xho i  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    XhoI
    Description:
    XhoI 25 000 units
    Catalog Number:
    R0146L
    Price:
    285
    Size:
    25 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs xho i
    XhoI
    XhoI 25 000 units
    https://www.bioz.com/result/xho i/product/New England Biolabs
    Average 99 stars, based on 167 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells"

    Article Title: Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells

    Journal: Neural Regeneration Research

    doi: 10.4103/1673-5374.165523

    Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: DNA marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.
    Figure Legend Snippet: Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: DNA marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Techniques Used: Recombinant, Plasmid Preparation, Marker, Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis, Derivative Assay

    Identificatiion of PCR products by enzymatic digestion. M: DNA marker; 1: recombinant plasmid pIRES-BDNF (774 bp) by Xho I and Mlu I; 2: recombinant plasmid pIRES-CNTF (597 bp) by Xba I and Sal I; two fragments [ i.e ., target gene CNTF fragment (597 bp) and pIRES vector fragment (approximately 6.1 kb)] were acquired, confirming the product was recombinant plasmid pIRES-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.
    Figure Legend Snippet: Identificatiion of PCR products by enzymatic digestion. M: DNA marker; 1: recombinant plasmid pIRES-BDNF (774 bp) by Xho I and Mlu I; 2: recombinant plasmid pIRES-CNTF (597 bp) by Xba I and Sal I; two fragments [ i.e ., target gene CNTF fragment (597 bp) and pIRES vector fragment (approximately 6.1 kb)] were acquired, confirming the product was recombinant plasmid pIRES-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Techniques Used: Polymerase Chain Reaction, Marker, Recombinant, Plasmid Preparation, Derivative Assay

    Identification of double-gene recon by PCR. M: DNA marker; 1: double-gene recon 1 BDNF mRNA amplification product (788 bp); 2: double-gene recon 1 CNTF mRNA amplification product (611 bp); 3: double-gene recon 2 BDNF mRNA amplification product (774 bp); 4: double-gene recon 2 CNTF mRNA amplification product (597 bp). Recombinant plasmid pIRES-BDNF was digested by Xho I and Mlu I, and two fragments, a 774-bp-long target gene BDNF fragment and an approximately 1.6-kb-long pIRES vector fragment, were acquired, confirming the product was recombinant plasmid pIRES-BDNF. BDNF: Brain-derived neurotrophic factor. CNTF: ciliary neurotrophic factor.
    Figure Legend Snippet: Identification of double-gene recon by PCR. M: DNA marker; 1: double-gene recon 1 BDNF mRNA amplification product (788 bp); 2: double-gene recon 1 CNTF mRNA amplification product (611 bp); 3: double-gene recon 2 BDNF mRNA amplification product (774 bp); 4: double-gene recon 2 CNTF mRNA amplification product (597 bp). Recombinant plasmid pIRES-BDNF was digested by Xho I and Mlu I, and two fragments, a 774-bp-long target gene BDNF fragment and an approximately 1.6-kb-long pIRES vector fragment, were acquired, confirming the product was recombinant plasmid pIRES-BDNF. BDNF: Brain-derived neurotrophic factor. CNTF: ciliary neurotrophic factor.

    Techniques Used: Polymerase Chain Reaction, Marker, Amplification, Recombinant, Plasmid Preparation, Derivative Assay

    2) Product Images from "Adenovirus Type 4 Respiratory Infections among Civilian Adults, Northeastern United States, 2011–2015"

    Article Title: Adenovirus Type 4 Respiratory Infections among Civilian Adults, Northeastern United States, 2011–2015

    Journal: Emerging Infectious Diseases

    doi: 10.3201/eid2402.171407

    In silico restriction enzyme analysis of human adenovirus type 4 genomes representing the spectrum of genetic variability of the 36 isolates characterized in study of acute respiratory infection detected in the northeastern United States, 2011–2015. We generated restriction enzyme profiles for the completely sequenced genomes obtained in this study and from reference sequences available in GenBank using Geneious Pro ( 31 ). 4p4 MIL is isolate NHR90339, 4a1 MIL is isolate NHRC3, and 4a2 MIL is isolate 42606; 4a Sma I v is isolate NY11 (GenBank accession no. KY996449) and 4a Sma I/ Xho I v is isolate NY24 (GenBank accession no. KY996446). MIL, military isolate; v, variant; Vac, vaccine strain.
    Figure Legend Snippet: In silico restriction enzyme analysis of human adenovirus type 4 genomes representing the spectrum of genetic variability of the 36 isolates characterized in study of acute respiratory infection detected in the northeastern United States, 2011–2015. We generated restriction enzyme profiles for the completely sequenced genomes obtained in this study and from reference sequences available in GenBank using Geneious Pro ( 31 ). 4p4 MIL is isolate NHR90339, 4a1 MIL is isolate NHRC3, and 4a2 MIL is isolate 42606; 4a Sma I v is isolate NY11 (GenBank accession no. KY996449) and 4a Sma I/ Xho I v is isolate NY24 (GenBank accession no. KY996446). MIL, military isolate; v, variant; Vac, vaccine strain.

    Techniques Used: In Silico, Infection, Generated, Variant Assay

    3) Product Images from "Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers"

    Article Title: Effects of size and topology of DNA molecules on intracellular delivery with non-viral gene carriers

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-8-23

    Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.
    Figure Legend Snippet: Structure of the DNA molecules used in this study. A . Structure of the parent c-DNA. B . l-DNA formed by restriction digest of c-DNA with the enzyme Xho I. The size of the linearized plasmid was 4272 bp, C . pcr-DNA (2209 bp) generated by site-specific primers that amplified the region of the c-DNA containing the HTLV promoter, the hOPG open reading frame, and the SV40 Poly-A site. D . Structure of the parent c-DNA used in transfection. E . l-DNA formed by digest of pEGFP-N2 with the enzyme Cla I, which cuts in the vector backbone. F . pcr-DNA (1713 bp) generated by primers that are complementary to the sequence upstream of the CMV promoter and downstream of the polyA site.

    Techniques Used: Plasmid Preparation, Polymerase Chain Reaction, Generated, Amplification, Transfection, Sequencing

    4) Product Images from "Escherichia coli outer membrane protein F (OmpF): an immunogenic protein induces cross-reactive antibodies against Escherichia coli and Shigella"

    Article Title: Escherichia coli outer membrane protein F (OmpF): an immunogenic protein induces cross-reactive antibodies against Escherichia coli and Shigella

    Journal: AMB Express

    doi: 10.1186/s13568-017-0452-8

    Cloning, expression, purification and Western blotting analysis of OmpF. aA PCR products of the ompF gene. Lane M1 Trans DNA Marker II (1500, 900, 700, 500, 400, 200 and 100 bp); lane 1 ompF PCR products. Lane 2 the recombinant pET-28a(+)-ompF plasmid. Lane 3 the recombinant pET-28a(+)-ompF plasmid digested with BamH I and Xho I; lane M2 Trans 5K DNA Marker (5000, 3000, 2000, 1500, 1000, 800, 500 and 300 bp); B schematic representation of the pET-28a(+)-ompF plasmid; C SDS-PAGE analysis of the expression of rOmpF in auto-inducing media at different time. 1 mL of cultured cells were collected at 4, 6, 8, 10, 12, 14, and 24 h, respectively. Lane M protein marker (94.4–14.4 kDa); lane 1 4 h; lane 2 6 h; lane 3 8 h; lane 4 10 h; lane 5 12 h; lane 6 14 h; lane 7 24 h; D SDS-PAGE analysis of the purified rOmpF protein. Lane M 5 µL of protein marker (94.4–14.4 kDa); lane 1 total proteins after auto-induction of E. coli BL21 (DE3) containing pET-28a(+)-ompF (15 µL of cell lysis); lane 2 precipitation containing inclusion body after sonication and centrifugation (15 µL of renaturation solution); Lane 3 flowthrough (15 µL of elution solution); Lane 4 the eluent washed with 70% elution buffer (15 µL of the purified OmpF protein); E Western blotting analysis of the OmpF protein. Lane M , protein marker; lane 1 , the OmpF protein
    Figure Legend Snippet: Cloning, expression, purification and Western blotting analysis of OmpF. aA PCR products of the ompF gene. Lane M1 Trans DNA Marker II (1500, 900, 700, 500, 400, 200 and 100 bp); lane 1 ompF PCR products. Lane 2 the recombinant pET-28a(+)-ompF plasmid. Lane 3 the recombinant pET-28a(+)-ompF plasmid digested with BamH I and Xho I; lane M2 Trans 5K DNA Marker (5000, 3000, 2000, 1500, 1000, 800, 500 and 300 bp); B schematic representation of the pET-28a(+)-ompF plasmid; C SDS-PAGE analysis of the expression of rOmpF in auto-inducing media at different time. 1 mL of cultured cells were collected at 4, 6, 8, 10, 12, 14, and 24 h, respectively. Lane M protein marker (94.4–14.4 kDa); lane 1 4 h; lane 2 6 h; lane 3 8 h; lane 4 10 h; lane 5 12 h; lane 6 14 h; lane 7 24 h; D SDS-PAGE analysis of the purified rOmpF protein. Lane M 5 µL of protein marker (94.4–14.4 kDa); lane 1 total proteins after auto-induction of E. coli BL21 (DE3) containing pET-28a(+)-ompF (15 µL of cell lysis); lane 2 precipitation containing inclusion body after sonication and centrifugation (15 µL of renaturation solution); Lane 3 flowthrough (15 µL of elution solution); Lane 4 the eluent washed with 70% elution buffer (15 µL of the purified OmpF protein); E Western blotting analysis of the OmpF protein. Lane M , protein marker; lane 1 , the OmpF protein

