Structured Review

Thermo Fisher xho i
Construction of the knockdown vector pCB309-PFUFT. The <t>FSH1</t> cDNA was ligated into pUC-PUT after DNA digestion by <t>Xho</t> I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
Xho I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 372 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xho i/product/Thermo Fisher
Average 99 stars, based on 372 article reviews
Price from $9.99 to $1999.99
xho i - by Bioz Stars, 2020-03
99/100 stars

Images

1) Product Images from "FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis"

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis

Journal: International Journal of Molecular Medicine

doi: 10.3892/ijmm.2019.4355

Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
Figure Legend Snippet: Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

Techniques Used: Plasmid Preparation, Construct

Related Articles

Clone Assay:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: Construction of pCB309-PFUFT-FSH1 knockdown vector The pCB309 plasmid synthesized from pSilent-1 (Fungal Genetics Stock Center) was kindly provided by Zhang et al , and contained the Escherichia coli (E. coli ) hygromycin B phosphotransferase gene to select successfully-transformed fungi, a transcription promoter driven by the Aspergillus nidulans constitutive trpC promoter and two multiple cloning sites separated by an intron-containing spacer. .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
Article Snippet: The product was cloned into pCR 2.1-TOPO®. .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: Paragraph title: 4.1.1. Cloning of SubA2-2 ... Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA).

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA). .. The PCR product was cut from the agarose gel, purified, and cloned into a pEASY-T vector (TransGen Biotech, Beijing, China), then sequenced using the M13 forward primer (5′-GTAAAACGACGGCCAGT-3′) and reverse primer (5′-AACAGCTATGACCATG-3′) at the Sangon Biotech (Guangzhou, China).

Amplification:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: The FSH1 forward inference sequence was amplified from the plasmid containing the full-length cDNA sequence of the FSH1 gene with the FSH1 primers presented in . .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: Prolonged Gray Matter Disease without Demyelination Caused by Theiler's Murine Encephalomyelitis Virus with a Mutation in VP2 Puff B
Article Snippet: We performed two PCR amplification (1825 to 2033 and 2013 to 2941) using GeneAmp kit reagents and a thermocycler (Perkin-Elmer Cetus, Norwalk, Conn.). .. The PCR product was digested with Sph I and Nco I. pDAFL3 was digested with Sph I and Xho I and with Nco I and Xho I (Gibco, Gaithersburg, Md.).

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: Therefore, the subA insert of the expression plasmids described by [ ] were amplified in standard 50-µL PCR reactions using the Phusion High Fidelity Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) with the primer pairs listed in (Eurofins Scientific, Luxemburg, Luxemburg) according to the manufacturer’s manual to ensure that the sequences of the His-tagged and untagged subunits used in the previous and current study were identical. .. Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA).

Article Title: Mitogen-activated protein kinase (MAPK)-docking sites in MAPK kinases function as tethers that are crucial for MAPK regulation in vivo
Article Snippet: To construct full-length pcDNA3.1-V5-MEK1 and pcDNA3.1-V5-MEK2, the appropriate coding sequences were amplified by high-fidelity PCR using either pBS-MEK1 or pBS-MEK2 [ ] as template and primers LB111 and MEK1a or LB114 and MEK2a, respectively (see for primers). .. The resulting products were digested with either Bam HI and Xho I or Eco RI and Xho I, for MEK1 and MEK2 respectively, and were then ligated into the corresponding sites of pcDNA3.1-V5 (Invitrogen).

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: .. The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA). ..

Synthesized:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: The pUC-PUT plasmid was synthesized by Wuhan GeneCreate Biological Engineering Co., Ltd. A map of each construct is presented in . .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Construct:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: To make the myc-tagged construct for APP695, human APP695 cDNA lacking the termination codon was generated by PCR with a set of primers: 5′-TTAAAATTTGCTAGCACCGCCATGCTGCCCGG-3′ and 5′-TTTAGCGGCCGCGTTCTGCATCTGCTCAAA-3′. .. The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen).

