic locus (upper), the plasmid vector pΔAPRT1-NEO5, with paromomycin resistance cassette ( NEO5 ) (middle), and after homologous recombination (lower). ( B ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from wild-type cells and partial APRT1 knockout cells. Molecular weight of signals against the probe corresponds to the prediction in ( A ). ( C ) Cell growth curves in the presence of 15 µg/mL 6mp. Points and attached bars correspond to mean measurements from three identical experiments and their standard deviations, respectively. Cells sensitive to 6mp all died by 72 h. ( D ) Southern blot analysis of XhoI- and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after measurement of cell growth rates in 6mp. ( E ) Southern blot analysis of XhoI-and BamHI-digested genomic DNA from partial APRT1 knockout cells before and after the induction of phenotypic assortment with 5 mg/mL paromomycin for 2 months. Molecular weight of signals against the probe corresponds to that predicted in the schematic in ( A ).

    Techniques Used: Knock-Out, Plasmid Preparation, Homologous Recombination, Southern Blot, Molecular Weight

    14) Product Images from "Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion"

    Article Title: Soluble L1CAM promotes breast cancer cell adhesion and migration in vitro, but not invasion

    Journal: Cancer Cell International

    doi: 10.1186/1475-2867-10-34

    Over-expressing L1-ectodomain in MDA-MB-468 cells . (A) Schematic diagram of Lvv 1879 vector containing L1ED. 3350 bp L1 ectodomain fragment was amplified and inserted into Lvv 1879 via SpeI and XhoI restriction enzyme sites. The constructed lentivirus was used to infect MDA-MB-468 cells to establish a new stable cell line. (B) Immunostaining and FACS analysis of L1CAM level in MDA-MB-468-L1ED compared to mock vector infected and plain MDA-MB-468 cells. (C) TCA precipitation and western blotting examining over-expressed L1 ectodomain release in MDA-MB-468-L1ED culture medium by monoclonal antibody 5G3. The amount of cell associated L1 in pellets was probed by polyclonal antibody NCAM-L1 (C-20).
    Figure Legend Snippet: Over-expressing L1-ectodomain in MDA-MB-468 cells . (A) Schematic diagram of Lvv 1879 vector containing L1ED. 3350 bp L1 ectodomain fragment was amplified and inserted into Lvv 1879 via SpeI and XhoI restriction enzyme sites. The constructed lentivirus was used to infect MDA-MB-468 cells to establish a new stable cell line. (B) Immunostaining and FACS analysis of L1CAM level in MDA-MB-468-L1ED compared to mock vector infected and plain MDA-MB-468 cells. (C) TCA precipitation and western blotting examining over-expressed L1 ectodomain release in MDA-MB-468-L1ED culture medium by monoclonal antibody 5G3. The amount of cell associated L1 in pellets was probed by polyclonal antibody NCAM-L1 (C-20).

    Techniques Used: Expressing, Multiple Displacement Amplification, Plasmid Preparation, Amplification, Construct, Stable Transfection, Immunostaining, FACS, Infection, TCA Precipitation, Western Blot

    15) Product Images from "RIP140 in thyroid hormone-repression and chromatin remodeling of Crabp1 gene during adipocyte differentiation"

    Article Title: RIP140 in thyroid hormone-repression and chromatin remodeling of Crabp1 gene during adipocyte differentiation

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkp780

    Alterations of restriction enzyme accessibility in the juxtaposed region of Crabp1 promoter along the course of adipocyte differentiation. ( A ) Detection of nucleosome array. Chromatin of MNase partially digested nuclei was separated on agarose gels followed by Southern blot analysis (left panel) and EtBr staining (right panel). A probe used covering the TIS (HinfI-PvuII) was used for Southern blot analysis. ( B–F ) Nuclei (differentiation Days 0, 4, 8) were digested with the indicated restriction enzymes and the recovered chromatin DNAs were completely re-digested with ApaI ( B–D ) or PstI ( E and F ) (the relationship of specific restriction site and each individual nucleosome was depicted in panel G), followed by Southern blot analyses using probe 1 ( D ) or probe 2 (B–C and E–F). ( G ) Schematic description of restriction enzyme digestion, nucleosomes, and predicted fragments detected with probes on the Southern blots. Complete digestion with ApaI produced 1.3 kb, and complete digestion with PstI produced 1.65 kb fragments. The generated fragments by digestion with XhoI, PstI, SmaI, SpeI and ApaLI for the corresponding nucleosome are 0.93, 0.67, 0.86, 0.55 and 0.65 kb, respectively. Nucleosomes on this array were named N5 to N-1, from the 5′- to the 3′-ends of this chromatin segment. Experiments were performed for least three times.
    Figure Legend Snippet: Alterations of restriction enzyme accessibility in the juxtaposed region of Crabp1 promoter along the course of adipocyte differentiation. ( A ) Detection of nucleosome array. Chromatin of MNase partially digested nuclei was separated on agarose gels followed by Southern blot analysis (left panel) and EtBr staining (right panel). A probe used covering the TIS (HinfI-PvuII) was used for Southern blot analysis. ( B–F ) Nuclei (differentiation Days 0, 4, 8) were digested with the indicated restriction enzymes and the recovered chromatin DNAs were completely re-digested with ApaI ( B–D ) or PstI ( E and F ) (the relationship of specific restriction site and each individual nucleosome was depicted in panel G), followed by Southern blot analyses using probe 1 ( D ) or probe 2 (B–C and E–F). ( G ) Schematic description of restriction enzyme digestion, nucleosomes, and predicted fragments detected with probes on the Southern blots. Complete digestion with ApaI produced 1.3 kb, and complete digestion with PstI produced 1.65 kb fragments. The generated fragments by digestion with XhoI, PstI, SmaI, SpeI and ApaLI for the corresponding nucleosome are 0.93, 0.67, 0.86, 0.55 and 0.65 kb, respectively. Nucleosomes on this array were named N5 to N-1, from the 5′- to the 3′-ends of this chromatin segment. Experiments were performed for least three times.

    Techniques Used: Southern Blot, Staining, Produced, Generated

    16) Product Images from "Optimizing the design of protein nanoparticles as carriers for vaccine applications"

    Article Title: Optimizing the design of protein nanoparticles as carriers for vaccine applications

    Journal:

    doi: 10.1016/j.nano.2015.05.003

    (a) PDB search for protein structures with inter-helical angles similar to the mode of the nanoparticle followed by superposition of the helices of the different pdb-structures (blue and red) onto the pentamer (green) and trimer (blue) helices of the monomer of the peptide nanoparticle. The residues with angles similar to the angle between the helices of the pentamer and the trimer in the peptide nanoparticle were selected (gray region). ( b) Schematics of the molecular biology strategy for inserting the new linker region: the original construct with pentameric (green) and trimeric (blue) helices is double digested with restriction enzymes ApaI and XhoI. ( c) Linker oligonucleotides selected from panel a are ligated into double digested vector (panel b ) using T4 DNA ligase generating new plasmid which codes for the genetically modified single polypeptide chain.
    Figure Legend Snippet: (a) PDB search for protein structures with inter-helical angles similar to the mode of the nanoparticle followed by superposition of the helices of the different pdb-structures (blue and red) onto the pentamer (green) and trimer (blue) helices of the monomer of the peptide nanoparticle. The residues with angles similar to the angle between the helices of the pentamer and the trimer in the peptide nanoparticle were selected (gray region). ( b) Schematics of the molecular biology strategy for inserting the new linker region: the original construct with pentameric (green) and trimeric (blue) helices is double digested with restriction enzymes ApaI and XhoI. ( c) Linker oligonucleotides selected from panel a are ligated into double digested vector (panel b ) using T4 DNA ligase generating new plasmid which codes for the genetically modified single polypeptide chain.