    Techniques Used: Clone Assay, Expressing, Purification, Western Blot, Polymerase Chain Reaction, Marker, Recombinant, Positron Emission Tomography, Plasmid Preparation, SDS Page, Cell Culture, Lysis, Sonication, Centrifugation

    5) Product Images from "Prevalence and Infection Load Dynamics of Rickettsia felis in Actively Feeding Cat Fleas"

    Article Title: Prevalence and Infection Load Dynamics of Rickettsia felis in Actively Feeding Cat Fleas

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0002805

    Estimation of C. felis 18S rDNA copy number using Southern blot. C. felis genomic DNA (6 µg/enzyme) was digested with Eag I, Eco R I, Pst I, Xba I and Xho I. Uncut gDNA served as a negative control and PCR product of a portion of C. felis 18S rDNA served as a positive control. Genomic DNA was hybridized with Cf 18S bp probe to estimate the number of 18S rDNA gene copies in C. felis . Digestion with each enzyme results in a single digestion product. (*DNA was not completely digested by Pst I. Top band is uncut DNA.)
    Figure Legend Snippet: Estimation of C. felis 18S rDNA copy number using Southern blot. C. felis genomic DNA (6 µg/enzyme) was digested with Eag I, Eco R I, Pst I, Xba I and Xho I. Uncut gDNA served as a negative control and PCR product of a portion of C. felis 18S rDNA served as a positive control. Genomic DNA was hybridized with Cf 18S bp probe to estimate the number of 18S rDNA gene copies in C. felis . Digestion with each enzyme results in a single digestion product. (*DNA was not completely digested by Pst I. Top band is uncut DNA.)

    Techniques Used: Southern Blot, Negative Control, Polymerase Chain Reaction, Positive Control

    6) Product Images from "A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells"

    Article Title: A Nucleolus-Predominant piggyBac Transposase, NP-mPB, Mediates Elevated Transposition Efficiency in Mammalian Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0089396

    Schematic representation of expression constructs for PBase variants, PBase fusion proteins, and the dual fluorescent UGm transposon used in this study. (A) The mPB and NP-mPB coding sequences of mouse codon-optimized PBase were cloned into the pTriEx-HTNC plasmid by replacing the Cre cassette between Spe I and Xho I. The mPB and NP-mPB coding sequences were preceded by a hexa-histidine encoding sequence (6× His tag). NP-mPB included an additional nucleolus-predominant (NP) signal peptide. (B) The pTriEx-mPB-tGFP and pTriEx-NP-mPB-tGFP constructs expressed tGFP-fused PBases. The tGFP moiety allowed real-time imaging of the PBase variant subcellular distributions. The pTriEx-mPB-2A-eGFP and pTriEx-NP-mPB-2A-eGFP plasmids expressed PBase variants, which were linked to eGFP by the self-cleaving 2A peptide. All protein-encoding cassettes were transcriptionally regulated by a hybrid promoter composed of the CMV immediate early enhancer fused to the chicken β-actin promoter (CAG), and followed by a polyadenylation signal sequence (pA). (C) Flanking the 5′ and 3′ inverted terminal repeats (ITRs) (empty arrows), the dual fluorescent transposon ( pXL-T3-Neo-UGm-cHS4X ; UGm ) carried a human ubiquitin C (UBC) promoter-driven H2B-eGFP-2A-mCherry-GPI (Gm) transgene that labeled the transposed cells with a characteristic chromatin EGFP and membrane mCherry dual fluorescence. Additional abbreviations: Neo r , a neomycin phosphotransferase expression cassette providing resistance to G418 selection; 2× Ins, two copies of the insulator sequence from chicken β-globin.
    Figure Legend Snippet: Schematic representation of expression constructs for PBase variants, PBase fusion proteins, and the dual fluorescent UGm transposon used in this study. (A) The mPB and NP-mPB coding sequences of mouse codon-optimized PBase were cloned into the pTriEx-HTNC plasmid by replacing the Cre cassette between Spe I and Xho I. The mPB and NP-mPB coding sequences were preceded by a hexa-histidine encoding sequence (6× His tag). NP-mPB included an additional nucleolus-predominant (NP) signal peptide. (B) The pTriEx-mPB-tGFP and pTriEx-NP-mPB-tGFP constructs expressed tGFP-fused PBases. The tGFP moiety allowed real-time imaging of the PBase variant subcellular distributions. The pTriEx-mPB-2A-eGFP and pTriEx-NP-mPB-2A-eGFP plasmids expressed PBase variants, which were linked to eGFP by the self-cleaving 2A peptide. All protein-encoding cassettes were transcriptionally regulated by a hybrid promoter composed of the CMV immediate early enhancer fused to the chicken β-actin promoter (CAG), and followed by a polyadenylation signal sequence (pA). (C) Flanking the 5′ and 3′ inverted terminal repeats (ITRs) (empty arrows), the dual fluorescent transposon ( pXL-T3-Neo-UGm-cHS4X ; UGm ) carried a human ubiquitin C (UBC) promoter-driven H2B-eGFP-2A-mCherry-GPI (Gm) transgene that labeled the transposed cells with a characteristic chromatin EGFP and membrane mCherry dual fluorescence. Additional abbreviations: Neo r , a neomycin phosphotransferase expression cassette providing resistance to G418 selection; 2× Ins, two copies of the insulator sequence from chicken β-globin.

    Techniques Used: Expressing, Construct, Clone Assay, Plasmid Preparation, Sequencing, Imaging, Variant Assay, Labeling, Fluorescence, Selection

    7) Product Images from "Characterization of Monoclonal Antibodies against HA Protein of H1N1 Swine Influenza Virus and Protective Efficacy against H1 Viruses in Mice"

    Article Title: Characterization of Monoclonal Antibodies against HA Protein of H1N1 Swine Influenza Virus and Protective Efficacy against H1 Viruses in Mice

    Journal: Viruses

    doi: 10.3390/v9080209

    The recombinant pCI-neo-HA identification by Nhe I/Xho I digestion. Lane 1 and 4: DNA molecular weight marker; lane 2: empty pCI-neo plasmid; lane 3: pCI-neo-HA plasmid digested with Nhe I and Xho I.
    Figure Legend Snippet: The recombinant pCI-neo-HA identification by Nhe I/Xho I digestion. Lane 1 and 4: DNA molecular weight marker; lane 2: empty pCI-neo plasmid; lane 3: pCI-neo-HA plasmid digested with Nhe I and Xho I.

    Techniques Used: Recombinant, Hemagglutination Assay, Molecular Weight, Marker, Plasmid Preparation

    8) Product Images from "A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product"

    Article Title: A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0001777

    Restriction fragment length polymorphism analysis of the TcMK amplification product. A: a multiple sequence alignment of the 5′-UTR just upstream of the translational start codon, showing the polymorphic Xho I site. A solid line box marks the Xho I site in TcV strains. B: Agarose gel electrophoresis showing a PCR-RFLP analysis of selected strains. Strains analyzed were: Sc43 cl9, MN cl2, LL014 and Teh53 for DTU TcV; and Tulahuen cl2, CL-Brener, Tul2 and P63 cl1 for DTU TcVI.
    Figure Legend Snippet: Restriction fragment length polymorphism analysis of the TcMK amplification product. A: a multiple sequence alignment of the 5′-UTR just upstream of the translational start codon, showing the polymorphic Xho I site. A solid line box marks the Xho I site in TcV strains. B: Agarose gel electrophoresis showing a PCR-RFLP analysis of selected strains. Strains analyzed were: Sc43 cl9, MN cl2, LL014 and Teh53 for DTU TcV; and Tulahuen cl2, CL-Brener, Tul2 and P63 cl1 for DTU TcVI.

    Techniques Used: Amplification, Sequencing, Agarose Gel Electrophoresis, Electrophoresis, Polymerase Chain Reaction

    9) Product Images from "Conjugative Botulinum Neurotoxin-Encoding Plasmids in Clostridium botulinum"

    Article Title: Conjugative Botulinum Neurotoxin-Encoding Plasmids in Clostridium botulinum

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0011087

    Confirmation of plasmid pCLJ-Erm transfer from C. botulinum strain 657BaCT4 to strain LNT01. ( A ) Ethidium bromide stained PFGE of C. botulinum strains: LNT01 (Lanes 1 and 7), wild type strain 657Ba (Lanes 2 and 8); 657BaCT4 (Lanes 3 and 9) and LNT01 transconjugants (pCLJ-Erm) (Lanes 4–6 and 10–12); Lanes 1–6, nondigested DNA samples; Lanes 7–12, Xho I digested DNAsamples. Lambda PFG Marker (Lane M), New England Biolabs. The position of the pCLJ plasmid is indicated with an arrow. Southern hybridization with: ( B ) the ermB probe and ( C ) the bont/bvB probe. PFGE conditions: 6V/cm, 12°C, 1–26 s pulse time, 24 h.
    Figure Legend Snippet: Confirmation of plasmid pCLJ-Erm transfer from C. botulinum strain 657BaCT4 to strain LNT01. ( A ) Ethidium bromide stained PFGE of C. botulinum strains: LNT01 (Lanes 1 and 7), wild type strain 657Ba (Lanes 2 and 8); 657BaCT4 (Lanes 3 and 9) and LNT01 transconjugants (pCLJ-Erm) (Lanes 4–6 and 10–12); Lanes 1–6, nondigested DNA samples; Lanes 7–12, Xho I digested DNAsamples. Lambda PFG Marker (Lane M), New England Biolabs. The position of the pCLJ plasmid is indicated with an arrow. Southern hybridization with: ( B ) the ermB probe and ( C ) the bont/bvB probe. PFGE conditions: 6V/cm, 12°C, 1–26 s pulse time, 24 h.