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: To construct the final FSH1 double-stranded RNA interference (dsRNAi) plasmid pCB309-PFUFT, three steps of ligation were performed as follows. .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2). .. The obtained fragments and the pGEX4T-2 plasmids ligated with T4 DNA ligase (Thermo Fisher) to construct the recombinant plasmid pGEX4T-2/Mj RPS27.

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: Cloning of SubA2-2 For expression of His-tag free SubA2-2, plasmids pKR01 was constructed. .. Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA).

Article Title: Mitogen-activated protein kinase (MAPK)-docking sites in MAPK kinases function as tethers that are crucial for MAPK regulation in vivo
Article Snippet: To construct full-length pcDNA3.1-V5-MEK1 and pcDNA3.1-V5-MEK2, the appropriate coding sequences were amplified by high-fidelity PCR using either pBS-MEK1 or pBS-MEK2 [ ] as template and primers LB111 and MEK1a or LB114 and MEK2a, respectively (see for primers). .. The resulting products were digested with either Bam HI and Xho I or Eco RI and Xho I, for MEK1 and MEK2 respectively, and were then ligated into the corresponding sites of pcDNA3.1-V5 (Invitrogen).

Expressing:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: .. The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen). .. Authenticity of all PCR-generated constructs was confirmed by DNA sequencing.

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: Paragraph title: Recombinant Expression and Purification of Mj RPS27 ... The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2).

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: Therefore, the subA insert of the expression plasmids described by [ ] were amplified in standard 50-µL PCR reactions using the Phusion High Fidelity Polymerase (Thermo Fisher Scientific, Waltham, MA, USA) with the primer pairs listed in (Eurofins Scientific, Luxemburg, Luxemburg) according to the manufacturer’s manual to ensure that the sequences of the His-tagged and untagged subunits used in the previous and current study were identical. .. Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA).

Transformation Assay:

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2). .. The constructed recombinant plasmid was then transformed into E. coli DH5α cells, cultured at 37°C overnight.

Article Title: Prolonged Gray Matter Disease without Demyelination Caused by Theiler's Murine Encephalomyelitis Virus with a Mutation in VP2 Puff B
Article Snippet: The PCR product was digested with Sph I and Nco I. pDAFL3 was digested with Sph I and Xho I and with Nco I and Xho I (Gibco, Gaithersburg, Md.). .. Transformation into Escherichia coli DH5α competent cells was performed according to the vendor's protocol.

Ligation:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: To construct the final FSH1 double-stranded RNA interference (dsRNAi) plasmid pCB309-PFUFT, three steps of ligation were performed as follows. .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Cell Culture:

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2). .. The constructed recombinant plasmid was then transformed into E. coli DH5α cells, cultured at 37°C overnight.

Generated:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: A deletion mutant containing only the C-terminal 99 amino acids of full-length APP (APPC99) was generated by PCR with a set of primers: 5′GCAAGCTTGCAGAATTCCGACATGACTCAGGA-3′ and 5′-TTCAAGAAACTCGTCTACGTCTTGCGAGCTCCG-3′. .. The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen).

Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
Article Snippet: PCR products were generated using primer pairs 5 and 6 with Taq polymerase. .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

Polymerase Chain Reaction:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: .. The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen). .. Authenticity of all PCR-generated constructs was confirmed by DNA sequencing.

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.). ..

Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
Article Snippet: .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively. ..

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: .. The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2). .. The obtained fragments and the pGEX4T-2 plasmids ligated with T4 DNA ligase (Thermo Fisher) to construct the recombinant plasmid pGEX4T-2/Mj RPS27.

Article Title: Prolonged Gray Matter Disease without Demyelination Caused by Theiler's Murine Encephalomyelitis Virus with a Mutation in VP2 Puff B
Article Snippet: .. The PCR product was digested with Sph I and Nco I. pDAFL3 was digested with Sph I and Xho I and with Nco I and Xho I (Gibco, Gaithersburg, Md.). .. The 0.2-kb PCR product and 10- and 0.7-kb fragments from pDAFL3 were isolated and ligated with T4 DNA ligase (Gibco).

