xhoi restriction enzymes  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    XhoI
    Description:
    5 C ↓T C G A G 3 3 G A G C T ↑C 5 Thermo Scientific XhoI restriction enzyme recognizes C TCGAG sites and cuts best at 37°C in R buffer See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Isoschizomers PaeR7I Sfr274I SlaI StrI TliI Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    Catalog Number:
    er0693
    Price:
    None
    Applications:
    Cloning|Restriction Enzyme Cloning
    Category:
    Proteins Enzymes Peptides
    Buy from Supplier


    Structured Review

    Thermo Fisher xhoi restriction enzymes
    (A) Digestion on extracted plasmid of one of positive clones with NheI and <t>XhoI</t> confirmed HBsAg fragment insertion in <t>pcDNA</t> vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.
    5 C ↓T C G A G 3 3 G A G C T ↑C 5 Thermo Scientific XhoI restriction enzyme recognizes C TCGAG sites and cuts best at 37°C in R buffer See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Isoschizomers PaeR7I Sfr274I SlaI StrI TliI Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    https://www.bioz.com/result/xhoi restriction enzymes/product/Thermo Fisher
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    xhoi restriction enzymes - by Bioz Stars, 2020-02
    90/100 stars

    Images

    1) Product Images from "Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression"

    Article Title: Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression

    Journal: Research in Pharmaceutical Sciences

    doi: 10.4103/1735-5362.192485

    (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.
    Figure Legend Snippet: (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Techniques Used: Plasmid Preparation, Clone Assay, Recombinant

    2) Product Images from "Cloning, Expression and Purification of Pseudomonas putida ATCC12633 Creatinase"

    Article Title: Cloning, Expression and Purification of Pseudomonas putida ATCC12633 Creatinase

    Journal: Avicenna Journal of Medical Biotechnology

    doi:

    Lane 1: PCR product of Cre gene, lane 2: pET28a-cre plasmid extraction result, lane 3: DNA ladder, lane 4: double digestion of recombinant pET28a-cre by NheI and XhoI. Products were electrophoresed on 0.7% agarose gel.
    Figure Legend Snippet: Lane 1: PCR product of Cre gene, lane 2: pET28a-cre plasmid extraction result, lane 3: DNA ladder, lane 4: double digestion of recombinant pET28a-cre by NheI and XhoI. Products were electrophoresed on 0.7% agarose gel.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Recombinant, Agarose Gel Electrophoresis

    3) Product Images from "Origin of the Putrescine-Producing Ability of the Coagulase-Negative Bacterium Staphylococcus epidermidis 2015B ▿"

    Article Title: Origin of the Putrescine-Producing Ability of the Coagulase-Negative Bacterium Staphylococcus epidermidis 2015B ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00441-10

    (A) Results of enzymatic restriction performed on S. epidermidis 2015B plasmid extraction. Lanes: M1, DNA marker phage λ/HindIII; 1, digestion by AvaI; 2, digestion by XhoI; M2, 100-bp ladder. (B) PCR-based detection of odc gene. Lanes: M2, 100-bp
    Figure Legend Snippet: (A) Results of enzymatic restriction performed on S. epidermidis 2015B plasmid extraction. Lanes: M1, DNA marker phage λ/HindIII; 1, digestion by AvaI; 2, digestion by XhoI; M2, 100-bp ladder. (B) PCR-based detection of odc gene. Lanes: M2, 100-bp

    Techniques Used: Plasmid Preparation, Marker, Polymerase Chain Reaction

    Related Articles

    Clone Assay:

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei
    Article Snippet: P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania). .. The amplified gene was cloned into pTZ57R/T (InsTAclone PCR Cloning Kit; Fermentas), and then subcloned into pTYB2 and transformed into E. coli BL21 (DE3) pLysS cells.

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene). .. SOD1 was cloned in the pBCM vector under control of a T3 promoter.

    Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
    Article Snippet: The product was cloned into pCR 2.1-TOPO®. .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

    Article Title: Heterologous expression, purification and function of the extracellular domain of human RANK
    Article Snippet: A version of RANK-N gene fragment encoding RANK-N was codon optimized (Pichia pastoris ), synthesized and cloned into a pUC57 plasmid (Additional file ). .. The RANK-N fragment was then integrated into pPIC9K that had been digested with Xho I and Not I (Thermo Scientific).

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific. .. Positive clones were screened for and the recombinant plasmid, CYP3A5-pYES2/CT, was extracted.

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: .. The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. To generate mutants in vitro , site-directed mutagenesis was carried out.

    Article Title: Genetic polymorphism of the Nrf2 promoter region is associated with vitiligo risk in Han Chinese populations
    Article Snippet: Construction of reporter plasmids Nrf2 promoter‐luciferase reporter plasmids containing either rs35652124 T or C sequences were prepared by amplifying the 731 bp promoter region (from −738 to −7) using the primers 5′‐CCGCTCGAG ACCACTCTCCGACCTAAAGG‐3′ (forward) and 5′‐CCGAAGCTTCGTCGGCGGCTCCTCCGGGCTC‐3′ (reverse) that included Xho I and Hind III (both from Cnservice Invitrogen, Shanghai, China) restriction sites. .. The fragments were cloned into the pGL3‐basic vector (Promega, Madison, WI, USA) after both were cut with Xho I and Hind III enzymes.

    Article Title: A Polymorphism rs12325489C > T in the LincRNA-ENST00000515084 Exon Was Found to Modulate Breast Cancer Risk via GWAS-Based Association Analyses
    Article Snippet: .. Construction of Reporter Plasmids C-allelic reporter constructs were prepared by amplifying the lincRNA exonic region spanning the 258 bp flanking the rs12325489 polymorphism from subjects homozygous for the C allele (rs12325489CC) with the forward primer 5′-CCGCTCGAGCCATTGGTAAGAAGCA-3′ and the reverse primer 5′-ATTTGCGGCCGCCTTTGAATAGGGAAGAAC-3′ , which included Xho I and Not I (Fermentas, Hanover, MD, USA) restriction enzyme sites, and cloning these fragments into psiCHECK-2 (Promega, Madison, WI, USA). .. A Quick Change XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to obtain rs12325489T reporter constructs from the psiCHECK-2-rs12325489C constructs by site-directed mutagenesis as described previously .