    Techniques Used: Construct, Plasmid Preparation, Genetically Modified

    17) Product Images from "Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli"

    Article Title: Examining a DNA Replication Requirement for Bacteriophage λ Red- and Rac Prophage RecET-Promoted Recombination in Escherichia coli

    Journal: mBio

    doi: 10.1128/mBio.01443-16

    Linear dimer recombination assay. (A) The linear dimer substrate is depicted, with genes and mutations indicated. Each of the two tet mutations generates XhoI restriction sites. Normal PstI sites are located in the bla genes. The dimer is made linear by digestion at a unique BamHI site; the star indicates the location of a second defective BamHI site. (B) The 5′-to-3′ dsDNA exonuclease, either λ Exo or Rac RecE, degrades the 5′ strands of the linear dsDNA to reveal 3′ overhangs to which the λ Beta or Rac RecT recombinase binds. (C) The recombinase anneals the internal complementary ssDNA regions to form a circular monomeric plasmid intermediate with 3′ ssDNA tails. Host functions presumably remove the long single-stranded 3′ ends, with DNA ligase sealing the resulting nicks.
    Figure Legend Snippet: Linear dimer recombination assay. (A) The linear dimer substrate is depicted, with genes and mutations indicated. Each of the two tet mutations generates XhoI restriction sites. Normal PstI sites are located in the bla genes. The dimer is made linear by digestion at a unique BamHI site; the star indicates the location of a second defective BamHI site. (B) The 5′-to-3′ dsDNA exonuclease, either λ Exo or Rac RecE, degrades the 5′ strands of the linear dsDNA to reveal 3′ overhangs to which the λ Beta or Rac RecT recombinase binds. (C) The recombinase anneals the internal complementary ssDNA regions to form a circular monomeric plasmid intermediate with 3′ ssDNA tails. Host functions presumably remove the long single-stranded 3′ ends, with DNA ligase sealing the resulting nicks.

    Techniques Used: Recombination Assay, Plasmid Preparation

    18) Product Images from "Rejoining of DNA Double-Strand Breaks as a Function of Overhang Length"

    Article Title: Rejoining of DNA Double-Strand Breaks as a Function of Overhang Length

    Journal:

    doi: 10.1128/MCB.25.3.896-906.2005

    Oligonucleotide-modified plasmid assay. (A) Plasmid modification scheme. pTW423 is digested with BglII and XhoI and purified, removing the polyterminator. Annealed oligonucleotides are then ligated onto the BglII and XhoI ends, restoring the ADE2 coding sequence. Precise in-frame repair of the break yields Ade+ colonies. (B) Primer extension assay to determine the oligonucleotide ligation efficiency. Annealed oligonucleotides (Oligos) were added to the ligation reaction mixture at concentrations of 50, 100, 500, 1,000, and 5,000-fold molar excess over the concentration of the linearized plasmid (indicated by the thickness of the triangle over the lanes). Primer extension was performed after ligation as described in Materials and Methods.
    Figure Legend Snippet: Oligonucleotide-modified plasmid assay. (A) Plasmid modification scheme. pTW423 is digested with BglII and XhoI and purified, removing the polyterminator. Annealed oligonucleotides are then ligated onto the BglII and XhoI ends, restoring the ADE2 coding sequence. Precise in-frame repair of the break yields Ade+ colonies. (B) Primer extension assay to determine the oligonucleotide ligation efficiency. Annealed oligonucleotides (Oligos) were added to the ligation reaction mixture at concentrations of 50, 100, 500, 1,000, and 5,000-fold molar excess over the concentration of the linearized plasmid (indicated by the thickness of the triangle over the lanes). Primer extension was performed after ligation as described in Materials and Methods.

    Techniques Used: Modification, Plasmid Preparation, Purification, Sequencing, Primer Extension Assay, Ligation, Concentration Assay

    19) Product Images from "Cloning of fliC Gene From Salmonella typhimurium in the Expression Vector pVAX1 and Evaluation of its Expression in Eukaryotic Cells"

    Article Title: Cloning of fliC Gene From Salmonella typhimurium in the Expression Vector pVAX1 and Evaluation of its Expression in Eukaryotic Cells

    Journal: Jundishapur Journal of Microbiology

    doi: 10.5812/jjm.12351

    Electrophoresis of pPrime- fliC Recombinant Plasmids From White Colonies on 1% Agarose Gel Lane 1 to 6: extracted Pprime- fliC plasmids; Lane 8 to 13: Pprime- fliC plasmids digested by XhoI; Lane 15 to 20: Pprime- fliC plasmids digested by XhoI and NheI; Lane 7 and 14: 1 Kbp DNA ladder vivantis.
    Figure Legend Snippet: Electrophoresis of pPrime- fliC Recombinant Plasmids From White Colonies on 1% Agarose Gel Lane 1 to 6: extracted Pprime- fliC plasmids; Lane 8 to 13: Pprime- fliC plasmids digested by XhoI; Lane 15 to 20: Pprime- fliC plasmids digested by XhoI and NheI; Lane 7 and 14: 1 Kbp DNA ladder vivantis.

    Techniques Used: Electrophoresis, Recombinant, Agarose Gel Electrophoresis

    AgaroseGel Electrophoresis of Restriction Enzyme Digestion of Purified pVAX- fliC Recombinant Plasmid Lane 1: pVAX- fliC plasmid digested by XhoI had one band (4419 bp); Lane 2: Double Digestion by NheI and XhoI on pVAX- fliC plasmid had two bands that were 1509 bp (down) and 2910 bp (up); Lane 3: 1 Kbp DNA ladder Vivantis.
    Figure Legend Snippet: AgaroseGel Electrophoresis of Restriction Enzyme Digestion of Purified pVAX- fliC Recombinant Plasmid Lane 1: pVAX- fliC plasmid digested by XhoI had one band (4419 bp); Lane 2: Double Digestion by NheI and XhoI on pVAX- fliC plasmid had two bands that were 1509 bp (down) and 2910 bp (up); Lane 3: 1 Kbp DNA ladder Vivantis.