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: .. Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA). .. Digestion of the insert and the pET16b(+) vector (Novagen, Darmstaft, Germany) was performed as recommended by the web tool DoubleDigest calculator of Thermo Scientific.

Article Title: Mitogen-activated protein kinase (MAPK)-docking sites in MAPK kinases function as tethers that are crucial for MAPK regulation in vivo
Article Snippet: To construct full-length pcDNA3.1-V5-MEK1 and pcDNA3.1-V5-MEK2, the appropriate coding sequences were amplified by high-fidelity PCR using either pBS-MEK1 or pBS-MEK2 [ ] as template and primers LB111 and MEK1a or LB114 and MEK2a, respectively (see for primers). .. The resulting products were digested with either Bam HI and Xho I or Eco RI and Xho I, for MEK1 and MEK2 respectively, and were then ligated into the corresponding sites of pcDNA3.1-V5 (Invitrogen).

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: The PCR amplification was performed in the following conditions—5 min at 94 °C followed by 30 cycles of 1 min at 94 °C, 30 s at 50 °C and 90 s at 72 °C, then a final extension at 72 °C for 5 min. Three to five mites from each colony were used for genetic identification. .. The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA).

DNA Sequencing:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen). .. Authenticity of all PCR-generated constructs was confirmed by DNA sequencing.

Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
Article Snippet: The chromosomal deletion was confirmed by DNA sequencing of PCR products using primer 7 and 8 ( ). .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

Sequencing:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: The FSH1 forward inference sequence was amplified from the plasmid containing the full-length cDNA sequence of the FSH1 gene with the FSH1 primers presented in . .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Recombinant:

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: Paragraph title: Recombinant Expression and Purification of Mj RPS27 ... The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2).

Mutagenesis:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: A deletion mutant containing only the C-terminal 99 amino acids of full-length APP (APPC99) was generated by PCR with a set of primers: 5′GCAAGCTTGCAGAATTCCGACATGACTCAGGA-3′ and 5′-TTCAAGAAACTCGTCTACGTCTTGCGAGCTCCG-3′. .. The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen).

Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
Article Snippet: Finally, pCS3 was electroporated into the resulting double mutant to generate the isogenic triple mutant (Δlmo0515 Δlmo1580 Δlmo2673 ). .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively.

Article Title: Prolonged Gray Matter Disease without Demyelination Caused by Theiler's Murine Encephalomyelitis Virus with a Mutation in VP2 Puff B
Article Snippet: Two additional oligonucleotides were designed to allow extension from the mutation site to positions 1825 and 2941: 1825 (5′AAGACCGGCTGGCGAGTACAAGTTCA3′) and 2197 (5′TGAAGACGGCAACGACGAGGGTCCAATTA3′). .. The PCR product was digested with Sph I and Nco I. pDAFL3 was digested with Sph I and Xho I and with Nco I and Xho I (Gibco, Gaithersburg, Md.).

Isolation:

Article Title: Prolonged Gray Matter Disease without Demyelination Caused by Theiler's Murine Encephalomyelitis Virus with a Mutation in VP2 Puff B
Article Snippet: The PCR product was digested with Sph I and Nco I. pDAFL3 was digested with Sph I and Xho I and with Nco I and Xho I (Gibco, Gaithersburg, Md.). .. The 0.2-kb PCR product and 10- and 0.7-kb fragments from pDAFL3 were isolated and ligated with T4 DNA ligase (Gibco).

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: Genetic Identification of Varroa Mites Total DNA was isolated from individual mites using OMEGA reagent (Omega bio-tec, Guangzhou, China). .. The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA).

Size-exclusion Chromatography:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: The PCR mixture was as follows: 1.25U LA Taq (Takara Bio, Inc.), 1 µ l FSH1 plasmid (20 ng/µ l), 1 µ l FSH1-F primer, 1 µ l FSH1-R primer, 5 µ l 10X LA Taq Buffer, 4 µ l dNTP (2.5 mM), and ddH2 O up to a total volume of 50 µ l. The thermocycling conditions were as follows: Initial denaturation at 94°C for 1 min; followed by 30 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 30 sec, and a final extension 72°C for 10 min. PCR products were gel purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.). .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Purification:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.). ..