    Techniques Used: Plasmid Preparation, Staining, Marker, Hybridization

    10) Product Images from "Cdc73 suppresses genome instability by mediating telomere homeostasis"

    Article Title: Cdc73 suppresses genome instability by mediating telomere homeostasis

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007170

    Loss of CDC73 results in a telomere defect. a. Southern blot of Xho I-digested genomic DNA isolated from strains of the indicated genotypes derived by sporulation of appropriate diploids and analyzed with a telomere-specific probe immediately after sporulation and genotyping. The dashed line corresponds to wild-type telomere length. b. Strains were serially propagated on non-selective media for > 20 restreaks and then tested by telomere Southern blot as above. c. Strains of the indicated genotypes were obtained by sporulation of heterozygous diploids and analyzed by pulse field gel electrophoresis. Wild-type chromosome sizes are labeled (left). Chromosome bands with new sizes are indicated with solid triangles, and missing bands are indicated with open triangles. Decreased band intensity and increased smearing can be seen in strains that were shown to undergo senescence. d. TPE was assayed by plating 10-fold serial dilutions of cdc73Δ , tel1Δ , and yku80Δ single and double mutant strains on selective media or selective media containing 5FOA. Loss of telomeric silencing is indicated by increased sensitivity to 5FOA.
    Figure Legend Snippet: Loss of CDC73 results in a telomere defect. a. Southern blot of Xho I-digested genomic DNA isolated from strains of the indicated genotypes derived by sporulation of appropriate diploids and analyzed with a telomere-specific probe immediately after sporulation and genotyping. The dashed line corresponds to wild-type telomere length. b. Strains were serially propagated on non-selective media for > 20 restreaks and then tested by telomere Southern blot as above. c. Strains of the indicated genotypes were obtained by sporulation of heterozygous diploids and analyzed by pulse field gel electrophoresis. Wild-type chromosome sizes are labeled (left). Chromosome bands with new sizes are indicated with solid triangles, and missing bands are indicated with open triangles. Decreased band intensity and increased smearing can be seen in strains that were shown to undergo senescence. d. TPE was assayed by plating 10-fold serial dilutions of cdc73Δ , tel1Δ , and yku80Δ single and double mutant strains on selective media or selective media containing 5FOA. Loss of telomeric silencing is indicated by increased sensitivity to 5FOA.

    Techniques Used: Southern Blot, Isolation, Derivative Assay, Nucleic Acid Electrophoresis, Labeling, Mutagenesis

    11) Product Images from "Colonization of Vitis vinifera by a Green Fluorescence Protein-Labeled, gfp-Marked Strain of Xylophilus ampelinus, the Causal Agent of Bacterial Necrosis of Grapevine"

    Article Title: Colonization of Vitis vinifera by a Green Fluorescence Protein-Labeled, gfp-Marked Strain of Xylophilus ampelinus, the Causal Agent of Bacterial Necrosis of Grapevine

    Journal:

    doi: 10.1128/AEM.69.4.1904-1912.2003

    Southern blot of Xho I digested DNA of X. ampelinus strains on a nylon membrane hybridized with the DIG-labeled gfp -probe. Lanes: 1, CFBP2098; 2, 2098:: gfp 2; 3, 2098:: gfp 3; 4, 2098:: gfp 4; 5, plasmid pUT gfp. There are two Xho I sites in pUT gfp. One is located in the npt II gene, borne by the mini- gfp transposon. Consequently, the gfp probe hybridized one DNA fragment per insertion. There is one insertion of the mini- gfp transposon in 2098:: gfp 2 and 2098:: gfp 3 and two insertions in 2098:: gfp 4.
    Figure Legend Snippet: Southern blot of Xho I digested DNA of X. ampelinus strains on a nylon membrane hybridized with the DIG-labeled gfp -probe. Lanes: 1, CFBP2098; 2, 2098:: gfp 2; 3, 2098:: gfp 3; 4, 2098:: gfp 4; 5, plasmid pUT gfp. There are two Xho I sites in pUT gfp. One is located in the npt II gene, borne by the mini- gfp transposon. Consequently, the gfp probe hybridized one DNA fragment per insertion. There is one insertion of the mini- gfp transposon in 2098:: gfp 2 and 2098:: gfp 3 and two insertions in 2098:: gfp 4.

    Techniques Used: Southern Blot, Labeling, Plasmid Preparation

    12) Product Images from "A Small Peptide Modeled after the NRAGE Repeat Domain Inhibits XIAP-TAB1-TAK1 Signaling for NF-?B Activation and Apoptosis in P19 Cells"

    Article Title: A Small Peptide Modeled after the NRAGE Repeat Domain Inhibits XIAP-TAB1-TAK1 Signaling for NF-?B Activation and Apoptosis in P19 Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0020659

    Design of the NRAGE peptide. (A) A list of the 25 hexamers in the order in which they appear in the NRAGE repeat domain partitioned into 4 distinguishing groups. A repeat consensus sequence was determined for each group and was then resolved into a single final consensus sequence as indicated by the red amino acids which was repeated 4 times for the NRAGE peptide. (B) Schematic of nucleotides comprising the NRAGE peptide including a Xho I site and a Kozak sequence to facilitate excision and transcription respectively.
    Figure Legend Snippet: Design of the NRAGE peptide. (A) A list of the 25 hexamers in the order in which they appear in the NRAGE repeat domain partitioned into 4 distinguishing groups. A repeat consensus sequence was determined for each group and was then resolved into a single final consensus sequence as indicated by the red amino acids which was repeated 4 times for the NRAGE peptide. (B) Schematic of nucleotides comprising the NRAGE peptide including a Xho I site and a Kozak sequence to facilitate excision and transcription respectively.

    Techniques Used: Sequencing

    13) Product Images from "One-Step Recovery of scFv Clones from High-Throughput Sequencing-Based Screening of Phage Display Libraries Challenged to Cells Expressing Native Claudin-1"

    Article Title: One-Step Recovery of scFv Clones from High-Throughput Sequencing-Based Screening of Phage Display Libraries Challenged to Cells Expressing Native Claudin-1

    Journal: BioMed Research International

    doi: 10.1155/2015/703213

    Library screening and analysis of sequences. (a) The panel shows the DNA fragments, gel-purified from sublibraries, after the indicated selection cycles. The corresponding plasmid preparations were digested with Nco I and Xho I restriction endonucleases, to release the DNA fragments encoding for the VH regions of the scFv fragments. The fragments were bar-coded and subjected to high-throughput sequencing, as described in the text. SM, size marker. (b) The chart reports the entropy values for the populations of fragments originating from the indicated selection cycles, after sequencing. (c) The reported values indicate the total number of clones, and the relative representation of the most abundant clone, within the corresponding selection cycles. (d) The chart indicates the relative distribution of clones, according to the number of counts observed, within the indicated ranges, for each of the 4 selection cycles. Cycles 3 and 4 show similar distributions.
    Figure Legend Snippet: Library screening and analysis of sequences. (a) The panel shows the DNA fragments, gel-purified from sublibraries, after the indicated selection cycles. The corresponding plasmid preparations were digested with Nco I and Xho I restriction endonucleases, to release the DNA fragments encoding for the VH regions of the scFv fragments. The fragments were bar-coded and subjected to high-throughput sequencing, as described in the text. SM, size marker. (b) The chart reports the entropy values for the populations of fragments originating from the indicated selection cycles, after sequencing. (c) The reported values indicate the total number of clones, and the relative representation of the most abundant clone, within the corresponding selection cycles. (d) The chart indicates the relative distribution of clones, according to the number of counts observed, within the indicated ranges, for each of the 4 selection cycles. Cycles 3 and 4 show similar distributions.

    Techniques Used: Library Screening, Purification, Selection, Plasmid Preparation, Next-Generation Sequencing, Marker, Sequencing, Clone Assay

    14) Product Images from "Novel Method of Cell-Free In Vitro Synthesis of the Human Fibroblast Growth Factor 1 Gene"

    Article Title: Novel Method of Cell-Free In Vitro Synthesis of the Human Fibroblast Growth Factor 1 Gene

    Journal: Journal of Biomedicine and Biotechnology

    doi: 10.1155/2010/971340

    Confirmation of assembled plasmid containing the FGF1 gene . The pcDNA3.1/V5-His-TOPO-FGF1 plasmid was cleaved by Hin dIII and Xho I. Lane 1: DNA molecular weight markers. Lane 2: Two digestion fragments of 5433 bp and 561 bp.
    Figure Legend Snippet: Confirmation of assembled plasmid containing the FGF1 gene . The pcDNA3.1/V5-His-TOPO-FGF1 plasmid was cleaved by Hin dIII and Xho I. Lane 1: DNA molecular weight markers. Lane 2: Two digestion fragments of 5433 bp and 561 bp.