    Techniques Used: Electrophoresis, Purification, Recombinant, Plasmid Preparation

    20) Product Images from "Genome-Wide Mapping of DNA Strand Breaks"

    Article Title: Genome-Wide Mapping of DNA Strand Breaks

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0017353

    dDIP enrichment of yeast telomeric DNA evaluated by Southern blot. Extracted yeast DNA was first digested by XhoI or PstI, two enzymes cutting once in the conserved telomere proximal Y' repeat element giving a≈1.2 kb and ≈1.0 kb terminal restriction fragment respectively. A probe covering part of the telomeric Y' fragment including the terminal 0.35 kb TG1-3 repeats was used to reveal the capture of telomeric DNA. To evaluate the telomeres immunoprecipitation efficiency by the dDIP technique, 30%, 40% and 50% of the input DNA before immunoprecipitation was applied to the gel. N+, DNA from uninduced cells end-labeled with dATP, biotin-dATP and TdT. N-, DNA from uninduced cells end-labeled with dATP, biotin-dATP without TdT.
    Figure Legend Snippet: dDIP enrichment of yeast telomeric DNA evaluated by Southern blot. Extracted yeast DNA was first digested by XhoI or PstI, two enzymes cutting once in the conserved telomere proximal Y' repeat element giving a≈1.2 kb and ≈1.0 kb terminal restriction fragment respectively. A probe covering part of the telomeric Y' fragment including the terminal 0.35 kb TG1-3 repeats was used to reveal the capture of telomeric DNA. To evaluate the telomeres immunoprecipitation efficiency by the dDIP technique, 30%, 40% and 50% of the input DNA before immunoprecipitation was applied to the gel. N+, DNA from uninduced cells end-labeled with dATP, biotin-dATP and TdT. N-, DNA from uninduced cells end-labeled with dATP, biotin-dATP without TdT.

    Techniques Used: Southern Blot, Immunoprecipitation, Labeling

    Related Articles

    Transduction:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: Paragraph title: Production of NIS vector, retroviral supernatant and retroviral transduction ... The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Clone Assay:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: The diploids were sporulated, and the pif1-m2 spore clones carrying the plasmids were recovered. .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Purified CD4+ T-cells were resuspended in PBMC growth media: RPMI 1640 supplemented with 10% FBS, L-glutamine (20 mM), penicillin/streptomycin (100 mg/ml), and IL-2 (10 U/ml, Roche). .. Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. The resulting plasmids, NL4-3-MSS-eGFP and NL4-3-MSS-DsRed2, were sequenced across the junctions 5′ and 3′ of the fluorescent reporter gene using primers overlapping the 5′ Bam HI site ( 5′-TAGTGAACGGATCCTTAGCACTTATC-3′ ) and 3′ Xho I site ( 5′-TTCTAGGTCTCGAGATACTGCTCCCAC-3′ ).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Paragraph title: Library Design and Cloning ... Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Paragraph title: Cloning, expression and purification of VapA and VapD   ... The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ).

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: CA8 wildtype (WT) gene cDNA was purchased from Origene (Cat. No. RC210228). .. An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The V5-CA8 construct was then cloned between the BamHI and BglII restriction sites of the pAAV-MCS vector, one component of AAV Helper-Free System (Agilent Technologies, Santa Clara, CA), after amplification from pcDNA3.1/V5-His A using (CTCGGATCC GCCACC ATGGCGGAC) as forward primer and (TTTGTCGACTCACGTAGAATCGAGACCGAG) as reverse primer.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Paragraph title: Cloning of infant T/F env SGA sequences ... Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Paragraph title: 2.2.2. Site-directed mutagenesis and cloning ... Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Centrifugation:

    Article Title:
    Article Snippet: pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA). .. pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA).

    Amplification:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The loxP -KanMX -loxP fragment was amplified by PCR with primers O8655 and O8656 using the pUG6 plasmid [ ] as a template. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: The second fragment (2943 bp) contained only easF and was amplified by PCR primed with oligonucleotides easFF (5'-TCCATTCTTCGCTCGTTCAACCAGCAGG-3') and easFR (5'-CAGGACCTGTACCTAAAGCCTGGTAACC-3') in a 25 μL reaction containing 1× GoTaq Flexi buffer, 200 μM each deoxynucleotide triphosphate, 1.5 mM MgCl2 , 1 μM of each primer, and 2.5 units of Taq DNA polymerase (Promega, Madison, WI, USA). .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: NIS in the pcDNA3 vector was amplified by PCR using the forward primer 5′-CAC CAC CTC GAG GCT GTC AGC GCT GAG CAC AGC and reverse primer 5′-CAC CAC GAA TTC TTT GGC CCA TCC TGA GGA ACC . .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: Human CD59 lacking the sequence encoding the C-terminal 26 amino acids was amplified by PCR using the primers CD59XH2F ( 5′-CCCCCTCGAGTGGACAATCAC AATGGG-3′ ) and CD59StopEV-R ( 5′-TAAGGAGATATCTTAATTTTCAAGCTGTT CGTTA-3′ ) from the cDNA obtained from American Type Culture Collection. .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The primer sets were designed to contain the full length of coding sequence. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. The digested fragment was then subcloned between the NcoI site and the XhoI site of the pcDNA3.1+ vector.

    DNA Ligation:

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Synthesized:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The c-Myc promoter was synthesized by Sangon Biotech (Shanghai, China). .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Neutralization:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Briefly, cells (5×104 ) were fixed with 4% PFA for 10 mins at RT, followed by neutralization with 0.125 M glycine at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Construct:

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title:
    Article Snippet: Paragraph title: Retroviral Constructs ... Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: Paragraph title: Generation of adenovirus and AAV constructs ... The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The pcDNA3.1+ vector containing c-Myc-tagged PIWIL2 was constructed in our laboratory as previously described [ ]. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Real-time Polymerase Chain Reaction:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Incubation:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Cells were washed once with cold PBS and re-suspended and incubated in cold lysis buffer (10 mM Tris, pH 8, 10 mM NaCl, 5 mM MgCl2 , 0.1 mM EGTA, protease inhibitor cocktail and PMSF) for 10 min at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Where indicated, reactions were supplemented with 10 pmol of in vitro transcribed CLTA1 sgRNA. .. Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C. .. The reactions were stopped by the addition of Proteinase K (Thermo Scientific) and incubated at 37°C for 15 min. Cleavage products were analyzed by electrophoresis on a 1% agarose gel and stained with SYBR Safe.

    Article Title:
    Article Snippet: pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA). .. To express light chains, the expression vectors were transformed into BL21 (DE3) pLysS (Novagen).

    Luciferase:

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Expressing:

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: Paragraph title: Generation of AAV8 viruses expressing wildtype or mutant CA8 with V5 tag using AAV-MCS vectors ... An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer.

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The GST-T8 plasmid construct was transformed and expressed in BL21(DE3) Star cells.

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Article Title:
    Article Snippet: Paragraph title: Expression and Purification of Light Chain 22F6 ... pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Modification:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The MSCV (Murine Stem Cell Virus) MIGR1 vector was modified to contain human NIS followed by the IRES element and mCherry. .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Gaithersburg, Maryland, USA) containing 10 % fetal bovine serum (Gibco) at 37 °C in a incubator at 5 % CO2 . .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Western Blot:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Paragraph title: Western and Southern blotting ... Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Transformation Assay:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: For telomere blots, cells containing a plasmid with either a helicase gene (pMB267, 270, 282, and 292) or no insert (empty vector control; pMB13) ( ) were transformed into the PIF1 /pif1-m2 diploid (KP448). .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment. .. The plasmid that was derived through homologous recombination was rescued from yeast and amplified in E. coli .

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Plasmids were then transformed into XL10 gold chemically competent Escherichia coli cells. .. Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The reaction product was transformed into TOP10 cells for plasmid replication and isolated using a QIAprep miniprep kit (Qiagen, Hilden, Germany).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title:
    Article Snippet: pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA). .. The resulting DNA fragments were inserted between the same restriction sites of expression vector pET20b(+) (Novagen, Madison, WI).

    Over Expression:

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment. .. The plasmid that was derived through homologous recombination was rescued from yeast and amplified in E. coli .