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: Paragraph title: Recombinant Expression and Purification of Mj RPS27 ... The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2).

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: .. Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA). .. Digestion of the insert and the pET16b(+) vector (Novagen, Darmstaft, Germany) was performed as recommended by the web tool DoubleDigest calculator of Thermo Scientific.

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA). .. The PCR product was cut from the agarose gel, purified, and cloned into a pEASY-T vector (TransGen Biotech, Beijing, China), then sequenced using the M13 forward primer (5′-GTAAAACGACGGCCAGT-3′) and reverse primer (5′-AACAGCTATGACCATG-3′) at the Sangon Biotech (Guangzhou, China).

Reverse Transcription Polymerase Chain Reaction:

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: Recombinant Expression and Purification of Mj RPS27 Mj RPS27 exF and Mj RPS27 exR ( ) were used to amplify Mj RPS27 by RT-PCR. .. The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2).

Plasmid Preparation:

Article Title: Demonstration by Fluorescence Resonance Energy Transfer of Two Sites of Interaction between the Low-Density Lipoprotein Receptor-Related Protein and the Amyloid Precursor Protein: Role of the Intracellular Adapter Protein Fe65
Article Snippet: .. The PCR products were digested with Hin dIII and Xho I and ligated into the Hin dIII and Xho I site of an expression vector pSecTag2B (Invitrogen). .. Authenticity of all PCR-generated constructs was confirmed by DNA sequencing.

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: Paragraph title: Construction of pCB309-PFUFT-FSH1 knockdown vector ... First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Article Title: Universal Stress Proteins Are Important for Oxidative and Acid Stress Resistance and Growth of Listeria monocytogenes EGD-e In Vitro and In Vivo
Article Snippet: .. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamH I and Xho I (Fermentas) and for lmo1580 with Xho I and Sac I (Fermentas), respectively. ..

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: .. The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2). .. The obtained fragments and the pGEX4T-2 plasmids ligated with T4 DNA ligase (Thermo Fisher) to construct the recombinant plasmid pGEX4T-2/Mj RPS27.

Article Title: Prolonged Gray Matter Disease without Demyelination Caused by Theiler's Murine Encephalomyelitis Virus with a Mutation in VP2 Puff B
Article Snippet: The PCR product was digested with Sph I and Nco I. pDAFL3 was digested with Sph I and Xho I and with Nco I and Xho I (Gibco, Gaithersburg, Md.). .. Plasmid DNAs were extracted by the alkali-sodium dodecyl sulfate method.

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA). .. Digestion of the insert and the pET16b(+) vector (Novagen, Darmstaft, Germany) was performed as recommended by the web tool DoubleDigest calculator of Thermo Scientific.

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA). .. The PCR product was cut from the agarose gel, purified, and cloned into a pEASY-T vector (TransGen Biotech, Beijing, China), then sequenced using the M13 forward primer (5′-GTAAAACGACGGCCAGT-3′) and reverse primer (5′-AACAGCTATGACCATG-3′) at the Sangon Biotech (Guangzhou, China).

Software:

Article Title: Reproduction of Distinct Varroa destructor Genotypes on Honey Bee Worker Brood
Article Snippet: The amplified mtDNA CO-I fragment was treated with Xho I and Sac I restriction enzymes respectively, according to the manufacturer’s instructions (Thermo Fisher Scientific, Rockford, IL, USA). .. Multiple alignments of Varroa CO-I gene sequences was performed by using DNAstar software (v 7.1).

Agarose Gel Electrophoresis:

Article Title: Variants of Escherichia coli Subtilase Cytotoxin Subunits Show Differences in Complex Formation In Vitro
Article Snippet: Prior to digestion with the restriction enzymes Xba I and Xho I (both Thermo Fisher Scientific, Waltham, MA, USA), the insert was purified with the Wizard® SV Gel and PCR clean-up kit (Promega, Fitchburg, WI, USA) according to the manufacturer’s recommendations (Handbook 2009, Promega, Fitchburg, WI, USA). .. The digested vector was loaded on a 1% (w /v ) agarose gel, separated at 120 V with 90 min run time, and subsequently extracted with the Wizard® SV Gel and PCR clean-up kit.