    Techniques Used: Plasmid Preparation, Molecular Weight

    15) Product Images from "Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site"

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site

    Journal: BMC Research Notes

    doi: 10.1186/s13104-017-2631-8

    Xho I digests of miniprep DNA. Each DNA sample was digested with Xho I and electrophoresed on a 0.8% agarose gel. Lanes 1–7 represent various transformants. Lane 8 is a 1 kb ladder
    Figure Legend Snippet: Xho I digests of miniprep DNA. Each DNA sample was digested with Xho I and electrophoresed on a 0.8% agarose gel. Lanes 1–7 represent various transformants. Lane 8 is a 1 kb ladder

    Techniques Used: Agarose Gel Electrophoresis

    Design of the mutant loxP oligonucleotide. The 13 bp inverted repeats are underlined . The mutated bases in the 8 bp central spacer are shown in shadowed grey font . The Xho I site is also indicated
    Figure Legend Snippet: Design of the mutant loxP oligonucleotide. The 13 bp inverted repeats are underlined . The mutated bases in the 8 bp central spacer are shown in shadowed grey font . The Xho I site is also indicated

    Techniques Used: Mutagenesis

    16) Product Images from "Role of Pathogenicity Determinant Protein C (PdpC) in Determining the Virulence of the Francisella tularensis Subspecies tularensis SCHU"

    Article Title: Role of Pathogenicity Determinant Protein C (PdpC) in Determining the Virulence of the Francisella tularensis Subspecies tularensis SCHU

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0089075

    Construction of pdpC knockout mutants. The pdpC mutants were constructed using the TargeTron gene knockout system (Sigma-Aldrich) and pKEK1140 plasmid. (A) pKEK1140 plasmids were optimized for use in Francisella tularensis with the TargeTron gene knockout system. This plasmid consists of a plasmid origin for temperature-sensitive replication in F. tularensis (Ft ori), a plasmid origin in E. coli (p15A ori), an antibiotic resistance gene (Kan), FTN1451 promoter for Kan expressed in F. tularensis (FTN1451p), the RNP ( ltr B L1 and LtrA) driven by the F. tularensis groEL promoter (groELp), and a lacZ ′ within ltr B L1 . To target specific F. tularensis genes for group II intron insertion, the ltrB L1 intron in pKEK1140 was retargeted by replacing lacZ′, which is located between the Xho I and BsrG I sites, with a 350-bp PCR product [27] . (B) The insertion in each pdpC mutant derived from SCHU P9 was confirmed by PCR. In the left panel, genomic DNA extracted from SCHU P9, 538 ins, 1119 ins, and 2013 ins mutants was amplified using sense (pdpC-435F) and antisense (pdpC-2204R) primers. In the middle and right panel, genomic DNA was amplified using insertion-and pdpC -specific primer pairs (pdpC-435F/EBS universal and EBS universal/pdpC-2204R). These amplicons and molecular weight marker were electrophoresed in a 0.7% agarose gel. (C) Summary of pdpC mutants generated in this study. ltrB introns were inserted into SCHU P9 pdpC positions 538|539, 1119|1120, and 2013|2014. The resultant mutants were designated 538 ins, 1119 ins, and 2013 ins mutants, respectively. Both duplicated pdpC were mutated by pKEK1140 plasmid in all mutants. (D) SCHU P5, SCHU P9, 538 ins, 1119 ins, and 2013 ins were grown in CDM and the lysates were subjected to western blot analysis was performed using anti-PdpC polyclonal antibody [20] . Intact PdpC was observed only in SCHU P9. Western blot analysis demonstrated that truncated forms of PdpC proteins with predicted molecular size (538 ins, approximately 20 kDa; 1119 ins, approximately 45 kDa; 2013 ins, approximately 75 kDa) were expressed in three pdpC mutants obtained.
    Figure Legend Snippet: Construction of pdpC knockout mutants. The pdpC mutants were constructed using the TargeTron gene knockout system (Sigma-Aldrich) and pKEK1140 plasmid. (A) pKEK1140 plasmids were optimized for use in Francisella tularensis with the TargeTron gene knockout system. This plasmid consists of a plasmid origin for temperature-sensitive replication in F. tularensis (Ft ori), a plasmid origin in E. coli (p15A ori), an antibiotic resistance gene (Kan), FTN1451 promoter for Kan expressed in F. tularensis (FTN1451p), the RNP ( ltr B L1 and LtrA) driven by the F. tularensis groEL promoter (groELp), and a lacZ ′ within ltr B L1 . To target specific F. tularensis genes for group II intron insertion, the ltrB L1 intron in pKEK1140 was retargeted by replacing lacZ′, which is located between the Xho I and BsrG I sites, with a 350-bp PCR product [27] . (B) The insertion in each pdpC mutant derived from SCHU P9 was confirmed by PCR. In the left panel, genomic DNA extracted from SCHU P9, 538 ins, 1119 ins, and 2013 ins mutants was amplified using sense (pdpC-435F) and antisense (pdpC-2204R) primers. In the middle and right panel, genomic DNA was amplified using insertion-and pdpC -specific primer pairs (pdpC-435F/EBS universal and EBS universal/pdpC-2204R). These amplicons and molecular weight marker were electrophoresed in a 0.7% agarose gel. (C) Summary of pdpC mutants generated in this study. ltrB introns were inserted into SCHU P9 pdpC positions 538|539, 1119|1120, and 2013|2014. The resultant mutants were designated 538 ins, 1119 ins, and 2013 ins mutants, respectively. Both duplicated pdpC were mutated by pKEK1140 plasmid in all mutants. (D) SCHU P5, SCHU P9, 538 ins, 1119 ins, and 2013 ins were grown in CDM and the lysates were subjected to western blot analysis was performed using anti-PdpC polyclonal antibody [20] . Intact PdpC was observed only in SCHU P9. Western blot analysis demonstrated that truncated forms of PdpC proteins with predicted molecular size (538 ins, approximately 20 kDa; 1119 ins, approximately 45 kDa; 2013 ins, approximately 75 kDa) were expressed in three pdpC mutants obtained.

    Techniques Used: Knock-Out, Construct, Gene Knockout, Plasmid Preparation, Polymerase Chain Reaction, Mutagenesis, Derivative Assay, Amplification, Molecular Weight, Marker, Agarose Gel Electrophoresis, Generated, Western Blot

    17) Product Images from "Stabilization of Dicentric Translocations through Secondary Rearrangements Mediated by Multiple Mechanisms in S. cerevisiae"

    Article Title: Stabilization of Dicentric Translocations through Secondary Rearrangements Mediated by Multiple Mechanisms in S. cerevisiae

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0006389

    Degradation of chromosome ends in strains containing mec1 and tlc1 mutations. (A) aGCH analysis of representative chromosomes with signal decay at their ends is presented. (B) The qPCR validation of the decrease in the amount of genomic DNA on the right arm of chromosome XVI in the U1 GCR strain using primer pairs specific to YPR133W , YPR144C and YPR194C loci . The relative amounts of genomic DNA determined by qPCR at the YPR133W , YPR144W and YPR194C loci in the U1 strain are expressed relative to the signal obtained with each primer pair using RDKY3615 control DNA. (C) Telomere lengths in a RDKY3615 Can s 5FOA s strain, a mec1 sml1 tlc1 Can1 r 5FOA r post-senescence strain, a mec1 sml1 lig4 tlc1 Can1 s 5FOA s post-senescence strain, mec1 sml1 tlc1 GCR strains (D4, U1 and D5) and mec1 sml1 lig4 tlc1 GCR strains (D6, D7, D9 and D10) were analyzed by Southern blot with a poly(C 1-3 /TG 1–3 ) radiolabelled probe hybridized to Xho I-digested genomic DNA. (D) Chromosomes with at least one degraded end are listed. The chromosome number is followed by the standard SGD nucleotide coordinates of the chromosome region that has a negative log 2 ratio.
    Figure Legend Snippet: Degradation of chromosome ends in strains containing mec1 and tlc1 mutations. (A) aGCH analysis of representative chromosomes with signal decay at their ends is presented. (B) The qPCR validation of the decrease in the amount of genomic DNA on the right arm of chromosome XVI in the U1 GCR strain using primer pairs specific to YPR133W , YPR144C and YPR194C loci . The relative amounts of genomic DNA determined by qPCR at the YPR133W , YPR144W and YPR194C loci in the U1 strain are expressed relative to the signal obtained with each primer pair using RDKY3615 control DNA. (C) Telomere lengths in a RDKY3615 Can s 5FOA s strain, a mec1 sml1 tlc1 Can1 r 5FOA r post-senescence strain, a mec1 sml1 lig4 tlc1 Can1 s 5FOA s post-senescence strain, mec1 sml1 tlc1 GCR strains (D4, U1 and D5) and mec1 sml1 lig4 tlc1 GCR strains (D6, D7, D9 and D10) were analyzed by Southern blot with a poly(C 1-3 /TG 1–3 ) radiolabelled probe hybridized to Xho I-digested genomic DNA. (D) Chromosomes with at least one degraded end are listed. The chromosome number is followed by the standard SGD nucleotide coordinates of the chromosome region that has a negative log 2 ratio.

    Techniques Used: Real-time Polymerase Chain Reaction, Southern Blot

    Related Articles

    Transduction:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: Paragraph title: Production of NIS vector, retroviral supernatant and retroviral transduction ... The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Clone Assay:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: The diploids were sporulated, and the pif1-m2 spore clones carrying the plasmids were recovered. .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Purified CD4+ T-cells were resuspended in PBMC growth media: RPMI 1640 supplemented with 10% FBS, L-glutamine (20 mM), penicillin/streptomycin (100 mg/ml), and IL-2 (10 U/ml, Roche). .. Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. The resulting plasmids, NL4-3-MSS-eGFP and NL4-3-MSS-DsRed2, were sequenced across the junctions 5′ and 3′ of the fluorescent reporter gene using primers overlapping the 5′ Bam HI site ( 5′-TAGTGAACGGATCCTTAGCACTTATC-3′ ) and 3′ Xho I site ( 5′-TTCTAGGTCTCGAGATACTGCTCCCAC-3′ ).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Paragraph title: Library Design and Cloning ... Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Paragraph title: Cloning, expression and purification of VapA and VapD   ... The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ).