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The mouse NFAT5 3'-UTR were amplified, double-digested with Pme I and Xho I, and then cloned into the pmirGLO vector (Promega, USA).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: Paragraph title: Cloning and expression of SFTSV/NSs ... The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes.

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: .. The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. After amplification and DNA sequence confirmation, this vector was designated as pcDNA3.1-IL-18 and used for the overexpression of IL-18 in TSCC cells. pcDNA3.1 and pCDNA3.1-IL-18 plasmids were separately transfected into CRL-1623 cells using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturer’s instructions, and stable cell lines were selected with 650 μg/ml G418 (Invitrogen Life Technologies).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The mouse NFAT5 3'-UTR were amplified, double-digested with Pme I and Xho I, and then cloned into the pmirGLO vector (Promega, USA).

    Amplification:

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei
    Article Snippet: .. P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania). .. The reaction was performed using 10 ng DNA, 2 μL (10 μM) of each primer, 5 μL (10mM) dNTPs, 5 μL 10× PCR buffer [100mM Tris-HCl (pH 8.9), 500mM KCl, 20mM MgCl2 , 1% Triton X-100] and High-fidelity PCR Enzyme Mix (Fermentas).

    Article Title: A Polymorphism rs12325489C > T in the LincRNA-ENST00000515084 Exon Was Found to Modulate Breast Cancer Risk via GWAS-Based Association Analyses
    Article Snippet: Construction of Reporter Plasmids C-allelic reporter constructs were prepared by amplifying the lincRNA exonic region spanning the 258 bp flanking the rs12325489 polymorphism from subjects homozygous for the C allele (rs12325489CC) with the forward primer 5′-CCGCTCGAGCCATTGGTAAGAAGCA-3′ and the reverse primer 5′-ATTTGCGGCCGCCTTTGAATAGGGAAGAAC-3′ , which included Xho I and Not I (Fermentas, Hanover, MD, USA) restriction enzyme sites, and cloning these fragments into psiCHECK-2 (Promega, Madison, WI, USA). .. The amplified exonic regions including the rs12325489C > T polymorphism were inserted into the Xho I and Not I enzyme sites of the 3′-UTR of the Renilla luciferase gene in the vector psiCHECK-2.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The mouse NFAT5 3'-UTR were amplified, double-digested with Pme I and Xho I, and then cloned into the pmirGLO vector (Promega, USA).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The amplified products were identified on a 2% ethidium bromide-stained agarose gel and recovered using the TIANgel Midi Purification Kit [Tiangen Biotech (Beijing) Co., Ltd.]. .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes.

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: Construction of an expression vector carrying human IL-18 cDNA and gene transfection ( ) Human IL-18 cDNA was cloned and amplified from leukocytes (from one healthy donor including the entire coding sequence of IL-18; NM-001562.2). .. The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The mouse NFAT5 3'-UTR were amplified, double-digested with Pme I and Xho I, and then cloned into the pmirGLO vector (Promega, USA).

    Stable Transfection:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. After amplification and DNA sequence confirmation, this vector was designated as pcDNA3.1-IL-18 and used for the overexpression of IL-18 in TSCC cells. pcDNA3.1 and pCDNA3.1-IL-18 plasmids were separately transfected into CRL-1623 cells using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturer’s instructions, and stable cell lines were selected with 650 μg/ml G418 (Invitrogen Life Technologies).

    Synthesized:

    Article Title: Heterologous expression, purification and function of the extracellular domain of human RANK
    Article Snippet: A version of RANK-N gene fragment encoding RANK-N was codon optimized (Pichia pastoris ), synthesized and cloned into a pUC57 plasmid (Additional file ). .. The RANK-N fragment was then integrated into pPIC9K that had been digested with Xho I and Not I (Thermo Scientific).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The first-strand cDNA was synthesized using the SuperScript® III First-Strand Synthesis System (Invitrogen™) according to the manufacturer's instructions. .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes.

    Construct:

    Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
    Article Snippet: The Construction of Recombinant Plasmid pcDNA3.1(+)/mBD1-mBD3 The overlap-PCR product was cleaved by Eco R I and Xho I (Fermentas Co. Ltd, Shenzhen, China), and the mBD1-mBD3 fragment was inserted into similarly digested pcDNA3.1(+) (Invitrogen, Shanghai, China) vector with T4 DNA ligase (Fermentas Co. Ltd, Shenzhen, China) at 16 °C to construct the expression plasmid named pcDNA3.1(+)/mBD1-mBD3 . .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific. .. CYP3A5*4 and CYP3A5*6 mutational expression vectors were constructed using site-specific mutagenesis of the wild type CYP3A5- pYES2/CT gene ( ).

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: Paragraph title: TIE2 expression constructs ... The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA).

    Article Title: A Polymorphism rs12325489C > T in the LincRNA-ENST00000515084 Exon Was Found to Modulate Breast Cancer Risk via GWAS-Based Association Analyses
    Article Snippet: .. Construction of Reporter Plasmids C-allelic reporter constructs were prepared by amplifying the lincRNA exonic region spanning the 258 bp flanking the rs12325489 polymorphism from subjects homozygous for the C allele (rs12325489CC) with the forward primer 5′-CCGCTCGAGCCATTGGTAAGAAGCA-3′ and the reverse primer 5′-ATTTGCGGCCGCCTTTGAATAGGGAAGAAC-3′ , which included Xho I and Not I (Fermentas, Hanover, MD, USA) restriction enzyme sites, and cloning these fragments into psiCHECK-2 (Promega, Madison, WI, USA). .. A Quick Change XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to obtain rs12325489T reporter constructs from the psiCHECK-2-rs12325489C constructs by site-directed mutagenesis as described previously .