Concentration Assay:

Article Title: RPS27, a sORF-Encoded Polypeptide, Functions Antivirally by Activating the NF-κB Pathway and Interacting With Viral Envelope Proteins in Shrimp
Article Snippet: The PCR product and empty plasmid pGEX4T-2 (GE Healthcare) were digested by two restriction endonucleases, Bam HI and Xho I (Thermo Scientific), at 37°C for 1 h (MjRPS27 ) and 37°C for 0.5 h (vector pGEX4T-2). .. The recombinant plasmid, purified from the E. coli DH5α, was transformed into E. coli Rosetta cells, and Mj RPS27 expression was induced with β-d -1-thiogalactopyranoside (IPTG; Sangon, Shanghai, China) at a final concentration of 0.5 mM at 37°C.

DNA Purification:

Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
Article Snippet: The PCR mixture was as follows: 1.25U LA Taq (Takara Bio, Inc.), 1 µ l FSH1 plasmid (20 ng/µ l), 1 µ l FSH1-F primer, 1 µ l FSH1-R primer, 5 µ l 10X LA Taq Buffer, 4 µ l dNTP (2.5 mM), and ddH2 O up to a total volume of 50 µ l. The thermocycling conditions were as follows: Initial denaturation at 94°C for 1 min; followed by 30 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 30 sec, and a final extension 72°C for 10 min. PCR products were gel purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.). .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher xho i
    Agarose gel electrophoresis of transcription elongation factor-1α gene products (420 bp) of the Fusarium species (lane 1, clinical isolate; lanes 2–7, environmental isolates) following double digestion with <t>Xho</t> I and Sdu I. Lane M, 100-bp
    Xho I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 372 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/Thermo Fisher
    Average 99 stars, based on 372 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    89
    Thermo Fisher xho i hind iii
    Confirmation of the recombinant plasmids using digestion: Lane 1: pEGFP-Hsp20, Lane 2: pEGFP-Hsp20 digested by Nhe I/ Hind <t>III</t> (581 bp +720 bp ), Lane 3: pEGFP-NS3, Lane 4: pEGFP-NS3 digested by Xho I/ Hind III (861 bp ), Lane 5: pEGFP-Hsp20-NS3, Lane 6: pEGFP-Hsp20-NS3 digested by Nhe I/ Hind III (1442 bp +720 bp ). MW is a molecular weight marker (1 kb , Fermentas).
    Xho I Hind Iii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i hind iii/product/Thermo Fisher
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    xho i hind iii - by Bioz Stars, 2020-03
    89/100 stars
      Buy from Supplier

    Image Search Results


    Agarose gel electrophoresis of transcription elongation factor-1α gene products (420 bp) of the Fusarium species (lane 1, clinical isolate; lanes 2–7, environmental isolates) following double digestion with Xho I and Sdu I. Lane M, 100-bp

    Journal: Biomedical Reports

    Article Title: Development of a polymerase chain reaction-restriction fragment length polymorphism method for identification of the Fusarium genus using the transcription elongation factor-1α gene

    doi: 10.3892/br.2016.783

    Figure Lengend Snippet: Agarose gel electrophoresis of transcription elongation factor-1α gene products (420 bp) of the Fusarium species (lane 1, clinical isolate; lanes 2–7, environmental isolates) following double digestion with Xho I and Sdu I. Lane M, 100-bp

    Article Snippet: Therefore, double digestion with two restriction enzymes, Xho I and Sdu I (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used for discrimination.