    Derivative Assay:

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. The resulting PCR products were digested with the appropriate enzymes (New England Biolabs) and ligated into a pSP72 subcloning vector, containing EcoR I-Xho I sequence from NL4-3-MSS.

    Countercurrent Chromatography:

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Electroporation:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Transfection:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. This PCR product was digested with Esp3I, leaving an NcoI-compatible overhang, and SalI, and subsequently ligated into the NIS containing MIGR1 vector that had been digested with NcoI and SalI, which had removed the GFP.

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Paragraph title: Cell culture and transfection ... Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    TRAP Assay:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: Paragraph title: Yeast signal sequence trap assay ... The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion.

    Southern Blot:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Paragraph title: Western and Southern blotting ... Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Ligation:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Protease Inhibitor:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Cells were washed once with cold PBS and re-suspended and incubated in cold lysis buffer (10 mM Tris, pH 8, 10 mM NaCl, 5 mM MgCl2 , 0.1 mM EGTA, protease inhibitor cocktail and PMSF) for 10 min at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Cell Culture:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Paragraph title: Cell culture and transfection ... Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Generated:

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: This shortened version of the construct generated a product that was more stable than the previous His-tagged construct. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Gel Extraction:

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    DNA Sequencing:

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. Plasmids were transformed into E. coli DH5α by the CaCl2 transformation method.

    Sequencing:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: Paragraph title: Yeast signal sequence trap assay ... The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion.

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Chimeric infectious molecular clones in the Env region were generated by PCR amplifying archival clones of 1157i C2-V4 sequences in pGEM-T with primers containing the Age I ( 5′-CACATGGAATCAGACCGGT AGTATC-3′ ) and Sbf I ( 5′-GTTTTATCCTGCAGG GGAGTGTGATTG-3′ ) restriction sites to exactly match the sites flanking C2-V4 in the pNL4-3-MSS vector (position 6970 to 7464 in NL4-3).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. The library oligos were ligated into the vector using T4 DNA ligase (New England Biolabs) at a 1∶5 molar ratio of vector to insert, followed by phenol-chloroform extraction and ethanol precipitation for purification and concentration of DNA fragments.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. This PCR product was digested with Esp3I, leaving an NcoI-compatible overhang, and SalI, and subsequently ligated into the NIS containing MIGR1 vector that had been digested with NcoI and SalI, which had removed the GFP.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Amplicons from the first round PCR product that matched the infant consensus sequence (T/F virus sequence) were ligated into pcDNA3.1 Directional Topo vectors (Invitrogen) by introducing a–CACC 5’ end via a PCR reaction with the primers Rev19 (5’- ACTTTTTGACCACTTGCCACCCAT-3’) and Env1A (5’-caccTTAGGCATCTCCT ATGGCAGGAAGAAG-3’). .. Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: Human CD59 lacking the sequence encoding the C-terminal 26 amino acids was amplified by PCR using the primers CD59XH2F ( 5′-CCCCCTCGAGTGGACAATCAC AATGGG-3′ ) and CD59StopEV-R ( 5′-TAAGGAGATATCTTAATTTTCAAGCTGTT CGTTA-3′ ) from the cDNA obtained from American Type Culture Collection. .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Recombinant:

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The S100P mutation is associated with proteasome-mediated degradation that represents a null mutation comparable to the causal Car8 deletion mutation of the waddles mouse.

    Cellular Antioxidant Activity Assay:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: A SlonoMax library was obtained from Sloning BioTechnology GmbH (Pucheim, Germany), encoding helix 1 and 2 of the Affibody molecule with a Xho I and a Sac I site for subcloning to the vector (5′-CTC GAG GCG GAA GCC AAA TAC GCC AAA GAA XXX XXX XXX GCG XXX XXX GAG ATC XXX XXX TTA CCT AAC TTA ACC XXX XXX CAA XXX XXX GCC TTC ATC XXX AAA TTA XXX GAT GAC CCA AGC CAG AGC TCT-Ć; X denotes a randomized nucleotide position). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Immunofluorescence:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Cleavage Assay:

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Paragraph title: In vitro cleavage assay ... Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C.

    DNA Extraction:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: The diploids were sporulated, and the pif1-m2 spore clones carrying the plasmids were recovered. .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. Results from DNA from restreaks 1–3 are shown in , but the same results were also observed after 6 restreaks.

    Nucleic Acid Electrophoresis:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Magnetic Beads:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. The end-labeling reactions were upscaled and 1.5 ml eppendorf tubes were used to accommodate larger volumes.

    Mutagenesis:

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. These constructs directed the expression of full-length VapA (VapA-full), full-length VapD (Vap-full) and the N-terminally truncated form of VapD (Vap-core), each with the amino-acid residues LEHHHHHH attached at the C-terminus.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: Paragraph title: Generation of AAV8 viruses expressing wildtype or mutant CA8 with V5 tag using AAV-MCS vectors ... An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs). .. For three infants, 100046, 100383 and 101580, no SGA sequences matched 100% of nucleotides in the consensus sequence.

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Paragraph title: 2.2.2. Site-directed mutagenesis and cloning ... Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title:
    Article Snippet: To generate N-terminally truncated TAP1 (1ΔN), human TAP1 in the pLPCX vector served as a template for mutagenesis using the primer pair 5′-GCTTCGGGATCCTGCCGCCACCATGCCCGGGGGTCAGGGCGGCTCTGG-3′ and 5′-CCAGAGCCCTGACCCCCGGGCATGGTGGCGGCAGGATCCCGAAGC-3′, and human TAP2 in the pLNCX2 retroviral vector (Clontech) served as a template for mutagenesis using the primer pair 5′-CGCGGCTGAGCCGCCACCATGCCCGGGGCCCAGGAGAAGG-3′ and 5′-CCTTCTCCTGGGCCCCGGGCATGGTGGCGGCTCAGCCGCG-3′ to generate N-terminally truncated TAP2 (2ΔN). .. Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively.

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: Paragraph title: Mutation of FLAG-RAX ... The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1.

    Isolation:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: The diploids were sporulated, and the pif1-m2 spore clones carrying the plasmids were recovered. .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. Results from DNA from restreaks 1–3 are shown in , but the same results were also observed after 6 restreaks.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. Next, the library-encoding plasmids were transformed into electrocompetent E. coli SS320 by electroporation and individual clones where sequenced for library validation by BigDye Thermo Cycle Sequencing using an ABI Prism 3700 instrument (Applied Biosystems).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The GST-T8 plasmid construct was transformed and expressed in BL21(DE3) Star cells.