    Electrophoresis:

    Article Title: Bacterial Contig Map of the 21q11 Region Associated with Alzheimer's Disease and Abnormal Myelopoiesis in Down Syndrome
    Article Snippet: PAC DNA (0.50–1 μg) was digested at 37°C with one or a combination of the following restriction enzymes, Not I, Sal I (NEB), Xho I (Life Technologies). .. Electrophoresis conditions were as follows: For the 4- to 200-kb window, 5.2 V/cm, 14 hr, switch time 3–15 sec; for the 100- to 1600-kb window, 6 V/cm, 22 hr, switch time 40–80 sec. DNA size markers used (see Fig. , from left to right) were Lambda ladder (Bio-Rad), high molecular weight DNA markers (Life Technologies), 1-kb DNA ladder (Life Technologies).

    Incubation:

    Article Title: Construction of fat1 Gene Expression Vector and Its Catalysis Efficiency in Bovine Fetal Fibroblast Cells
    Article Snippet: .. The eukaryotic expression vector pEF-GFP was double digested with Xho I and Mls I (Fermentas, Ontario, Canada) in a 10 μl reaction system: Xho I 0.75 μl, Mls I 0.75 μl, Tango buffer 2 μl, pEF-GFP plasmid 2 μl, Nuclease-free water 4.5 μl, and incubated at 37°C 5 h. Codon optimization fat1 was also double digested, with Xho I and Sma I (Fermentas, Ontario, Canada) from the pUC vector in a 10 μl reaction system: Xho I 0.75 μl, Sma I 0.75 μl, T buffer 2 μl, fat1 4 μl, Nuclease-free water 2.5 μl, 37°C 5 h. Recovered and ligated by T4 DNA Ligase (Fermentas, Ontario, Canada): T4 DNA Ligase Buffer 2.5 μl, pEF-GFP vector 2.5 μl, fat1 5 μl, T4 DNA Ligase 5 U, PEG 4000 Solution 2 μl, Nuclease-free water 12 μl and incubated at 4°C overnight. .. Transformed into competent E. coli (DH5α) cells (Tiangen, Beijing, China), and then prepared the pEF-GFP-fat1 plasmid.

    Luciferase:

    Article Title: A Polymorphism rs12325489C > T in the LincRNA-ENST00000515084 Exon Was Found to Modulate Breast Cancer Risk via GWAS-Based Association Analyses
    Article Snippet: Construction of Reporter Plasmids C-allelic reporter constructs were prepared by amplifying the lincRNA exonic region spanning the 258 bp flanking the rs12325489 polymorphism from subjects homozygous for the C allele (rs12325489CC) with the forward primer 5′-CCGCTCGAGCCATTGGTAAGAAGCA-3′ and the reverse primer 5′-ATTTGCGGCCGCCTTTGAATAGGGAAGAAC-3′ , which included Xho I and Not I (Fermentas, Hanover, MD, USA) restriction enzyme sites, and cloning these fragments into psiCHECK-2 (Promega, Madison, WI, USA). .. The amplified exonic regions including the rs12325489C > T polymorphism were inserted into the Xho I and Not I enzyme sites of the 3′-UTR of the Renilla luciferase gene in the vector psiCHECK-2.

    Expressing:

    Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
    Article Snippet: The Construction of Recombinant Plasmid pcDNA3.1(+)/mBD1-mBD3 The overlap-PCR product was cleaved by Eco R I and Xho I (Fermentas Co. Ltd, Shenzhen, China), and the mBD1-mBD3 fragment was inserted into similarly digested pcDNA3.1(+) (Invitrogen, Shanghai, China) vector with T4 DNA ligase (Fermentas Co. Ltd, Shenzhen, China) at 16 °C to construct the expression plasmid named pcDNA3.1(+)/mBD1-mBD3 . .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei
    Article Snippet: Paragraph title: Construction of expression plasmid ... P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania).

    Article Title: Heterologous expression, purification and function of the extracellular domain of human RANK
    Article Snippet: Paragraph title: Construction of expression vector pPIC9K/RANK-N ... The RANK-N fragment was then integrated into pPIC9K that had been digested with Xho I and Not I (Thermo Scientific).

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: Paragraph title: Construction of CYP3A5 gene polymorphism expression vectors ... Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: .. The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. To generate mutants in vitro , site-directed mutagenesis was carried out.

    Article Title: Construction of fat1 Gene Expression Vector and Its Catalysis Efficiency in Bovine Fetal Fibroblast Cells
    Article Snippet: .. The eukaryotic expression vector pEF-GFP was double digested with Xho I and Mls I (Fermentas, Ontario, Canada) in a 10 μl reaction system: Xho I 0.75 μl, Mls I 0.75 μl, Tango buffer 2 μl, pEF-GFP plasmid 2 μl, Nuclease-free water 4.5 μl, and incubated at 37°C 5 h. Codon optimization fat1 was also double digested, with Xho I and Sma I (Fermentas, Ontario, Canada) from the pUC vector in a 10 μl reaction system: Xho I 0.75 μl, Sma I 0.75 μl, T buffer 2 μl, fat1 4 μl, Nuclease-free water 2.5 μl, 37°C 5 h. Recovered and ligated by T4 DNA Ligase (Fermentas, Ontario, Canada): T4 DNA Ligase Buffer 2.5 μl, pEF-GFP vector 2.5 μl, fat1 5 μl, T4 DNA Ligase 5 U, PEG 4000 Solution 2 μl, Nuclease-free water 12 μl and incubated at 4°C overnight. .. Transformed into competent E. coli (DH5α) cells (Tiangen, Beijing, China), and then prepared the pEF-GFP-fat1 plasmid.

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: Paragraph title: Cloning and expression of SFTSV/NSs ... The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes.

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: Paragraph title: Construction of an expression vector carrying human IL-18 cDNA and gene transfection ... The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies).

    Modification:

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: The human liver cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen, Thermo Fisher Scientific, Inc.) supplemented with 20% fetal bovine serum at a temperature of 37°C in an environment containing 5% CO2 . .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Western Blot:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. IL-18 transgene expression and its function were confirmed by quantitative reverse transcription-PCR (RT-qPCR), western blot analysis, and immunofluorescence analyses.

    Transformation Assay:

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei
    Article Snippet: P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania). .. The amplified gene was cloned into pTZ57R/T (InsTAclone PCR Cloning Kit; Fermentas), and then subcloned into pTYB2 and transformed into E. coli BL21 (DE3) pLysS cells.