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: CA8 wildtype (WT) gene cDNA was purchased from Origene (Cat. No. RC210228). .. An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The V5-CA8 construct was then cloned between the BamHI and BglII restriction sites of the pAAV-MCS vector, one component of AAV Helper-Free System (Agilent Technologies, Santa Clara, CA), after amplification from pcDNA3.1/V5-His A using (CTCGGATCC GCCACC ATGGCGGAC) as forward primer and (TTTGTCGACTCACGTAGAATCGAGACCGAG) as reverse primer.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Paragraph title: Cloning of infant T/F env SGA sequences ... Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Paragraph title: 2.2.2. Site-directed mutagenesis and cloning ... Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Centrifugation:

    Article Title:
    Article Snippet: pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA). .. pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA).

    Amplification:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The loxP -KanMX -loxP fragment was amplified by PCR with primers O8655 and O8656 using the pUG6 plasmid [ ] as a template. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: The second fragment (2943 bp) contained only easF and was amplified by PCR primed with oligonucleotides easFF (5'-TCCATTCTTCGCTCGTTCAACCAGCAGG-3') and easFR (5'-CAGGACCTGTACCTAAAGCCTGGTAACC-3') in a 25 μL reaction containing 1× GoTaq Flexi buffer, 200 μM each deoxynucleotide triphosphate, 1.5 mM MgCl2 , 1 μM of each primer, and 2.5 units of Taq DNA polymerase (Promega, Madison, WI, USA). .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: NIS in the pcDNA3 vector was amplified by PCR using the forward primer 5′-CAC CAC CTC GAG GCT GTC AGC GCT GAG CAC AGC and reverse primer 5′-CAC CAC GAA TTC TTT GGC CCA TCC TGA GGA ACC . .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: Human CD59 lacking the sequence encoding the C-terminal 26 amino acids was amplified by PCR using the primers CD59XH2F ( 5′-CCCCCTCGAGTGGACAATCAC AATGGG-3′ ) and CD59StopEV-R ( 5′-TAAGGAGATATCTTAATTTTCAAGCTGTT CGTTA-3′ ) from the cDNA obtained from American Type Culture Collection. .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The primer sets were designed to contain the full length of coding sequence. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. The digested fragment was then subcloned between the NcoI site and the XhoI site of the pcDNA3.1+ vector.

    DNA Ligation:

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Synthesized:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The c-Myc promoter was synthesized by Sangon Biotech (Shanghai, China). .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Neutralization:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Briefly, cells (5×104 ) were fixed with 4% PFA for 10 mins at RT, followed by neutralization with 0.125 M glycine at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Construct:

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title:
    Article Snippet: Paragraph title: Retroviral Constructs ... Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: Paragraph title: Generation of adenovirus and AAV constructs ... The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The pcDNA3.1+ vector containing c-Myc-tagged PIWIL2 was constructed in our laboratory as previously described [ ]. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Real-time Polymerase Chain Reaction:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Incubation:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Cells were washed once with cold PBS and re-suspended and incubated in cold lysis buffer (10 mM Tris, pH 8, 10 mM NaCl, 5 mM MgCl2 , 0.1 mM EGTA, protease inhibitor cocktail and PMSF) for 10 min at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Where indicated, reactions were supplemented with 10 pmol of in vitro transcribed CLTA1 sgRNA. .. Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C. .. The reactions were stopped by the addition of Proteinase K (Thermo Scientific) and incubated at 37°C for 15 min. Cleavage products were analyzed by electrophoresis on a 1% agarose gel and stained with SYBR Safe.

    Article Title:
    Article Snippet: pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA). .. To express light chains, the expression vectors were transformed into BL21 (DE3) pLysS (Novagen).

    Luciferase:

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Expressing:

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: Paragraph title: Generation of AAV8 viruses expressing wildtype or mutant CA8 with V5 tag using AAV-MCS vectors ... An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer.

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The GST-T8 plasmid construct was transformed and expressed in BL21(DE3) Star cells.

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Article Title:
    Article Snippet: Paragraph title: Expression and Purification of Light Chain 22F6 ... pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Modification:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The MSCV (Murine Stem Cell Virus) MIGR1 vector was modified to contain human NIS followed by the IRES element and mCherry. .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco, Gaithersburg, Maryland, USA) containing 10 % fetal bovine serum (Gibco) at 37 °C in a incubator at 5 % CO2 . .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Western Blot:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Paragraph title: Western and Southern blotting ... Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Transformation Assay:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: For telomere blots, cells containing a plasmid with either a helicase gene (pMB267, 270, 282, and 292) or no insert (empty vector control; pMB13) ( ) were transformed into the PIF1 /pif1-m2 diploid (KP448). .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment. .. The plasmid that was derived through homologous recombination was rescued from yeast and amplified in E. coli .

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Plasmids were then transformed into XL10 gold chemically competent Escherichia coli cells. .. Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The reaction product was transformed into TOP10 cells for plasmid replication and isolated using a QIAprep miniprep kit (Qiagen, Hilden, Germany).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title:
    Article Snippet: pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA). .. The resulting DNA fragments were inserted between the same restriction sites of expression vector pET20b(+) (Novagen, Madison, WI).

    Over Expression:

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment. .. The plasmid that was derived through homologous recombination was rescued from yeast and amplified in E. coli .

    Derivative Assay:

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. The resulting PCR products were digested with the appropriate enzymes (New England Biolabs) and ligated into a pSP72 subcloning vector, containing EcoR I-Xho I sequence from NL4-3-MSS.

    Countercurrent Chromatography:

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Electroporation:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Transfection:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. This PCR product was digested with Esp3I, leaving an NcoI-compatible overhang, and SalI, and subsequently ligated into the NIS containing MIGR1 vector that had been digested with NcoI and SalI, which had removed the GFP.

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Paragraph title: Cell culture and transfection ... Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    TRAP Assay:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: Paragraph title: Yeast signal sequence trap assay ... The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion.

    Southern Blot:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Paragraph title: Western and Southern blotting ... Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Ligation:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Protease Inhibitor:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Cells were washed once with cold PBS and re-suspended and incubated in cold lysis buffer (10 mM Tris, pH 8, 10 mM NaCl, 5 mM MgCl2 , 0.1 mM EGTA, protease inhibitor cocktail and PMSF) for 10 min at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Cell Culture:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Paragraph title: Cell culture and transfection ... Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Generated:

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: This shortened version of the construct generated a product that was more stable than the previous His-tagged construct. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Gel Extraction:

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    DNA Sequencing:

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. Plasmids were transformed into E. coli DH5α by the CaCl2 transformation method.

    Sequencing:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: Paragraph title: Yeast signal sequence trap assay ... The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion.

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Chimeric infectious molecular clones in the Env region were generated by PCR amplifying archival clones of 1157i C2-V4 sequences in pGEM-T with primers containing the Age I ( 5′-CACATGGAATCAGACCGGT AGTATC-3′ ) and Sbf I ( 5′-GTTTTATCCTGCAGG GGAGTGTGATTG-3′ ) restriction sites to exactly match the sites flanking C2-V4 in the pNL4-3-MSS vector (position 6970 to 7464 in NL4-3).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. The library oligos were ligated into the vector using T4 DNA ligase (New England Biolabs) at a 1∶5 molar ratio of vector to insert, followed by phenol-chloroform extraction and ethanol precipitation for purification and concentration of DNA fragments.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. This PCR product was digested with Esp3I, leaving an NcoI-compatible overhang, and SalI, and subsequently ligated into the NIS containing MIGR1 vector that had been digested with NcoI and SalI, which had removed the GFP.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Amplicons from the first round PCR product that matched the infant consensus sequence (T/F virus sequence) were ligated into pcDNA3.1 Directional Topo vectors (Invitrogen) by introducing a–CACC 5’ end via a PCR reaction with the primers Rev19 (5’- ACTTTTTGACCACTTGCCACCCAT-3’) and Env1A (5’-caccTTAGGCATCTCCT ATGGCAGGAAGAAG-3’). .. Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: Human CD59 lacking the sequence encoding the C-terminal 26 amino acids was amplified by PCR using the primers CD59XH2F ( 5′-CCCCCTCGAGTGGACAATCAC AATGGG-3′ ) and CD59StopEV-R ( 5′-TAAGGAGATATCTTAATTTTCAAGCTGTT CGTTA-3′ ) from the cDNA obtained from American Type Culture Collection. .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Recombinant:

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The S100P mutation is associated with proteasome-mediated degradation that represents a null mutation comparable to the causal Car8 deletion mutation of the waddles mouse.

    Cellular Antioxidant Activity Assay:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: A SlonoMax library was obtained from Sloning BioTechnology GmbH (Pucheim, Germany), encoding helix 1 and 2 of the Affibody molecule with a Xho I and a Sac I site for subcloning to the vector (5′-CTC GAG GCG GAA GCC AAA TAC GCC AAA GAA XXX XXX XXX GCG XXX XXX GAG ATC XXX XXX TTA CCT AAC TTA ACC XXX XXX CAA XXX XXX GCC TTC ATC XXX AAA TTA XXX GAT GAC CCA AGC CAG AGC TCT-Ć; X denotes a randomized nucleotide position). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Immunofluorescence:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Cleavage Assay:

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Paragraph title: In vitro cleavage assay ... Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C.

    DNA Extraction:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: The diploids were sporulated, and the pif1-m2 spore clones carrying the plasmids were recovered. .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. Results from DNA from restreaks 1–3 are shown in , but the same results were also observed after 6 restreaks.