    Subcloning:

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Chimeric infectious molecular clones in the Env region were generated by PCR amplifying archival clones of 1157i C2-V4 sequences in pGEM-T with primers containing the Age I ( 5′-CACATGGAATCAGACCGGT AGTATC-3′ ) and Sbf I ( 5′-GTTTTATCCTGCAGG GGAGTGTGATTG-3′ ) restriction sites to exactly match the sites flanking C2-V4 in the pNL4-3-MSS vector (position 6970 to 7464 in NL4-3).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: A SlonoMax library was obtained from Sloning BioTechnology GmbH (Pucheim, Germany), encoding helix 1 and 2 of the Affibody molecule with a Xho I and a Sac I site for subcloning to the vector (5′-CTC GAG GCG GAA GCC AAA TAC GCC AAA GAA XXX XXX XXX GCG XXX XXX GAG ATC XXX XXX TTA CCT AAC TTA ACC XXX XXX CAA XXX XXX GCC TTC ATC XXX AAA TTA XXX GAT GAC CCA AGC CAG AGC TCT-Ć; X denotes a randomized nucleotide position). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Marker:

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Purification:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title:
    Article Snippet: To generate N-terminally truncated TAP1 (1ΔN), human TAP1 in the pLPCX vector served as a template for mutagenesis using the primer pair 5′-GCTTCGGGATCCTGCCGCCACCATGCCCGGGGGTCAGGGCGGCTCTGG-3′ and 5′-CCAGAGCCCTGACCCCCGGGCATGGTGGCGGCAGGATCCCGAAGC-3′, and human TAP2 in the pLNCX2 retroviral vector (Clontech) served as a template for mutagenesis using the primer pair 5′-CGCGGCTGAGCCGCCACCATGCCCGGGGCCCAGGAGAAGG-3′ and 5′-CCTTCTCCTGGGCCCCGGGCATGGTGGCGGCTCAGCCGCG-3′ to generate N-terminally truncated TAP2 (2ΔN). .. Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively. .. Sequencing of each construct was performed prior to retroviral transduction.

    Article Title:
    Article Snippet: Paragraph title: Expression and Purification of Light Chain 22F6 ... pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. AAVCAGsCD59 was generated by insertion of the CAGsCD59pA expression cassette (as employed in the adenovirus construct) into pAAV-MCS (Stratagene) to generate pAAVCAGsCD59 (further cloning details available upon request).

    Polymerase Chain Reaction:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. The DNA was digested overnight at 37°C with Alw N1 and run on a 0.7% agarose gel.

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The loxP -KanMX -loxP fragment was amplified by PCR with primers O8655 and O8656 using the pUG6 plasmid [ ] as a template. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ).

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ).

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: NIS in the pcDNA3 vector was amplified by PCR using the forward primer 5′-CAC CAC CTC GAG GCT GTC AGC GCT GAG CAC AGC and reverse primer 5′-CAC CAC GAA TTC TTT GGC CCA TCC TGA GGA ACC . .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. Next, mCherry obtained from the lab of Professor R.Y.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Phusion High-Fidelity PCR Master Mix with HF Buffer was used according to the manufacturer’s instructions (New England BioLabs). .. Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The reverse primer introduces a stop codon after asparagine 77. .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The control viruses, AdCAGGFP and AdCAGpA have been described previously .

    Positron Emission Tomography:

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Blocking Assay:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. The end-labeling reactions were upscaled and 1.5 ml eppendorf tubes were used to accommodate larger volumes.

    Staining:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Concentration Assay:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The PIWI fragment was amplified from human iPS cell lines with the primer set: 5′-TTC TCG AGA TGG ATC CTT TCC GAC CAT C-3′ and 5′-TTC CAT GGT CAC AGG AAG AAC AGG TTC TC-3′. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Plasmid Preparation:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: For telomere blots, cells containing a plasmid with either a helicase gene (pMB267, 270, 282, and 292) or no insert (empty vector control; pMB13) ( ) were transformed into the PIF1 /pif1-m2 diploid (KP448). .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment. .. The plasmid that was derived through homologous recombination was rescued from yeast and amplified in E. coli .

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Paragraph title: Plasmid Construction ... Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: A SlonoMax library was obtained from Sloning BioTechnology GmbH (Pucheim, Germany), encoding helix 1 and 2 of the Affibody molecule with a Xho I and a Sac I site for subcloning to the vector (5′-CTC GAG GCG GAA GCC AAA TAC GCC AAA GAA XXX XXX XXX GCG XXX XXX GAG ATC XXX XXX TTA CCT AAC TTA ACC XXX XXX CAA XXX XXX GCC TTC ATC XXX AAA TTA XXX GAT GAC CCA AGC CAG AGC TCT-Ć; X denotes a randomized nucleotide position). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: NIS in the pcDNA3 vector was amplified by PCR using the forward primer 5′-CAC CAC CTC GAG GCT GTC AGC GCT GAG CAC AGC and reverse primer 5′-CAC CAC GAA TTC TTT GGC CCA TCC TGA GGA ACC . .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. Next, mCherry obtained from the lab of Professor R.Y.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The S100P mutation is associated with proteasome-mediated degradation that represents a null mutation comparable to the causal Car8 deletion mutation of the waddles mouse.

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The reaction product was transformed into TOP10 cells for plasmid replication and isolated using a QIAprep miniprep kit (Qiagen, Hilden, Germany).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Article Title:
    Article Snippet: To generate N-terminally truncated TAP1 (1ΔN), human TAP1 in the pLPCX vector served as a template for mutagenesis using the primer pair 5′-GCTTCGGGATCCTGCCGCCACCATGCCCGGGGGTCAGGGCGGCTCTGG-3′ and 5′-CCAGAGCCCTGACCCCCGGGCATGGTGGCGGCAGGATCCCGAAGC-3′, and human TAP2 in the pLNCX2 retroviral vector (Clontech) served as a template for mutagenesis using the primer pair 5′-CGCGGCTGAGCCGCCACCATGCCCGGGGCCCAGGAGAAGG-3′ and 5′-CCTTCTCCTGGGCCCCGGGCATGGTGGCGGCTCAGCCGCG-3′ to generate N-terminally truncated TAP2 (2ΔN). .. Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively. .. Sequencing of each construct was performed prior to retroviral transduction.

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Cleavage reactions were carried out in a total volume of 20 μl and contained 10 μl lysate, 2 μl of 5× cleavage buffer (100 mM HEPES pH 7.5, 500 mM KCl, 25 mM MgCl2 , 5 mM DTT, 25% glycerol) and 300 ng plasmid. .. Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The pcDNA3.1+ vector containing c-Myc-tagged PIWIL2 was constructed in our laboratory as previously described [ ]. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    shRNA:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. The digested fragment was then subcloned between the NcoI site and the XhoI site of the pcDNA3.1+ vector.

    Agarose Gel Electrophoresis:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. When colonies arose after GCR events, single colonies were restreaked onto FOA+Can plates, and genomic DNA was isolated from the survivors using a MasterPure Yeast DNA Isolation kit.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    In Vitro:

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Paragraph title: In vitro cleavage assay ... Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C.

    Ethanol Precipitation:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Produced:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: Retroviral supernatant was produced as previously described with the following modification. .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The S100P mutation is associated with proteasome-mediated degradation that represents a null mutation comparable to the causal Car8 deletion mutation of the waddles mouse.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. AAVCAGsCD59 was generated by insertion of the CAGsCD59pA expression cassette (as employed in the adenovirus construct) into pAAV-MCS (Stratagene) to generate pAAVCAGsCD59 (further cloning details available upon request).

    Immunoprecipitation:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: After the incubation, samples were quickly put on the magnetic block, and the supernatant was transferred to a sterile 1.5 ml eppendorf (referred to as DNAIP ) and was kept at −20°C until analysis. .. To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. These endonucleases have cutting sites within the conserved telomere proximal Y' repeat element releasing a≈1.2 kb and ≈1.0 kb terminal restriction fragment (TRF) respectively, which includes the terminal 0.35 kb TG1-3 repeats .

    DNA Purification:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    End Labeling:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs).