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: The resulting pMD18-T-CYP3A5 plasmid was transformed into E. coli JM109 (Auragene Bioscience Corporation Inc, Changsha, China). .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Article Title: Construction of fat1 Gene Expression Vector and Its Catalysis Efficiency in Bovine Fetal Fibroblast Cells
    Article Snippet: The eukaryotic expression vector pEF-GFP was double digested with Xho I and Mls I (Fermentas, Ontario, Canada) in a 10 μl reaction system: Xho I 0.75 μl, Mls I 0.75 μl, Tango buffer 2 μl, pEF-GFP plasmid 2 μl, Nuclease-free water 4.5 μl, and incubated at 37°C 5 h. Codon optimization fat1 was also double digested, with Xho I and Sma I (Fermentas, Ontario, Canada) from the pUC vector in a 10 μl reaction system: Xho I 0.75 μl, Sma I 0.75 μl, T buffer 2 μl, fat1 4 μl, Nuclease-free water 2.5 μl, 37°C 5 h. Recovered and ligated by T4 DNA Ligase (Fermentas, Ontario, Canada): T4 DNA Ligase Buffer 2.5 μl, pEF-GFP vector 2.5 μl, fat1 5 μl, T4 DNA Ligase 5 U, PEG 4000 Solution 2 μl, Nuclease-free water 12 μl and incubated at 4°C overnight. .. Transformed into competent E. coli (DH5α) cells (Tiangen, Beijing, China), and then prepared the pEF-GFP-fat1 plasmid.

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. After ligation reaction using T4 DNA Ligase (Thermo Fisher Scientific, Inc.), the reaction mixture containing the rSFTSV/NSs-pET28a (+) plasmid was transformed into the competent cells Escherichia coli BL21 (DE3) (Novagen).

    Over Expression:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. After amplification and DNA sequence confirmation, this vector was designated as pcDNA3.1-IL-18 and used for the overexpression of IL-18 in TSCC cells. pcDNA3.1 and pCDNA3.1-IL-18 plasmids were separately transfected into CRL-1623 cells using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturer’s instructions, and stable cell lines were selected with 650 μg/ml G418 (Invitrogen Life Technologies).

    Transfection:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: Paragraph title: Construction of an expression vector carrying human IL-18 cDNA and gene transfection ... The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies).

    Ligation:

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. After ligation reaction using T4 DNA Ligase (Thermo Fisher Scientific, Inc.), the reaction mixture containing the rSFTSV/NSs-pET28a (+) plasmid was transformed into the competent cells Escherichia coli BL21 (DE3) (Novagen).

    Cell Culture:

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: The E. coli strains carrying the recombinant pMD18-T-CYP3A5 plasmid were cultured on LB agar supplemented with 50 µg/ml ampicillin at 37°C overnight. .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Generated:

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: The plasmids encoding ELP3 SAM (C109/112S) and ELP3 HAT (Y529A) were generated from the human ELP3-FLAG plasmid with QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). .. To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene).

    Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
    Article Snippet: PCR products were generated using primer pairs 5 and 6 with Taq polymerase. .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The binding site mutants were generated using a MutanBEST Kit (TaKaRa, China) and mutagenic primers.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The binding site mutants were generated using a MutanBEST Kit (TaKaRa, China) and mutagenic primers.

    DNA Sequencing:

    Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
    Article Snippet: The chromosomal deletion was confirmed by DNA sequencing of PCR products using primer 7 and 8 ( ). .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

    Sequencing:

    Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
    Article Snippet: .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China). .. Screening of Stable Expression MDCK Stains Transfected with pcDNA3.1(+)/mBD1-mBD3 The final concentration of MDCK cells were adjusted to 2 × 105 –5 × 105 /mL with DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% bovine serum, 100 U/mL penicillin and 100 µg/mL streptomycin.

    Article Title: Heterologous expression, purification and function of the extracellular domain of human RANK
    Article Snippet: The RANK-N fragment was then integrated into pPIC9K that had been digested with Xho I and Not I (Thermo Scientific). .. The presence of pPIC9k/RANK-N in successful recombinant colonies was confirmed by gene sequencing.

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: .. The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. To generate mutants in vitro , site-directed mutagenesis was carried out.

    Article Title: Construction of fat1 Gene Expression Vector and Its Catalysis Efficiency in Bovine Fetal Fibroblast Cells
    Article Snippet: An enhanced green fluorescent protein (eGFP) gene was used for transient expression in cells regulated by IRES sequence, a neo-kan and amp expression cassette served as a selection marker ( ). .. The eukaryotic expression vector pEF-GFP was double digested with Xho I and Mls I (Fermentas, Ontario, Canada) in a 10 μl reaction system: Xho I 0.75 μl, Mls I 0.75 μl, Tango buffer 2 μl, pEF-GFP plasmid 2 μl, Nuclease-free water 4.5 μl, and incubated at 37°C 5 h. Codon optimization fat1 was also double digested, with Xho I and Sma I (Fermentas, Ontario, Canada) from the pUC vector in a 10 μl reaction system: Xho I 0.75 μl, Sma I 0.75 μl, T buffer 2 μl, fat1 4 μl, Nuclease-free water 2.5 μl, 37°C 5 h. Recovered and ligated by T4 DNA Ligase (Fermentas, Ontario, Canada): T4 DNA Ligase Buffer 2.5 μl, pEF-GFP vector 2.5 μl, fat1 5 μl, T4 DNA Ligase 5 U, PEG 4000 Solution 2 μl, Nuclease-free water 12 μl and incubated at 4°C overnight.

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: Construction of an expression vector carrying human IL-18 cDNA and gene transfection ( ) Human IL-18 cDNA was cloned and amplified from leukocytes (from one healthy donor including the entire coding sequence of IL-18; NM-001562.2). .. The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies).

    Recombinant:

    Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
    Article Snippet: Paragraph title: 2.2. The Construction of Recombinant Plasmid pcDNA3.1(+)/mBD1-mBD3 ... The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

    Article Title: Heterologous expression, purification and function of the extracellular domain of human RANK
    Article Snippet: The RANK-N fragment was then integrated into pPIC9K that had been digested with Xho I and Not I (Thermo Scientific). .. The presence of pPIC9k/RANK-N in successful recombinant colonies was confirmed by gene sequencing.