    Nucleic Acid Electrophoresis:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Magnetic Beads:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. The end-labeling reactions were upscaled and 1.5 ml eppendorf tubes were used to accommodate larger volumes.

    Mutagenesis:

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. These constructs directed the expression of full-length VapA (VapA-full), full-length VapD (Vap-full) and the N-terminally truncated form of VapD (Vap-core), each with the amino-acid residues LEHHHHHH attached at the C-terminus.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: Paragraph title: Generation of AAV8 viruses expressing wildtype or mutant CA8 with V5 tag using AAV-MCS vectors ... An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs). .. For three infants, 100046, 100383 and 101580, no SGA sequences matched 100% of nucleotides in the consensus sequence.

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: Paragraph title: 2.2.2. Site-directed mutagenesis and cloning ... Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title:
    Article Snippet: To generate N-terminally truncated TAP1 (1ΔN), human TAP1 in the pLPCX vector served as a template for mutagenesis using the primer pair 5′-GCTTCGGGATCCTGCCGCCACCATGCCCGGGGGTCAGGGCGGCTCTGG-3′ and 5′-CCAGAGCCCTGACCCCCGGGCATGGTGGCGGCAGGATCCCGAAGC-3′, and human TAP2 in the pLNCX2 retroviral vector (Clontech) served as a template for mutagenesis using the primer pair 5′-CGCGGCTGAGCCGCCACCATGCCCGGGGCCCAGGAGAAGG-3′ and 5′-CCTTCTCCTGGGCCCCGGGCATGGTGGCGGCTCAGCCGCG-3′ to generate N-terminally truncated TAP2 (2ΔN). .. Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively.

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: Paragraph title: Mutation of FLAG-RAX ... The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1.

    Isolation:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: The diploids were sporulated, and the pif1-m2 spore clones carrying the plasmids were recovered. .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. Results from DNA from restreaks 1–3 are shown in , but the same results were also observed after 6 restreaks.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. Next, the library-encoding plasmids were transformed into electrocompetent E. coli SS320 by electroporation and individual clones where sequenced for library validation by BigDye Thermo Cycle Sequencing using an ABI Prism 3700 instrument (Applied Biosystems).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The GST-T8 plasmid construct was transformed and expressed in BL21(DE3) Star cells.

    Subcloning:

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Chimeric infectious molecular clones in the Env region were generated by PCR amplifying archival clones of 1157i C2-V4 sequences in pGEM-T with primers containing the Age I ( 5′-CACATGGAATCAGACCGGT AGTATC-3′ ) and Sbf I ( 5′-GTTTTATCCTGCAGG GGAGTGTGATTG-3′ ) restriction sites to exactly match the sites flanking C2-V4 in the pNL4-3-MSS vector (position 6970 to 7464 in NL4-3).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: A SlonoMax library was obtained from Sloning BioTechnology GmbH (Pucheim, Germany), encoding helix 1 and 2 of the Affibody molecule with a Xho I and a Sac I site for subcloning to the vector (5′-CTC GAG GCG GAA GCC AAA TAC GCC AAA GAA XXX XXX XXX GCG XXX XXX GAG ATC XXX XXX TTA CCT AAC TTA ACC XXX XXX CAA XXX XXX GCC TTC ATC XXX AAA TTA XXX GAT GAC CCA AGC CAG AGC TCT-Ć; X denotes a randomized nucleotide position). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Marker:

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Purification:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation. .. Protoplasts of A. nidulans FGSC A767 were prepared by incubating overnight cultures with 50 mg driselase (Sigma-Aldrich, St. Louis, MO, USA), which was filter sterilized with a 0.22 μm filter, and 75 mg lysing enzyme (Sigma-Aldrich, St. Louis, MO, USA) in 15 mL of 0.7 M sodium chloride.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title:
    Article Snippet: To generate N-terminally truncated TAP1 (1ΔN), human TAP1 in the pLPCX vector served as a template for mutagenesis using the primer pair 5′-GCTTCGGGATCCTGCCGCCACCATGCCCGGGGGTCAGGGCGGCTCTGG-3′ and 5′-CCAGAGCCCTGACCCCCGGGCATGGTGGCGGCAGGATCCCGAAGC-3′, and human TAP2 in the pLNCX2 retroviral vector (Clontech) served as a template for mutagenesis using the primer pair 5′-CGCGGCTGAGCCGCCACCATGCCCGGGGCCCAGGAGAAGG-3′ and 5′-CCTTCTCCTGGGCCCCGGGCATGGTGGCGGCTCAGCCGCG-3′ to generate N-terminally truncated TAP2 (2ΔN). .. Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively. .. Sequencing of each construct was performed prior to retroviral transduction.

    Article Title:
    Article Snippet: Paragraph title: Expression and Purification of Light Chain 22F6 ... pCR-Blunt II TOPO vectors containing DNA fragments encoding human light chains were digested by restriction enzymes NcoI and XhoI (New England BioLabs, Beverly, MA).

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. AAVCAGsCD59 was generated by insertion of the CAGsCD59pA expression cassette (as employed in the adenovirus construct) into pAAV-MCS (Stratagene) to generate pAAVCAGsCD59 (further cloning details available upon request).

    Polymerase Chain Reaction:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. The DNA was digested overnight at 37°C with Alw N1 and run on a 0.7% agarose gel.

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The loxP -KanMX -loxP fragment was amplified by PCR with primers O8655 and O8656 using the pUG6 plasmid [ ] as a template. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ). .. Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ).

    Article Title: Partial Reconstruction of the Ergot Alkaloid Pathway by Heterologous Gene Expression in Aspergillus nidulans
    Article Snippet: PCR products were purified with QIAquick gel extraction kits (Qiagen, Valencia, CA, USA) prior to their inclusion in fungal transformations. .. The selectable marker pPyrG was obtained from the Fungal Genetics Stock Center and was digested with Xho I (New England BioLabs, Ipswich, MA, USA) and purified with QIAquick gel extraction kit prior to transformation.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ).

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: NIS in the pcDNA3 vector was amplified by PCR using the forward primer 5′-CAC CAC CTC GAG GCT GTC AGC GCT GAG CAC AGC and reverse primer 5′-CAC CAC GAA TTC TTT GGC CCA TCC TGA GGA ACC . .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. Next, mCherry obtained from the lab of Professor R.Y.

    Article Title: Infant transmitted/founder HIV-1 viruses from peripartum transmission are neutralization resistant to paired maternal plasma
    Article Snippet: Phusion High-Fidelity PCR Master Mix with HF Buffer was used according to the manufacturer’s instructions (New England BioLabs). .. Colonies were selected for growth, and plasmids were minipreped and quality controlled by restriction enzyme digestion using BamHI and XhoI (New England BioLabs).

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The reverse primer introduces a stop codon after asparagine 77. .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The control viruses, AdCAGGFP and AdCAGpA have been described previously .

    Positron Emission Tomography:

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Blocking Assay:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. The end-labeling reactions were upscaled and 1.5 ml eppendorf tubes were used to accommodate larger volumes.

    Staining:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. Transfection was performed in 6-well plates with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturers’ protocol.

    Concentration Assay:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development
    Article Snippet: The S130P mutation was introduced to pLVX-FLAG-RAX-IRES-ZsGreen1 by primer overlap mutagenesis, briefly one PCR reaction was performed using the primers: 5′AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ GCT AAT TCC TGT AAT GGG CCA ATT GGA TTC AGC TGG while a second PCR reaction was performed using the primers: 5′ CCA ATT GGC CCA TTA CAG GAA TTA GCA ATT CAC CAT G and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T , both reactions were performed using Expand High Fidelity PCR System (Roche). .. The resulting overlapping PCR products were then used as template for a second round PCR using the primers: 5′ AAC TCG AGG TAC CAT GGA CTA CTA CAA GG and 3′ AAT CTA GAG GAT CCC TAC TTT CTT TCT GCT ATT ATC TTT AAA T with Expand High Fidelity PCR System (Roche), the mutagenized product was digested with XhoI and XbaI (New England Biolabs) and ligated into pLVX-IRES-ZsGreen1 (Clontech) with Rapid DNA Ligation Kit (Roche) to generate pLVX-FLAG-RAX(S130P)-IRES-ZsGreen1. .. The DNA oligonucleotides CCG GCC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG TTT TTG and AAT TCA AAA ACC GTC AAC TTT CCA GAT TTC TCG AGA AAT CTG GAA AGT TGA CGG were annealed and ligated into pLKO.1-puro digested with AgeI and EcoRI (New England Biolabs) using Rapid DNA Ligation Kit (Roche) to generate pLKO.1-RAX (1199)-puro.

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The PIWI fragment was amplified from human iPS cell lines with the primer set: 5′-TTC TCG AGA TGG ATC CTT TCC GAC CAT C-3′ and 5′-TTC CAT GGT CAC AGG AAG AAC AGG TTC TC-3′. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    Plasmid Preparation:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: For telomere blots, cells containing a plasmid with either a helicase gene (pMB267, 270, 282, and 292) or no insert (empty vector control; pMB13) ( ) were transformed into the PIF1 /pif1-m2 diploid (KP448). .. Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously .

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment. .. The plasmid that was derived through homologous recombination was rescued from yeast and amplified in E. coli .