    CTG Assay:

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Lysis:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Cells were washed once with cold PBS and re-suspended and incubated in cold lysis buffer (10 mM Tris, pH 8, 10 mM NaCl, 5 mM MgCl2 , 0.1 mM EGTA, protease inhibitor cocktail and PMSF) for 10 min at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Homologous Recombination:

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xhoi
    Production of joint molecules used to test the branch migration activity of proteins. (A) Joint molecules with a 3′ displaced ssDNA tail are produced by RAD51 using gapped DNA and <t>pBS</t> II K (+) dsDNA linearized with <t>XhoI.</t> (B) Joint molecules with
    Xhoi, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 54 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi/product/New England Biolabs
    Average 99 stars, based on 54 article reviews
    Price from $9.99 to $1999.99
    xhoi - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier


    Image Search Results


    Production of joint molecules used to test the branch migration activity of proteins. (A) Joint molecules with a 3′ displaced ssDNA tail are produced by RAD51 using gapped DNA and pBS II K (+) dsDNA linearized with XhoI. (B) Joint molecules with

    Journal:

    Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

    doi: 10.1016/j.ymeth.2010.02.010

    Figure Lengend Snippet: Production of joint molecules used to test the branch migration activity of proteins. (A) Joint molecules with a 3′ displaced ssDNA tail are produced by RAD51 using gapped DNA and pBS II K (+) dsDNA linearized with XhoI. (B) Joint molecules with

    Article Snippet: Begin by digesting 10 μg of pBS II K (+) plasmid DNA with 40 units of XhoI (NEB) in the presence of 2 units of Shrimp Alkaline Phosphatase (USB) for 1 h at 37°C in a 100 μl volume.

    Techniques: Migration, Activity Assay, Produced

    The scheme used to produce gapped DNA. i) pBS II K (+) plasmid DNA is digested with XhoI and AlwNI. ii) The large DNA fragment from this digest is purified by gel electrophoresis in agarose gels, and then iii) annealed to circular ssDNA to generate gapped

    Journal:

    Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

    doi: 10.1016/j.ymeth.2010.02.010

    Figure Lengend Snippet: The scheme used to produce gapped DNA. i) pBS II K (+) plasmid DNA is digested with XhoI and AlwNI. ii) The large DNA fragment from this digest is purified by gel electrophoresis in agarose gels, and then iii) annealed to circular ssDNA to generate gapped

    Article Snippet: Begin by digesting 10 μg of pBS II K (+) plasmid DNA with 40 units of XhoI (NEB) in the presence of 2 units of Shrimp Alkaline Phosphatase (USB) for 1 h at 37°C in a 100 μl volume.

    Techniques: Plasmid Preparation, Purification, Nucleic Acid Electrophoresis

    Illustration of the 0.8% agarose gel used to purify the large (2065 bp) dsDNA fragment of pBS II K (+) following digestion with XhoI and AlwNI. After electrophoresis, lanes A, C, and E are excised from the gel and stained with ethidium bromide (dashed

    Journal:

    Article Title: Analyzing the Branch Migration Activities of Eukaryotic Proteins

    doi: 10.1016/j.ymeth.2010.02.010

    Figure Lengend Snippet: Illustration of the 0.8% agarose gel used to purify the large (2065 bp) dsDNA fragment of pBS II K (+) following digestion with XhoI and AlwNI. After electrophoresis, lanes A, C, and E are excised from the gel and stained with ethidium bromide (dashed

    Article Snippet: Begin by digesting 10 μg of pBS II K (+) plasmid DNA with 40 units of XhoI (NEB) in the presence of 2 units of Shrimp Alkaline Phosphatase (USB) for 1 h at 37°C in a 100 μl volume.

    Techniques: Agarose Gel Electrophoresis, Electrophoresis, Staining

    Ligation of discontinuities in kinetoplast-associated minicircles. Purified kDNA from 300 min after release from the hydroxyurea block were either treated with E. coli DNA ligase (+) or not (−) prior to digestion with XhoI and alkaline denaturing gel analysis. The gel was transferred and hybridized as in Figure 3 to identify released H and L single strands. Marker lanes: M1, minicircle single strand linears (ssl) and single strand circles (ssc); M2, denatured covalently closed minicircles (dcc) in addition to minicircle single strand linears (ssl) and single strand circles (ssc); M3, molecular weight markers.

    Journal: Nucleic Acids Research

    Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

    doi: 10.1093/nar/gkm1061

    Figure Lengend Snippet: Ligation of discontinuities in kinetoplast-associated minicircles. Purified kDNA from 300 min after release from the hydroxyurea block were either treated with E. coli DNA ligase (+) or not (−) prior to digestion with XhoI and alkaline denaturing gel analysis. The gel was transferred and hybridized as in Figure 3 to identify released H and L single strands. Marker lanes: M1, minicircle single strand linears (ssl) and single strand circles (ssc); M2, denatured covalently closed minicircles (dcc) in addition to minicircle single strand linears (ssl) and single strand circles (ssc); M3, molecular weight markers.

    Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

    Techniques: Ligation, Purification, Blocking Assay, Marker, Droplet Countercurrent Chromatography, Molecular Weight

    Topoisomerase decatenation of XhoI-resistant catenated minicircle molecules. Purified kDNA prepared at 300 min was digested with XhoI and one-half was additionally treated with a type II DNA topoisomerase prior to neutral gel electrophoresis and Southern blotting using a minicircle probe. Catenated minicircles are indicated by a bracket. N/G, nicked or gapped minicircle DNA; L, unit-length linear minicircle DNA; CCC, covalently closed circular minicircle DNA.

    Journal: Nucleic Acids Research

    Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

    doi: 10.1093/nar/gkm1061

    Figure Lengend Snippet: Topoisomerase decatenation of XhoI-resistant catenated minicircle molecules. Purified kDNA prepared at 300 min was digested with XhoI and one-half was additionally treated with a type II DNA topoisomerase prior to neutral gel electrophoresis and Southern blotting using a minicircle probe. Catenated minicircles are indicated by a bracket. N/G, nicked or gapped minicircle DNA; L, unit-length linear minicircle DNA; CCC, covalently closed circular minicircle DNA.

    Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

    Techniques: Purification, Nucleic Acid Electrophoresis, Southern Blot, Countercurrent Chromatography

    ( A ) Physical map of C. fasciculata minicircle DNA ( 36 ). The two-replication origins, oriA and oriB, are located 180° apart on the circular DNA. Specific nicks in nicked circular (form II) minicircles identified in free minicircles replicated in an isolated kinetoplast system define the initiation sites of the leading L strand and the initiation sites of the first H-strand Okazaki fragment at each origin ( 23 ). The nucleotide coordinates are indicated for the specific nicks in the H and L strands. The region from 1041 to 1240 nt has been shown to confer a static bend in the DNA ( 42 ) and is referred to as a bent helix. ( B ) Crithidia fasciculata minicircle replication schematic. Thin line, L strand; thick line, H strand; filled arrowheads, specific nicks; double arrowhead, XhoI site.