    Techniques: Agarose Gel Electrophoresis

    Agarose gel electrophoresis of transcription elongation factor-1α gene products (420 bp) of the Fusarium species following double digestion with Xho I and Sdu I. Lane M, 100-bp ladder; lane 1, F. oxysporum complex IBRC-M 30067; lane 2, F. verticillioides

    Journal: Biomedical Reports

    Article Title: Development of a polymerase chain reaction-restriction fragment length polymorphism method for identification of the Fusarium genus using the transcription elongation factor-1α gene

    doi: 10.3892/br.2016.783

    Figure Lengend Snippet: Agarose gel electrophoresis of transcription elongation factor-1α gene products (420 bp) of the Fusarium species following double digestion with Xho I and Sdu I. Lane M, 100-bp ladder; lane 1, F. oxysporum complex IBRC-M 30067; lane 2, F. verticillioides

    Article Snippet: Therefore, double digestion with two restriction enzymes, Xho I and Sdu I (Thermo Fisher Scientific, Inc., Waltham, MA, USA) was used for discrimination.

    Techniques: Agarose Gel Electrophoresis

    Expression and analysis of NbHK. (A) Protein structure of NbHK. There is a signal peptide contacting 23 amino acids in the N terminus. (B) Validation of the pET-32- NbHK vector by PCR (left) and Bam HI/ Xho I enzyme digestion (right). Products 1,300 bp were amplified by PCR or cleaved from the constructed vector. M: 2K Plus (TaKaRa, Kusatsu, Japan). (C) Purification of recombinant HK. Recombinant HK was eluted by elution buffer containing different concentration of imidazole and analyzed by SDS-PAGE. (D) Specificity of the HK antiserum. Proteins extracted from infected Sf9-III, mature spores and healthy Sf9-III were subjected to western blot using polyclonal antibody against HK. M, Protein maker (Transgene, Shanghai, China).

    Journal: PeerJ

    Article Title: A secretory hexokinase plays an active role in the proliferation of Nosema bombycis

    doi: 10.7717/peerj.5658

    Figure Lengend Snippet: Expression and analysis of NbHK. (A) Protein structure of NbHK. There is a signal peptide contacting 23 amino acids in the N terminus. (B) Validation of the pET-32- NbHK vector by PCR (left) and Bam HI/ Xho I enzyme digestion (right). Products 1,300 bp were amplified by PCR or cleaved from the constructed vector. M: 2K Plus (TaKaRa, Kusatsu, Japan). (C) Purification of recombinant HK. Recombinant HK was eluted by elution buffer containing different concentration of imidazole and analyzed by SDS-PAGE. (D) Specificity of the HK antiserum. Proteins extracted from infected Sf9-III, mature spores and healthy Sf9-III were subjected to western blot using polyclonal antibody against HK. M, Protein maker (Transgene, Shanghai, China).

    Article Snippet: The above vectors and pIZ/V5-His (Thermo Fisher, Santa Clara, CA, USA) were digested by Kpn I and Xho I (Thermo Fisher, CA, USA).

    Techniques: Expressing, Positron Emission Tomography, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Purification, Recombinant, Concentration Assay, SDS Page, Infection, Western Blot

    Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Journal: MethodsX

    Article Title: Purification, concentration and recovery of small fragments of DNA from Giardia lamblia and their use for other molecular techniques

    doi: 10.1016/j.mex.2017.08.005

    Figure Lengend Snippet: Applications of small DNA fragments purified from G . lamblia . A) Fragments corresponding to NADHox (98 bp), TPI (65 bp) genes and snoRNA GlsR17 (62 bp) (lines, 1, 2 and 3, respectively), were separated on 2.5% agarose gels. B) The three DNA fragments mentioned in (A) were recovered, diluted in 10 μL and then re-amplified again by PCR with a primer pair; for NADHox (Fw: GCACCATATGGCTTCAACGG and Rv: CAGGCCTGTCCGTGTCATTA); TPI (Fw: AGGAGCTCGGAGAGTCCAA and Rv: ACACGGGCTCGTAAGCAAT) and GlsRNA17 (Fw: TGCAGCCTAATCACCGC and GTGCAGGGTCCGAGGT). M: Molecular weight marker (10 bp DNA Ladder, Thermo Scientific). C) Blunt-end ligation of DNA fragments purified using the modified freeze-squeeze method and digestion of the fragments cloned into vector pJET1.2 with restriction enzymes with Xho I and Nde I D) Sequences obtained from the three fragments cloned into vector pJET1.2. Sequences analyses were carried out in the Unidad de síntesis y secuenciación del Instituto de Biotecnología, UNAM (Cuernavaca, México).