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: The E. coli strains carrying the recombinant pMD18-T-CYP3A5 plasmid were cultured on LB agar supplemented with 50 µg/ml ampicillin at 37°C overnight. .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: Then the recombinant plasmids were double-digested with Nhe I and Hin dIII (Thermo) and ligated into the pGL3 -Basic vector (Promega). .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. The expression of recombinant protein SFTSV/NSs was induced at 37°C by the addition of 1 mM isopropyl- β -thiogalactopyranoside into the culture medium when its OD600 reached ∼0.6, and then the mixture was shaken at 250 rpm and 37°C for further 4 h. Bacteria cells were collected, the expression pattern of the target rSFTSV/NSs protein was determined with 6× His tag by SDS-PAGE, and the rSFTSV/NSs protein was finally isolated and purified by Ni2+ -NTA agarose affinity using the Ni-NTA Sefinose™ Kit (Bio Basic, Inc.) according to the manufacturer's instructions ( ).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: Then the recombinant plasmids were double-digested with Nhe I and Hin dIII (Thermo) and ligated into the pGL3 -Basic vector (Promega). .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA).

    Immunofluorescence:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. IL-18 transgene expression and its function were confirmed by quantitative reverse transcription-PCR (RT-qPCR), western blot analysis, and immunofluorescence analyses.

    Molecular Weight:

    Article Title: Bacterial Contig Map of the 21q11 Region Associated with Alzheimer's Disease and Abnormal Myelopoiesis in Down Syndrome
    Article Snippet: PAC DNA (0.50–1 μg) was digested at 37°C with one or a combination of the following restriction enzymes, Not I, Sal I (NEB), Xho I (Life Technologies). .. Electrophoresis conditions were as follows: For the 4- to 200-kb window, 5.2 V/cm, 14 hr, switch time 3–15 sec; for the 100- to 1600-kb window, 6 V/cm, 22 hr, switch time 40–80 sec. DNA size markers used (see Fig. , from left to right) were Lambda ladder (Bio-Rad), high molecular weight DNA markers (Life Technologies), 1-kb DNA ladder (Life Technologies).

    Marker:

    Article Title: Construction of fat1 Gene Expression Vector and Its Catalysis Efficiency in Bovine Fetal Fibroblast Cells
    Article Snippet: An enhanced green fluorescent protein (eGFP) gene was used for transient expression in cells regulated by IRES sequence, a neo-kan and amp expression cassette served as a selection marker ( ). .. The eukaryotic expression vector pEF-GFP was double digested with Xho I and Mls I (Fermentas, Ontario, Canada) in a 10 μl reaction system: Xho I 0.75 μl, Mls I 0.75 μl, Tango buffer 2 μl, pEF-GFP plasmid 2 μl, Nuclease-free water 4.5 μl, and incubated at 37°C 5 h. Codon optimization fat1 was also double digested, with Xho I and Sma I (Fermentas, Ontario, Canada) from the pUC vector in a 10 μl reaction system: Xho I 0.75 μl, Sma I 0.75 μl, T buffer 2 μl, fat1 4 μl, Nuclease-free water 2.5 μl, 37°C 5 h. Recovered and ligated by T4 DNA Ligase (Fermentas, Ontario, Canada): T4 DNA Ligase Buffer 2.5 μl, pEF-GFP vector 2.5 μl, fat1 5 μl, T4 DNA Ligase 5 U, PEG 4000 Solution 2 μl, Nuclease-free water 12 μl and incubated at 4°C overnight.

    Mutagenesis:

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: The plasmids encoding ELP3 SAM (C109/112S) and ELP3 HAT (Y529A) were generated from the human ELP3-FLAG plasmid with QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). .. To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene).

    Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
    Article Snippet: Finally, pCS3 was electroporated into the resulting double mutant to generate the isogenic triple mutant (Δlmo0515 Δlmo1580 Δlmo2673 ). .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific. .. CYP3A5*4 and CYP3A5*6 mutational expression vectors were constructed using site-specific mutagenesis of the wild type CYP3A5- pYES2/CT gene ( ).

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. To generate mutants in vitro , site-directed mutagenesis was carried out.

    Article Title: A Polymorphism rs12325489C > T in the LincRNA-ENST00000515084 Exon Was Found to Modulate Breast Cancer Risk via GWAS-Based Association Analyses
    Article Snippet: Construction of Reporter Plasmids C-allelic reporter constructs were prepared by amplifying the lincRNA exonic region spanning the 258 bp flanking the rs12325489 polymorphism from subjects homozygous for the C allele (rs12325489CC) with the forward primer 5′-CCGCTCGAGCCATTGGTAAGAAGCA-3′ and the reverse primer 5′-ATTTGCGGCCGCCTTTGAATAGGGAAGAAC-3′ , which included Xho I and Not I (Fermentas, Hanover, MD, USA) restriction enzyme sites, and cloning these fragments into psiCHECK-2 (Promega, Madison, WI, USA). .. A Quick Change XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) was used to obtain rs12325489T reporter constructs from the psiCHECK-2-rs12325489C constructs by site-directed mutagenesis as described previously .

    Isolation:

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. The expression of recombinant protein SFTSV/NSs was induced at 37°C by the addition of 1 mM isopropyl- β -thiogalactopyranoside into the culture medium when its OD600 reached ∼0.6, and then the mixture was shaken at 250 rpm and 37°C for further 4 h. Bacteria cells were collected, the expression pattern of the target rSFTSV/NSs protein was determined with 6× His tag by SDS-PAGE, and the rSFTSV/NSs protein was finally isolated and purified by Ni2+ -NTA agarose affinity using the Ni-NTA Sefinose™ Kit (Bio Basic, Inc.) according to the manufacturer's instructions ( ).