    Journal: Nucleic Acids Research

    Article Title: Structure of discontinuities in kinetoplast DNA-associated minicircles during S phase in Crithidia fasciculata

    doi: 10.1093/nar/gkm1061

    Figure Lengend Snippet: ( A ) Physical map of C. fasciculata minicircle DNA ( 36 ). The two-replication origins, oriA and oriB, are located 180° apart on the circular DNA. Specific nicks in nicked circular (form II) minicircles identified in free minicircles replicated in an isolated kinetoplast system define the initiation sites of the leading L strand and the initiation sites of the first H-strand Okazaki fragment at each origin ( 23 ). The nucleotide coordinates are indicated for the specific nicks in the H and L strands. The region from 1041 to 1240 nt has been shown to confer a static bend in the DNA ( 42 ) and is referred to as a bent helix. ( B ) Crithidia fasciculata minicircle replication schematic. Thin line, L strand; thick line, H strand; filled arrowheads, specific nicks; double arrowhead, XhoI site.

    Article Snippet: The remainders of the cell lysates were each ethanol precipitated and resuspended in 200 μl of 0.01 M Tris pH 8, 1 mM EDTA and 22 μl of 10 × NEB 3 buffer followed by digestion for 60 min at 37°C with Mlu I and XhoI restriction enzymes (New England Biolabs) to fragment the DNA.

    Techniques: Isolation

    A, Sub-cloning Results of Optimized tPA sp -PADRE-Truncated ORF2 (aa 112 - 660) Gene Cassette In Pvax1 Eukaryotic Plasmid; Lane M, 1kb DNA marker; Lane 1, pBMH-tPA sp -PADRE-truncated ORF2 plasmid; Lane 2, digested pBMH-tPA sp -PADRE-truncated ORF2 plasmid by NheI restriction enzyme; Lane 3, digested pBMH-tPA sp -PADRE-truncated ORF2 plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2900-bp and a 1795-bp fragment; Lane 4, pVAX plasmid; Lane 5, digested pVAX plasmid by NheI and XhoI restriction enzymes and production of 2909-bp band; Lane 6, pVAX-tPA sp -PADRE-truncated ORF2 plasmid; Lane 7, digested pVAX-tPA sp -PADRE-truncated ORF2 plasmid by the NheI restriction enzyme; Lane 8, digested pVAX-tPA sp -PADRE-truncated ORF2 plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2909-bp and a 1795-bp fragment; Lane 9, 1876-bp band in colony PCR test with T7 and BHG universal primers; B, Restriction Enzyme analyses and colony polymerase chain reaction results of three colonies containing pVAX-tPA sp -PADRE-truncated ORF2 plasmid; Lane M, 1 kb DNA marker; Lane 1, negative control; Lanes 2 - 4, 1876-bp band in colony PCR test; Lanes 5 - 7, digested pVAX-tPA sp -PADRE-truncated ORF2 (aa 112 - 660) -linker plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2909-bp and a 1795-bp fragment

    Journal: Jundishapur Journal of Microbiology

    Article Title: Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

    doi: 10.5812/jjm.26035

    Figure Lengend Snippet: A, Sub-cloning Results of Optimized tPA sp -PADRE-Truncated ORF2 (aa 112 - 660) Gene Cassette In Pvax1 Eukaryotic Plasmid; Lane M, 1kb DNA marker; Lane 1, pBMH-tPA sp -PADRE-truncated ORF2 plasmid; Lane 2, digested pBMH-tPA sp -PADRE-truncated ORF2 plasmid by NheI restriction enzyme; Lane 3, digested pBMH-tPA sp -PADRE-truncated ORF2 plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2900-bp and a 1795-bp fragment; Lane 4, pVAX plasmid; Lane 5, digested pVAX plasmid by NheI and XhoI restriction enzymes and production of 2909-bp band; Lane 6, pVAX-tPA sp -PADRE-truncated ORF2 plasmid; Lane 7, digested pVAX-tPA sp -PADRE-truncated ORF2 plasmid by the NheI restriction enzyme; Lane 8, digested pVAX-tPA sp -PADRE-truncated ORF2 plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2909-bp and a 1795-bp fragment; Lane 9, 1876-bp band in colony PCR test with T7 and BHG universal primers; B, Restriction Enzyme analyses and colony polymerase chain reaction results of three colonies containing pVAX-tPA sp -PADRE-truncated ORF2 plasmid; Lane M, 1 kb DNA marker; Lane 1, negative control; Lanes 2 - 4, 1876-bp band in colony PCR test; Lanes 5 - 7, digested pVAX-tPA sp -PADRE-truncated ORF2 (aa 112 - 660) -linker plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2909-bp and a 1795-bp fragment

    Article Snippet: After cloning of the truncated ORF2 PCR product (without PADRE and tPAsp sequences) in the pVAX1 vector, the recombinant plasmids were detected by colony PCR and restriction enzyme digestion with NheI and XhoI enzymes (New England BioLabs, USA) ( ).

    Techniques: Subcloning, Plasmid Preparation, Marker, Polymerase Chain Reaction, Negative Control

    A, Polymerase Chain Reaction Results of pVAX-Truncated ORF2 (aa 112 - 660) Expression Plasmid (without PADRE and tPA sp sequences); Lane M, 1 kb DNA marker; Lane 1, pVAX-truncated ORF2 (aa 112 - 660) plasmid; Lane 2, digested pVAX-truncated ORF2 (aa 112 - 660) plasmid by NheI restriction enzyme (4596 bp fragment); Lanes 3, digested pVAX-truncated ORF2 (112 - 660) plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2909-bp and a 1693-bp fragment; Lanes 4, PCR product of truncated ORF2 (aa 112-660) gene (without PADRE and tPA sp sequences) with specific primers (1710 bp); Lanes 4, PCR product of tPA sp -PADRE-ORF2 (aa 112 - 660) gene (with PADRE and tPA sp sequences) with T7p and BGH primers (1876 bp); B, Colony Polymerase Chain Reaction Results of Colonies Containing the pVAX-Truncated ORF2 (aa 112 - 660) Expression Recombinant Plasmid; Lane M, 1 kb DNA marker; Lane 1, negative control; Lanes 2 - 9, 1774 bp band of pVAX-truncated ORF2 (aa 112 - 660) plasmid (without PADRE and tPA sp sequences) due to colony PCR assay with T7p and BGH universal primers; Lane 2, 1876 bp band of pVAX-tPA sp -PADRE-ORF2 (aa 112 - 660) plasmid (with PADRE and tPA sp sequences) due to colony PCR assay with T7p and BGH primers as controls

    Journal: Jundishapur Journal of Microbiology

    Article Title: Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

    doi: 10.5812/jjm.26035

    Figure Lengend Snippet: A, Polymerase Chain Reaction Results of pVAX-Truncated ORF2 (aa 112 - 660) Expression Plasmid (without PADRE and tPA sp sequences); Lane M, 1 kb DNA marker; Lane 1, pVAX-truncated ORF2 (aa 112 - 660) plasmid; Lane 2, digested pVAX-truncated ORF2 (aa 112 - 660) plasmid by NheI restriction enzyme (4596 bp fragment); Lanes 3, digested pVAX-truncated ORF2 (112 - 660) plasmid by NheI and XhoI restriction enzymes and production of two expected fragments, a 2909-bp and a 1693-bp fragment; Lanes 4, PCR product of truncated ORF2 (aa 112-660) gene (without PADRE and tPA sp sequences) with specific primers (1710 bp); Lanes 4, PCR product of tPA sp -PADRE-ORF2 (aa 112 - 660) gene (with PADRE and tPA sp sequences) with T7p and BGH primers (1876 bp); B, Colony Polymerase Chain Reaction Results of Colonies Containing the pVAX-Truncated ORF2 (aa 112 - 660) Expression Recombinant Plasmid; Lane M, 1 kb DNA marker; Lane 1, negative control; Lanes 2 - 9, 1774 bp band of pVAX-truncated ORF2 (aa 112 - 660) plasmid (without PADRE and tPA sp sequences) due to colony PCR assay with T7p and BGH universal primers; Lane 2, 1876 bp band of pVAX-tPA sp -PADRE-ORF2 (aa 112 - 660) plasmid (with PADRE and tPA sp sequences) due to colony PCR assay with T7p and BGH primers as controls

    Article Snippet: After cloning of the truncated ORF2 PCR product (without PADRE and tPAsp sequences) in the pVAX1 vector, the recombinant plasmids were detected by colony PCR and restriction enzyme digestion with NheI and XhoI enzymes (New England BioLabs, USA) ( ).