    Article Title: HIV-1 Env C2-V4 Diversification in a Slow-Progressor Infant Reveals a Flat but Rugged Fitness Landscape
    Article Snippet: Paragraph title: Plasmid Construction ... Fluorescent protein genes from pNL4-3-Δenv-eGFP and pNL4-3-Δenv-DsRed2 (kindly provided by Miguel Quiñones-Mateu) were transferred into pNL4-3-MSS ( M ultiple S ilent S ite), using Bam HI (position 8465 in NL4-3) and Xho I (position 8887 in NL4-3) (New England Biolabs) restriction sites, to generate the infectious molecular clones pNL4-3-MSS-eGFP and pNL4-3-MSS-DsRed2 ( ).

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: A SlonoMax library was obtained from Sloning BioTechnology GmbH (Pucheim, Germany), encoding helix 1 and 2 of the Affibody molecule with a Xho I and a Sac I site for subcloning to the vector (5′-CTC GAG GCG GAA GCC AAA TAC GCC AAA GAA XXX XXX XXX GCG XXX XXX GAG ATC XXX XXX TTA CCT AAC TTA ACC XXX XXX CAA XXX XXX GCC TTC ATC XXX AAA TTA XXX GAT GAC CCA AGC CAG AGC TCT-Ć; X denotes a randomized nucleotide position). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH).

    Article Title: Structure of the virulence-associated protein VapD from the intracellular pathogen Rhodococcus equi
    Article Snippet: Fragments of the vapA gene encoding residues 1–158 (VapA-full) and the vapD gene encoding residues 1–134 (VapD-full) were amplified by polymerase chain reaction (PCR) from genomic DNA of R. equi virulent strain 103S (de la Peña-Moctezuma & Prescott, 1995 ) using the primers listed in Table 1 . .. The amplified fragments were purified, digested with restriction endonucleases Nde I and Xho I (New England Biolabs Inc.) and then inserted into the Escherichia coli expression vector pET-30a(+) digested with the same enzymes (EDM Millipore Chemicals; Table 1 ). .. For the production of the N-terminally truncated form of VapD (residues 20–134; VapD-core), PCR was performed using the primers listed in Table 1 and the pET-30a-VapD-full plasmid DNA as a template.

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: NIS in the pcDNA3 vector was amplified by PCR using the forward primer 5′-CAC CAC CTC GAG GCT GTC AGC GCT GAG CAC AGC and reverse primer 5′-CAC CAC GAA TTC TTT GGC CCA TCC TGA GGA ACC . .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector. .. Next, mCherry obtained from the lab of Professor R.Y.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The S100P mutation is associated with proteasome-mediated degradation that represents a null mutation comparable to the causal Car8 deletion mutation of the waddles mouse.

    Article Title: Mapping Protective Regions on a Three-Dimensional Model of the Moraxella catarrhalis Vaccine Antigen Oligopeptide Permease A
    Article Snippet: SmaI and XhoI sites were added to the ends of the modified T8 construct PCR product using the primers listed in Table S1 in the supplemental material. .. The T8 DNA fragment and pGEX4T-3 plasmid were digested with SmaI and XhoI (New England BioLabs, Ipswich, MA) according to the manufacturer's instructions and ligated together using T4 DNA ligase (Invitrogen). .. The reaction product was transformed into TOP10 cells for plasmid replication and isolated using a QIAprep miniprep kit (Qiagen, Hilden, Germany).

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ). .. The same method was used to generate pRLuc, pRLuc140p143R and pRLuc113p116R.

    Article Title:
    Article Snippet: To generate N-terminally truncated TAP1 (1ΔN), human TAP1 in the pLPCX vector served as a template for mutagenesis using the primer pair 5′-GCTTCGGGATCCTGCCGCCACCATGCCCGGGGGTCAGGGCGGCTCTGG-3′ and 5′-CCAGAGCCCTGACCCCCGGGCATGGTGGCGGCAGGATCCCGAAGC-3′, and human TAP2 in the pLNCX2 retroviral vector (Clontech) served as a template for mutagenesis using the primer pair 5′-CGCGGCTGAGCCGCCACCATGCCCGGGGCCCAGGAGAAGG-3′ and 5′-CCTTCTCCTGGGCCCCGGGCATGGTGGCGGCTCAGCCGCG-3′ to generate N-terminally truncated TAP2 (2ΔN). .. Following purification, digestion with XhoI and NotI (New England Biolabs), and repurification, full-length TAP1 and 1ΔN were ligated into the pBMN-IRES-EGFP retroviral vector , respectively. .. Sequencing of each construct was performed prior to retroviral transduction.

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Cleavage reactions were carried out in a total volume of 20 μl and contained 10 μl lysate, 2 μl of 5× cleavage buffer (100 mM HEPES pH 7.5, 500 mM KCl, 25 mM MgCl2 , 5 mM DTT, 25% glycerol) and 300 ng plasmid. .. Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described .

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: The pcDNA3.1+ vector containing c-Myc-tagged PIWIL2 was constructed in our laboratory as previously described [ ]. .. Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK).

    shRNA:

    Article Title: PIWIL2 promotes progression of non-small cell lung cancer by inducing CDK2 and Cyclin A expression
    Article Snippet: Amplified PIWI cDNA was digested with NcoI and XhoI (New England BioLabs [NEB], Hertfordshire, UK). .. The digested fragment was then subcloned between the NcoI site and the XhoI site of the pcDNA3.1+ vector.

    Agarose Gel Electrophoresis:

    Article Title: Pif1 family helicases suppress genome instability at G-quadruplex motifs
    Article Snippet: Genomic DNA was isolated from cells from restreaks 1–6 after sporulation (corresponding to approximately 25 generations/restreak) using a MasterPure Yeast DNA Isolation kit (Epicentre Biotechnologies), digested overnight with Pst I and Xho I (NEB), and telomere length was determined by Southern analysis as described previously . .. When colonies arose after GCR events, single colonies were restreaked onto FOA+Can plates, and genomic DNA was isolated from the survivors using a MasterPure Yeast DNA Isolation kit.

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: The library was PCR amplified in 11 cycles using Phusion DNA polymerase (Finnzymes, Espoo, Finland) followed by purification of the PCR product using QIAquick PCR purification kit (Qiagen GmbH, Hilden, Germany). .. Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    In Vitro:

    Article Title: RNA-programmed genome editing in human cellsDecision letterAuthor response
    Article Snippet: Paragraph title: In vitro cleavage assay ... Reactions were incubated at 37°C for 1 hr and subsequently digested with 10 U of XhoI (NEB) for an additional 30 min at 37°C.

    Ethanol Precipitation:

    Article Title: Inhibiting HER3-Mediated Tumor Cell Growth with Affibody Molecules Engineered to Low Picomolar Affinity by Position-Directed Error-Prone PCR-Like Diversification
    Article Snippet: Subsequently, the library oligos were digested by Xho I and Sac I-HF restriction enzymes (New England Biolabs) and purified by preparative gel electrophoresis (2% agarose gel) using QIAquick gel extraction kit (Qiagen GmbH). .. A modified version of the S. carnosus expression vector pSCZ1 was restricted by Xho I and Sac I-HF enzymes and purified by preparative gel electrophoresis as described above.

    Produced:

    Article Title: In Vivo SPECT Reporter Gene Imaging of Regulatory T Cells
    Article Snippet: Retroviral supernatant was produced as previously described with the following modification. .. The resulting PCR product was digested with the restriction enzymes XhoI and EcoRI (NEB) and ligated into the XhoI and EcoRI digested MIGR1 vector.

    Article Title: Human Carbonic Anhydrase-8 AAV8 Gene Therapy Inhibits Nerve Growth Factor Signaling Producing Prolonged Analgesia and Anti-Hyperalgesia in Mice
    Article Snippet: An Eppendorf Recycler gradient (Model 5331) was used to amplify the WT gene which was cloned into pcDNA3.1/V5-His A between the BamHI and XhoI (NEB) restriction sites (Invitrogen Life Technologies, Carlsbad, CA) using (TTTGGATCC GCCACC ATGGCGGACCTGAGCTTC) as the forward primer and (TTTCTCGAGCTGAAATGCAGCTCTAATGACTC) as the reverse primer. .. The S100P mutation is associated with proteasome-mediated degradation that represents a null mutation comparable to the causal Car8 deletion mutation of the waddles mouse.

    Article Title: A Non Membrane-Targeted Human Soluble CD59 Attenuates Choroidal Neovascularization in a Model of Age Related Macular Degeneration
    Article Snippet: The PCR product was digested with XhoI (New England Biolabs) and EcoRV (New England Biolabs) and ligated with a similarly-digested pShCAG pShCAG was recombined with pAdEasy-1 and used to generate the adenovirus, AdCAGsCD59, as previously described . .. AAVCAGsCD59 was generated by insertion of the CAGsCD59pA expression cassette (as employed in the adenovirus construct) into pAAV-MCS (Stratagene) to generate pAAVCAGsCD59 (further cloning details available upon request).

    Immunoprecipitation:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: After the incubation, samples were quickly put on the magnetic block, and the supernatant was transferred to a sterile 1.5 ml eppendorf (referred to as DNAIP ) and was kept at −20°C until analysis. .. To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. These endonucleases have cutting sites within the conserved telomere proximal Y' repeat element releasing a≈1.2 kb and ≈1.0 kb terminal restriction fragment (TRF) respectively, which includes the terminal 0.35 kb TG1-3 repeats .

    DNA Purification:

    Article Title: In Planta Functional Analysis and Subcellular Localization of the Oomycete Pathogen Plasmopara viticola Candidate RXLR Effector Repertoire
    Article Snippet: The DNA sequences of ScCOX4 1−29 and GmMan1 1−49 were synthesized by Tsingke Biological Technology and inserted into the pSuper1300 plasmid. .. The predicted DNA fragments encoding for the PvRXLR signal peptides were amplified by PCR, and purified using an Oligo DNA purification Kit (Shangon Biotech, Shanghai, China), and introduced into the linearized pSUC2 vector (pSUC2T7M13ORI) following Eco R I and Xho I (New England Biolabs, Ipswich, USA) digestion. .. The recombinant plasmids were transformed into the invertase-negative yeast strain YTK12 by using the lithium acetate method.