    Article Snippet: Reagents Oligo TPI Fw: AGGAGCTCGGAGAGTCCAA Oligo TPI Rv: ACACGGGCTCGTAAGCAAT Oligo NADHox Fw: GCACCATATGGCTTCAACGG Oligo NADHox Rv: CAGGCCTGTCCGTGTCATTA) Oligo GlsRNA17 Fw: TGCAGCCTAATCACCGC Oligo GlsRNA 17 Rv: GTGCAGGGTCCGAGGT Phusion HighFidelity DNA polymerase (Thermo scientific) Xho I (Thermo Scientific) Nco I (Thermo Scientific) GelRed (Nucleic Acid Gel, Biotium) 1X TBE buffer (Tris-HCL/Boric Acid/EDTA) TE buffer [10 mM Tris-HCl, pH 8.0 and 1 mM (ethylenedinitrilo)tetraacetic acid (EDTA)] Sodium acetate (3 M, pH 5.2) Ethanol for molecular biology (Sigma-Aldrich) SyberGreen Master Mix kit (Applied Biosystems, CA, USA) GeneJET Plasmid Miniprep Kit (Thermo Scientific) T4 ligase (Thermo Scientific) Agarose (Invitrogen) GeneJET Plasmid Miniprep Kit (Thermo Scientific) Equipment Thermocycler MaxyGene Gradient (Axygen, USA) Thermomixer compact, Eppendorf Centrifuge (minispin Eppendorf centrifuge for 1.5 mL microcentrifuge tubes) Agarose Electrophoresis System (Thermo Scientific) Analyzer ImageJ1.50i, Wayne Rasband National Institutes of Health (USA) StepOne™ Real-Time PCR System and Fast SYBR® MultiDoc-It Digital Imaging System UVP

    Techniques: Purification, Amplification, Polymerase Chain Reaction, Molecular Weight, Marker, Ligation, Modification, Clone Assay, Plasmid Preparation

    Confirmation of the recombinant plasmids using digestion: Lane 1: pEGFP-Hsp20, Lane 2: pEGFP-Hsp20 digested by Nhe I/ Hind III (581 bp +720 bp ), Lane 3: pEGFP-NS3, Lane 4: pEGFP-NS3 digested by Xho I/ Hind III (861 bp ), Lane 5: pEGFP-Hsp20-NS3, Lane 6: pEGFP-Hsp20-NS3 digested by Nhe I/ Hind III (1442 bp +720 bp ). MW is a molecular weight marker (1 kb , Fermentas).

    Journal: Avicenna Journal of Medical Biotechnology

    Article Title: The Distinct Role of Small Heat Shock Protein 20 on HCV NS3 Expression in HEK-293T Cell Line

    doi:

    Figure Lengend Snippet: Confirmation of the recombinant plasmids using digestion: Lane 1: pEGFP-Hsp20, Lane 2: pEGFP-Hsp20 digested by Nhe I/ Hind III (581 bp +720 bp ), Lane 3: pEGFP-NS3, Lane 4: pEGFP-NS3 digested by Xho I/ Hind III (861 bp ), Lane 5: pEGFP-Hsp20-NS3, Lane 6: pEGFP-Hsp20-NS3 digested by Nhe I/ Hind III (1442 bp +720 bp ). MW is a molecular weight marker (1 kb , Fermentas).

    Article Snippet: The eukaryotic vector (pcDNA3.1) harboring the immunogenic and conserved region of HCV subtype 1a NS3 gene (1095-1379 aa, No: EU781798.1) was digested by Xho I/Hind III (Thermo scientific Fastdigest) and sub-cloned into pEGFP-C3 expression vector.

    Techniques: Recombinant, Molecular Weight, Marker