    Techniques: Polymerase Chain Reaction, Expressing, Plasmid Preparation, Marker, Recombinant, Negative Control

    Reconstruction and amplification of rlukS-PV and rlukF-PV from protein expression system. A. Gene map of pET-21d(+)-lukF-PV (Reconstructed using VECTOR NTI software). The insert ( rlukF-PV ) locates within the NcoI and AvaI RDE sites, technically between the T7 promoter and terminator, all confirmed by sequencing. NOTE: The VECTOR NTI prefers the non-specific nuclease (AvaI), which recognises the degenerate sequence (CYCGRG), over the specific XhoI used in the cloning experiments which specifically recognises the sequence (CTCGAG) engineered into the primers used for recombination. B. Amplification of rlukS-PV and rlukF-PV from the expression system. Lane 1, rlukS-PV amplified from expression E. coli BL21(DE3)-pET-21d(+)-lukS-PV; Lane 2, rlukF-PV amplified from expression E. coli BL21(DE3)-pET-21d(+)-lukF-PV; Lane 3, Molecular grade water used as negative PCR control; Lane 4, 100 bp DNA ladder.

    Journal: BMC Biotechnology

    Article Title: Engineering of the LukS-PV and LukF-PV subunits of Staphylococcus aureus Panton-Valentine leukocidin for Diagnostic and Therapeutic Applications

    doi: 10.1186/1472-6750-13-103

    Figure Lengend Snippet: Reconstruction and amplification of rlukS-PV and rlukF-PV from protein expression system. A. Gene map of pET-21d(+)-lukF-PV (Reconstructed using VECTOR NTI software). The insert ( rlukF-PV ) locates within the NcoI and AvaI RDE sites, technically between the T7 promoter and terminator, all confirmed by sequencing. NOTE: The VECTOR NTI prefers the non-specific nuclease (AvaI), which recognises the degenerate sequence (CYCGRG), over the specific XhoI used in the cloning experiments which specifically recognises the sequence (CTCGAG) engineered into the primers used for recombination. B. Amplification of rlukS-PV and rlukF-PV from the expression system. Lane 1, rlukS-PV amplified from expression E. coli BL21(DE3)-pET-21d(+)-lukS-PV; Lane 2, rlukF-PV amplified from expression E. coli BL21(DE3)-pET-21d(+)-lukF-PV; Lane 3, Molecular grade water used as negative PCR control; Lane 4, 100 bp DNA ladder.

    Article Snippet: The double-digest reaction (40 μL) contained 15 uL of the intermediate plasmid miniprep, 4 μL of X10 multicore buffer (promega, UK), 4 μL of X10 Bovine Serum Albumin (Promega, UK) and 0.5 μL of NcoI (NEB, UK) and 0.5 μL of XhoI (NEB, UK).

    Techniques: Amplification, Expressing, Positron Emission Tomography, Plasmid Preparation, Software, Sequencing, Clone Assay, Polymerase Chain Reaction

    Start-up amplification and restriction digests of rlukS-PV and rlukF-PV. A. PCR amplification of rlukS-PV and rlukF-PV from S. aureus MW2 template genomic DNA. Lane L, 100 bp DNA Marker (NEB, UK); Lanes 1 and 2, rlukS-PV, 868 bp; Lane 3, Molecular grade water used as PCR negative control; Lanes 4 and 5 rlukF-PV, 919 bp. B. Double digests ( NcoI and XhoI ) of minipreps of the intermediate host E. coli 5α-pGEMT-Easy-luk-PV to release the insert DNA fragments. Lane 1, Undigested pGEMT-Easy-rlukF-PV; Lane 2, Digested pGEMT-Easy-rlukF-PV showing the cleaved insert rlukF-PV below the 1.0 kb mark; Lane 3, Duplicate of lane 1; Lane 4, Duplicate of lane 2; Lane 5, Undigested pGEMT-Easy-rlukS-PV; Lane 6, Digested pGEMT-Easy-rlukS-PV showing the cleaved insert rlukS-PV, below the 1.0 kb mark; Lane 7, Duplicate of lane 5; Lane 8, Duplicate of lane 6; Lane 9, Undigested pET expression vector; Lane 10, pET vector cut with NcoI and XhoI (the next home of the cleaved insert DNA fragments); Lane 11, Molecular grade water; Lane L, 1 kb DNA Marker (NEB, UK).

    Journal: BMC Biotechnology

    Article Title: Engineering of the LukS-PV and LukF-PV subunits of Staphylococcus aureus Panton-Valentine leukocidin for Diagnostic and Therapeutic Applications

    doi: 10.1186/1472-6750-13-103

    Figure Lengend Snippet: Start-up amplification and restriction digests of rlukS-PV and rlukF-PV. A. PCR amplification of rlukS-PV and rlukF-PV from S. aureus MW2 template genomic DNA. Lane L, 100 bp DNA Marker (NEB, UK); Lanes 1 and 2, rlukS-PV, 868 bp; Lane 3, Molecular grade water used as PCR negative control; Lanes 4 and 5 rlukF-PV, 919 bp. B. Double digests ( NcoI and XhoI ) of minipreps of the intermediate host E. coli 5α-pGEMT-Easy-luk-PV to release the insert DNA fragments. Lane 1, Undigested pGEMT-Easy-rlukF-PV; Lane 2, Digested pGEMT-Easy-rlukF-PV showing the cleaved insert rlukF-PV below the 1.0 kb mark; Lane 3, Duplicate of lane 1; Lane 4, Duplicate of lane 2; Lane 5, Undigested pGEMT-Easy-rlukS-PV; Lane 6, Digested pGEMT-Easy-rlukS-PV showing the cleaved insert rlukS-PV, below the 1.0 kb mark; Lane 7, Duplicate of lane 5; Lane 8, Duplicate of lane 6; Lane 9, Undigested pET expression vector; Lane 10, pET vector cut with NcoI and XhoI (the next home of the cleaved insert DNA fragments); Lane 11, Molecular grade water; Lane L, 1 kb DNA Marker (NEB, UK).

    Article Snippet: The double-digest reaction (40 μL) contained 15 uL of the intermediate plasmid miniprep, 4 μL of X10 multicore buffer (promega, UK), 4 μL of X10 Bovine Serum Albumin (Promega, UK) and 0.5 μL of NcoI (NEB, UK) and 0.5 μL of XhoI (NEB, UK).

    Techniques: Amplification, Polymerase Chain Reaction, Marker, Negative Control, Positron Emission Tomography, Expressing, Plasmid Preparation