    Size-exclusion Chromatography:

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The thermal cycling conditions were as follows: an initial denaturation at 94°C for 5 min followed by 15 cycles at 94°C for 30 sec, 56°C for 30 sec, and 72°C for 1.5 min, and further 30 cycles at 94°C for 30 sec, 68°C for 30 sec, and 72°C for 1.5 min with a final extension at 72°C for 10 min, which was performed on an Applied Biosystems GeneAmp PCR System 9700. .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes.

    Article Title: Bacterial Contig Map of the 21q11 Region Associated with Alzheimer's Disease and Abnormal Myelopoiesis in Down Syndrome
    Article Snippet: PAC DNA (0.50–1 μg) was digested at 37°C with one or a combination of the following restriction enzymes, Not I, Sal I (NEB), Xho I (Life Technologies). .. Electrophoresis conditions were as follows: For the 4- to 200-kb window, 5.2 V/cm, 14 hr, switch time 3–15 sec; for the 100- to 1600-kb window, 6 V/cm, 22 hr, switch time 40–80 sec. DNA size markers used (see Fig. , from left to right) were Lambda ladder (Bio-Rad), high molecular weight DNA markers (Life Technologies), 1-kb DNA ladder (Life Technologies).

    Purification:

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: PCR products of the cDNA fragments ( ) were purified and ligated into the pMD18-T simple vector (Invitrogen; Thermo Fisher Scientific, Inc.). .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: The purified PCR products were cloned into the pMD18-T vector (TaKaRa, China). .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. After ligation reaction using T4 DNA Ligase (Thermo Fisher Scientific, Inc.), the reaction mixture containing the rSFTSV/NSs-pET28a (+) plasmid was transformed into the competent cells Escherichia coli BL21 (DE3) (Novagen).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: The purified PCR products were cloned into the pMD18-T vector (TaKaRa, China). .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA).

    Polymerase Chain Reaction:

    Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
    Article Snippet: .. The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China). .. Screening of Stable Expression MDCK Stains Transfected with pcDNA3.1(+)/mBD1-mBD3 The final concentration of MDCK cells were adjusted to 2 × 105 –5 × 105 /mL with DMEM (Gibco, Grand Island, NY, USA) supplemented with 10% bovine serum, 100 U/mL penicillin and 100 µg/mL streptomycin.

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei
    Article Snippet: .. P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania). .. The reaction was performed using 10 ng DNA, 2 μL (10 μM) of each primer, 5 μL (10mM) dNTPs, 5 μL 10× PCR buffer [100mM Tris-HCl (pH 8.9), 500mM KCl, 20mM MgCl2 , 1% Triton X-100] and High-fidelity PCR Enzyme Mix (Fermentas).

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene). .. To generate the AAV: ELP3-FLAG transfer plasmid, the human ELP3-FLAG plasmid was PCR-amplified with the primers 5′ CGTGCTCTAGAATGAGGCAGAAGCGGAAAGGAG and 5′ GGTACGTGACTAGTGCCGGCCGTTTAAACCTTATCG and the resulting product ligated into Xba I/Spe I (Thermo) digested AAV transfer plasmid (pZac 2.1 eGFP3 SEED).

    Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
    Article Snippet: .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively. ..

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: PCR products of the cDNA fragments ( ) were purified and ligated into the pMD18-T simple vector (Invitrogen; Thermo Fisher Scientific, Inc.). .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. Briefly, a region of wild-type TIE2 (up to 1 kb, flanked by unique restriction sites) surrounding the mutation was cloned into the pCR-II TOPO vector (Invitrogen).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: The purified PCR products were cloned into the pMD18-T vector (TaKaRa, China). .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. After ligation reaction using T4 DNA Ligase (Thermo Fisher Scientific, Inc.), the reaction mixture containing the rSFTSV/NSs-pET28a (+) plasmid was transformed into the competent cells Escherichia coli BL21 (DE3) (Novagen).

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The polymerase chain reaction (PCR) primers were: forward, 5′-GGG GTA CCA TGG CTG CTG AAC CAG TAG AAG-3′ and reverse, 5′-CCG CTC GAG AGC TAG TCT TCG TTT TGA ACA GTG-3′ with the restriction enzymes Kpn I and Xho I link. .. The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: The purified PCR products were cloned into the pMD18-T vector (TaKaRa, China). .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA).

    Positron Emission Tomography:

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. After ligation reaction using T4 DNA Ligase (Thermo Fisher Scientific, Inc.), the reaction mixture containing the rSFTSV/NSs-pET28a (+) plasmid was transformed into the competent cells Escherichia coli BL21 (DE3) (Novagen).

    Quantitative RT-PCR:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. IL-18 transgene expression and its function were confirmed by quantitative reverse transcription-PCR (RT-qPCR), western blot analysis, and immunofluorescence analyses.

    SDS Page:

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. The expression of recombinant protein SFTSV/NSs was induced at 37°C by the addition of 1 mM isopropyl- β -thiogalactopyranoside into the culture medium when its OD600 reached ∼0.6, and then the mixture was shaken at 250 rpm and 37°C for further 4 h. Bacteria cells were collected, the expression pattern of the target rSFTSV/NSs protein was determined with 6× His tag by SDS-PAGE, and the rSFTSV/NSs protein was finally isolated and purified by Ni2+ -NTA agarose affinity using the Ni-NTA Sefinose™ Kit (Bio Basic, Inc.) according to the manufacturer's instructions ( ).

    Plasmid Preparation:

    Article Title: Construction of Eukaryotic Expression Vector with mBD1-mBD3 Fusion Genes and Exploring Its Activity against Influenza A Virus
    Article Snippet: Paragraph title: 2.2. The Construction of Recombinant Plasmid pcDNA3.1(+)/mBD1-mBD3 ... The inserted sequences were confirmed by PCR, restriction enzyme digestion analysis with Eco R I and Xho I and sequencing using the ABI 377 DNA Analyzer (Invitrogen, Shanghai, China).

    Article Title: Cloning, Expression, and Purification of Hyperthermophile α-Amylase from Pyrococcus woesei
    Article Snippet: Paragraph title: Construction of expression plasmid ... P. woesei chromosomal DNA was used as a source of the α-amylase gene and polymerase chain reaction (PCR) amplification was done with the following primers: 5′- GCTAGC TTGGAGCTTGAAGAGGGAG-3′ and 5′- GAGACC ACAATAACTCCATACGGAG-3′ containing recognition sites for restriction endonucleases Nhe I and Xho I (Fermentas; Vilnius, Lithuania).