    End Labeling:

    Article Title: Genome-Wide Mapping of DNA Strand Breaks
    Article Snippet: To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs). .. To match the detection levels observed by southern blots, we have immunoprecipitated 5 µg of uninduced yeast DNA previously digested with a ratio of 10 U per µg of DNA by XhoI and PstI (New England Biolabs).

    CTG Assay:

    Article Title: An Effective Strategy for a Whole-Cell Biosensor Based on Putative Effector Interaction Site of the Regulatory DmpR Protein
    Article Snippet: The primers used for site-directed mutagenesis are as follows, (a) for F42L (to generate pRLuc42R) forward primer: TGTTGCTGCAG CTT TCAGCGATGG and reverse primer: GCCATCGCTGA AAG CTGCAGCAA (b) for D140E and Q143L (to generate pRLuc140p143R) forward Primer: ACC GAA CTGGGG CTG ATGCA and reverse primer: TGCAT CAG CCCCA GTT CGGT (c) for L113M and D116A (to generate pRLuc113p116R) forward Primer: ACCGAG ATG GATATC GCC AAGGAA and reverse primer: TTCCTT GGC GATATC CAT CTCGGT (Altered codons are underlined). .. Mutagenic PCR product containing mutated DmpR (1692 bp) and the promoters, Pr and Po fragments (total 2377 bp) were gel-isolated and digested with XhoI and HindIII (New England Biolabs, USA), and introduced upstream of the firefly Luciferase (luc ) in the pGL3 basic expression vector to generate approximately 7 kb of pRLuc42R plasmid ( ).

    Lysis:

    Article Title: Developmental Heterogeneity in DNA Packaging Patterns Influences T-Cell Activation and Transmigration
    Article Snippet: Cells were washed once with cold PBS and re-suspended and incubated in cold lysis buffer (10 mM Tris, pH 8, 10 mM NaCl, 5 mM MgCl2 , 0.1 mM EGTA, protease inhibitor cocktail and PMSF) for 10 min at 4°C. .. Chromatin obtained was digested overnight with XhoI enzyme (NEB) at 37°C.

    Homologous Recombination:

    Article Title: Glycolic acid production in the engineered yeasts Saccharomyces cerevisiae and Kluyveromyces lactis
    Article Snippet: The primer pair has flanking regions for homologous recombination with the previously constructed ICL1 overexpression fragment and with the pRS426 shuttle vector. .. For constructing the idp2Δ::ICL1 cassette, the S. cerevisiae CEN.PK2-1D strain (MATα ura3-52 leu2-3 ,112 trp1-289 his3Δ MAL2-8 c SUC2 ) [ ] was transformed with the Eco RI and Xho I (both NEB) digested pRS426 plasmid, ICL1 overexpression fragment and loxP -KanMX -loxP fragment.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xho i
    Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: <t>DNA</t> marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.
    Xho I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 167 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xho i/product/New England Biolabs
    Average 99 stars, based on 167 article reviews
    Price from $9.99 to $1999.99
    xho i - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: DNA marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Journal: Neural Regeneration Research

    Article Title: Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells

    doi: 10.4103/1673-5374.165523

    Figure Lengend Snippet: Identification of recombinant plasmid pIRES-BDNF-CNTF by enzymatic digestion. 1: DNA marker; 2: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I, Xho I and Mlu I simutaneously; 3: recombinant plasmid pIRES-BDNF-CNTF was digested by Xho I and Mlu I; 4: recombinant plasmid pIRES-BDNF-CNTF was digested by Xba I and Sal I; 5: empty vector pIRES was digested by Xho I and Mlu I; 6: M: DNA marker. Enzymatic digestion products were visualized by gel electrophoresis using a 1.5% agarose gel. A 6.1-kb-sized vector band, a 774-bp-sized BDNF mRNA band and a 597-bp-sized CNTF band appeared, confirming the double-gene recombinant plasmid is pIRES-BDNF-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Article Snippet: Based on PCR amplification, recombinant plasmid DNA was digested by restriction enzymes Xba I, Sal I, Xho I and Mlu I (New England Biolabs, Ipswich, MA, USA).

    Techniques: Recombinant, Plasmid Preparation, Marker, Nucleic Acid Electrophoresis, Agarose Gel Electrophoresis, Derivative Assay

    Identificatiion of PCR products by enzymatic digestion. M: DNA marker; 1: recombinant plasmid pIRES-BDNF (774 bp) by Xho I and Mlu I; 2: recombinant plasmid pIRES-CNTF (597 bp) by Xba I and Sal I; two fragments [ i.e ., target gene CNTF fragment (597 bp) and pIRES vector fragment (approximately 6.1 kb)] were acquired, confirming the product was recombinant plasmid pIRES-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Journal: Neural Regeneration Research

    Article Title: Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells

    doi: 10.4103/1673-5374.165523

    Figure Lengend Snippet: Identificatiion of PCR products by enzymatic digestion. M: DNA marker; 1: recombinant plasmid pIRES-BDNF (774 bp) by Xho I and Mlu I; 2: recombinant plasmid pIRES-CNTF (597 bp) by Xba I and Sal I; two fragments [ i.e ., target gene CNTF fragment (597 bp) and pIRES vector fragment (approximately 6.1 kb)] were acquired, confirming the product was recombinant plasmid pIRES-CNTF. BDNF: Brain-derived neurotrophic factor; CNTF: ciliary neurotrophic factor.

    Article Snippet: Based on PCR amplification, recombinant plasmid DNA was digested by restriction enzymes Xba I, Sal I, Xho I and Mlu I (New England Biolabs, Ipswich, MA, USA).

    Techniques: Polymerase Chain Reaction, Marker, Recombinant, Plasmid Preparation, Derivative Assay

    Identification of double-gene recon by PCR. M: DNA marker; 1: double-gene recon 1 BDNF mRNA amplification product (788 bp); 2: double-gene recon 1 CNTF mRNA amplification product (611 bp); 3: double-gene recon 2 BDNF mRNA amplification product (774 bp); 4: double-gene recon 2 CNTF mRNA amplification product (597 bp). Recombinant plasmid pIRES-BDNF was digested by Xho I and Mlu I, and two fragments, a 774-bp-long target gene BDNF fragment and an approximately 1.6-kb-long pIRES vector fragment, were acquired, confirming the product was recombinant plasmid pIRES-BDNF. BDNF: Brain-derived neurotrophic factor. CNTF: ciliary neurotrophic factor.

    Journal: Neural Regeneration Research

    Article Title: Repair of peripheral nerve defects with chemically extracted acellular nerve allografts loaded with neurotrophic factors-transfected bone marrow mesenchymal stem cells

    doi: 10.4103/1673-5374.165523

    Figure Lengend Snippet: Identification of double-gene recon by PCR. M: DNA marker; 1: double-gene recon 1 BDNF mRNA amplification product (788 bp); 2: double-gene recon 1 CNTF mRNA amplification product (611 bp); 3: double-gene recon 2 BDNF mRNA amplification product (774 bp); 4: double-gene recon 2 CNTF mRNA amplification product (597 bp). Recombinant plasmid pIRES-BDNF was digested by Xho I and Mlu I, and two fragments, a 774-bp-long target gene BDNF fragment and an approximately 1.6-kb-long pIRES vector fragment, were acquired, confirming the product was recombinant plasmid pIRES-BDNF. BDNF: Brain-derived neurotrophic factor. CNTF: ciliary neurotrophic factor.

    Article Snippet: Based on PCR amplification, recombinant plasmid DNA was digested by restriction enzymes Xba I, Sal I, Xho I and Mlu I (New England Biolabs, Ipswich, MA, USA).

    Techniques: Polymerase Chain Reaction, Marker, Amplification, Recombinant, Plasmid Preparation, Derivative Assay

    Xho I digests of miniprep DNA. Each DNA sample was digested with Xho I and electrophoresed on a 0.8% agarose gel. Lanes 1–7 represent various transformants. Lane 8 is a 1 kb ladder

    Journal: BMC Research Notes

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site

    doi: 10.1186/s13104-017-2631-8

    Figure Lengend Snippet: Xho I digests of miniprep DNA. Each DNA sample was digested with Xho I and electrophoresed on a 0.8% agarose gel. Lanes 1–7 represent various transformants. Lane 8 is a 1 kb ladder

    Article Snippet: The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Techniques: Agarose Gel Electrophoresis

    Design of the mutant loxP oligonucleotide. The 13 bp inverted repeats are underlined . The mutated bases in the 8 bp central spacer are shown in shadowed grey font . The Xho I site is also indicated

    Journal: BMC Research Notes

    Article Title: Retrofitting the BAC cloning vector pBeloBAC11 by the insertion of a mutant loxP site

    doi: 10.1186/s13104-017-2631-8

    Figure Lengend Snippet: Design of the mutant loxP oligonucleotide. The 13 bp inverted repeats are underlined . The mutated bases in the 8 bp central spacer are shown in shadowed grey font . The Xho I site is also indicated

    Article Snippet: The DNA samples were digested with 10 U of Xho I for 2 h at 37 °C (New England BioLabs) and electrophoresed in a 0.8% agarose gel in 0.5X TBE.

    Techniques: Mutagenesis