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: .. To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene). .. To generate the AAV: ELP3-FLAG transfer plasmid, the human ELP3-FLAG plasmid was PCR-amplified with the primers 5′ CGTGCTCTAGAATGAGGCAGAAGCGGAAAGGAG and 5′ GGTACGTGACTAGTGCCGGCCGTTTAAACCTTATCG and the resulting product ligated into Xba I/Spe I (Thermo) digested AAV transfer plasmid (pZac 2.1 eGFP3 SEED).

    Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
    Article Snippet: .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively. ..

    Article Title: Heterologous expression, purification and function of the extracellular domain of human RANK
    Article Snippet: Paragraph title: Construction of expression vector pPIC9K/RANK-N ... The RANK-N fragment was then integrated into pPIC9K that had been digested with Xho I and Not I (Thermo Scientific).

    Article Title: Construction and verification of CYP3A5 gene polymorphisms using a Saccharomyces cerevisiae expression system to predict drug metabolism
    Article Snippet: The E. coli strains carrying the recombinant pMD18-T-CYP3A5 plasmid were cultured on LB agar supplemented with 50 µg/ml ampicillin at 37°C overnight. .. Plasmids were double-enzyme digested with Hind III and Xho I (Thermo Fisher Scientific.

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: .. The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. To generate mutants in vitro , site-directed mutagenesis was carried out.

    Article Title: Genetic polymorphism of the Nrf2 promoter region is associated with vitiligo risk in Han Chinese populations
    Article Snippet: Construction of reporter plasmids Nrf2 promoter‐luciferase reporter plasmids containing either rs35652124 T or C sequences were prepared by amplifying the 731 bp promoter region (from −738 to −7) using the primers 5′‐CCGCTCGAG ACCACTCTCCGACCTAAAGG‐3′ (forward) and 5′‐CCGAAGCTTCGTCGGCGGCTCCTCCGGGCTC‐3′ (reverse) that included Xho I and Hind III (both from Cnservice Invitrogen, Shanghai, China) restriction sites. .. The fragments were cloned into the pGL3‐basic vector (Promega, Madison, WI, USA) after both were cut with Xho I and Hind III enzymes.

    Article Title: A Polymorphism rs12325489C > T in the LincRNA-ENST00000515084 Exon Was Found to Modulate Breast Cancer Risk via GWAS-Based Association Analyses
    Article Snippet: Construction of Reporter Plasmids C-allelic reporter constructs were prepared by amplifying the lincRNA exonic region spanning the 258 bp flanking the rs12325489 polymorphism from subjects homozygous for the C allele (rs12325489CC) with the forward primer 5′-CCGCTCGAGCCATTGGTAAGAAGCA-3′ and the reverse primer 5′-ATTTGCGGCCGCCTTTGAATAGGGAAGAAC-3′ , which included Xho I and Not I (Fermentas, Hanover, MD, USA) restriction enzyme sites, and cloning these fragments into psiCHECK-2 (Promega, Madison, WI, USA). .. The amplified exonic regions including the rs12325489C > T polymorphism were inserted into the Xho I and Not I enzyme sites of the 3′-UTR of the Renilla luciferase gene in the vector psiCHECK-2.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The mouse NFAT5 3'-UTR were amplified, double-digested with Pme I and Xho I, and then cloned into the pmirGLO vector (Promega, USA).

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. After ligation reaction using T4 DNA Ligase (Thermo Fisher Scientific, Inc.), the reaction mixture containing the rSFTSV/NSs-pET28a (+) plasmid was transformed into the competent cells Escherichia coli BL21 (DE3) (Novagen).

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: .. The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies). .. After amplification and DNA sequence confirmation, this vector was designated as pcDNA3.1-IL-18 and used for the overexpression of IL-18 in TSCC cells. pcDNA3.1 and pCDNA3.1-IL-18 plasmids were separately transfected into CRL-1623 cells using Lipofectamine 2000 (Invitrogen Life Technologies) according to the manufacturer’s instructions, and stable cell lines were selected with 650 μg/ml G418 (Invitrogen Life Technologies).

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: .. Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The mouse NFAT5 3'-UTR were amplified, double-digested with Pme I and Xho I, and then cloned into the pmirGLO vector (Promega, USA).

    Binding Assay:

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with E coR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The binding site mutants were generated using a MutanBEST Kit (TaKaRa, China) and mutagenic primers.

    Article Title: NFAT5 is Regulated by p53/miR-27a Signal Axis and Promotes Mouse Ovarian Granulosa Cells Proliferation
    Article Snippet: Mouse p53 (NM_001127233.1) and NFAT5 (NM_018823.2) CDS were amplified and double-digested with EcoR I and Xho I (Thermo) and cloned into the pcDNA3.1 (+) vector (Invitrogen, USA). .. The binding site mutants were generated using a MutanBEST Kit (TaKaRa, China) and mutagenic primers.

    Agarose Gel Electrophoresis:

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The amplified products were identified on a 2% ethidium bromide-stained agarose gel and recovered using the TIANgel Midi Purification Kit [Tiangen Biotech (Beijing) Co., Ltd.]. .. The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes.

    In Vitro:

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: Paragraph title: Plasmids, morpholinos and in vitro RNA transcription ... To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene).

    Article Title: Hereditary cutaneomucosal venous malformations are caused by TIE2 mutations with widely variable hyper-phosphorylating effects
    Article Snippet: The 3.5-kb coding sequence of human TIE2 , along with 50 bp of the 5′ and 60 bp of the 3′ UTR, was cloned between the Xho I and Not I sites of the expression vector pcDNA3.1/Zeo(−) (Invitrogen, Carlsbad, CA, USA). .. To generate mutants in vitro , site-directed mutagenesis was carried out.

    Selection:

    Article Title: Construction of fat1 Gene Expression Vector and Its Catalysis Efficiency in Bovine Fetal Fibroblast Cells
    Article Snippet: An enhanced green fluorescent protein (eGFP) gene was used for transient expression in cells regulated by IRES sequence, a neo-kan and amp expression cassette served as a selection marker ( ). .. The eukaryotic expression vector pEF-GFP was double digested with Xho I and Mls I (Fermentas, Ontario, Canada) in a 10 μl reaction system: Xho I 0.75 μl, Mls I 0.75 μl, Tango buffer 2 μl, pEF-GFP plasmid 2 μl, Nuclease-free water 4.5 μl, and incubated at 37°C 5 h. Codon optimization fat1 was also double digested, with Xho I and Sma I (Fermentas, Ontario, Canada) from the pUC vector in a 10 μl reaction system: Xho I 0.75 μl, Sma I 0.75 μl, T buffer 2 μl, fat1 4 μl, Nuclease-free water 2.5 μl, 37°C 5 h. Recovered and ligated by T4 DNA Ligase (Fermentas, Ontario, Canada): T4 DNA Ligase Buffer 2.5 μl, pEF-GFP vector 2.5 μl, fat1 5 μl, T4 DNA Ligase 5 U, PEG 4000 Solution 2 μl, Nuclease-free water 12 μl and incubated at 4°C overnight.

    Article Title: Immunization with Recombinant SFTSV/NSs Protein Does Not Promote Virus Clearance in SFTSV-Infected C57BL/6J Mice
    Article Snippet: The purified PCR products were digested with Eco RI and Xho I (FastDigest enzymes; Thermo Fisher Scientific, Inc.) and then ligated into pET-28a(+) plasmid DNA (Novagen), which was digested with the same restriction enzymes. .. The positive clones were screened by kanamycin resistance selection and colony PCR method, and were finally sequenced to confirm absence of any mutations at the amino-acid residue level.

    HAT Assay:

    Article Title: Elongator subunit 3 (ELP3) modifies ALS through tRNA modification
    Article Snippet: The plasmids encoding ELP3 SAM (C109/112S) and ELP3 HAT (Y529A) were generated from the human ELP3-FLAG plasmid with QuickChange II Site-Directed Mutagenesis Kit (Agilent Technologies, Santa Clara, CA). .. To generate the ELP3 ΔHAT vector, the human ELP3-FLAG plasmid was digested with Xho I (Thermo Fisher Scientific, Waltham, MA) and the resulting fragment subcloned into the Xho I-digested pCMV6-Entry vector, under control of a T7 promoter (Origene).

    CTG Assay:

    Article Title: Overexpression of interleukin-18 protein reduces viability and induces apoptosis of tongue squamous cell carcinoma cells by activation of glycogen synthase kinase-3β signaling
    Article Snippet: The polymerase chain reaction (PCR) primers were: forward, 5′-GGG GTA CCA TGG CTG CTG AAC CAG TAG AAG-3′ and reverse, 5′-CCG CTC GAG AGC TAG TCT TCG TTT TGA ACA GTG-3′ with the restriction enzymes Kpn I and Xho I link. .. The cDNA was then subcloned into a linearized PMD-18T vector [Takara Biotechnology (Dalian) Co., Ltd., Dalian, China], digested and released with Kpn I and Xho I (Fermentas, Burlington, Ontario, Canada), and then cloned into pcDNA3.1 (+) vector (Invitrogen Life Technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher xhoi restriction enzymes
    (A) Digestion on extracted plasmid of one of positive clones with NheI and <t>XhoI</t> confirmed HBsAg fragment insertion in <t>pcDNA</t> vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.
    Xhoi Restriction Enzymes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xhoi restriction enzymes/product/Thermo Fisher
    Average 90 stars, based on 33 article reviews
    Price from $9.99 to $1999.99
    xhoi restriction enzymes - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Journal: Research in Pharmaceutical Sciences

    Article Title: Exposition of hepatitis B surface antigen (HBsAg) on the surface of HEK293T cell and evaluation of its expression

    doi: 10.4103/1735-5362.192485

    Figure Lengend Snippet: (A) Digestion on extracted plasmid of one of positive clones with NheI and XhoI confirmed HBsAg fragment insertion in pcDNA vector. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested circular plasmid. Column 3: 696 bp and 5501 bp bands that confirmed cloning. (B) Digestion of recombinant plasmid with BglII enzyme. Column 1: Mix DNA ladder (Thermoscientific, USA). Column 2: Undigested plasmid. Column 3: A 6197 bp linearized plasmid.

    Article Snippet: The extracted plasmid of one of the resulted clones and pcDNA 3.1 Hygro (+) plasmid (Invitrogen, USA) were digested by NheI and XhoI restriction enzymes (Thermoscience, USA) separately.

    Techniques: Plasmid Preparation, Clone Assay, Recombinant

    Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.

    Journal: mSphere

    Article Title: A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates

    doi: 10.1128/mSphere.00446-17

    Figure Lengend Snippet: Southern blot analysis of Δ pksP mutant generated in the Af293 background. (A) Schematic representation of the genomic locus of the Af293 and Δ pksP strains. Deletion of the pksP gene was carried out using the HygR cassette. The cleavage sites of the dual in vitro -assembled Cas9 RNPs are marked by thick vertical lines. XhoI cutting sites are indicated in the pksP locus of the wild-type and Δ pksP strains. (B) Southern blot analysis of 6 arbitrarily selected colonies after digesting genomic DNA with the XhoI restriction enzyme. The wild type (WT) produced a 1.8-kb band that matches the expected wild-type banding pattern. Lanes 1, 2, 4, 5, and 6 displayed a 3.8-kb band which matches the expected pksP deletion banding pattern. The colony in lane 3 displayed a 7.6-kb band, likely containing a tandem integration of the HygR repair template at the pksP locus.

    Article Snippet: Following quanti fication by a NanoDrop spectrophotometer and integrity verification by agarose gel electrophoresis, the genomic DNA was digested overnight at 37°C using the restriction enzyme XhoI and was separated on an agarose gel before being transferred to a Biodyne B modified nylon membrane (Thermo Scientific).

    Techniques: Southern Blot, Mutagenesis, Generated, In Vitro, Produced