Structured Review

Thermo Fisher xbai
Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are <t>EcoRI,</t> HinDIII and <t>XbaI</t> . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 468 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xbai/product/Thermo Fisher
Average 99 stars, based on 468 article reviews
Price from $9.99 to $1999.99
xbai - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)"

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

Journal: 3 Biotech

doi: 10.1007/s13205-018-1552-0

Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
Figure Legend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

Techniques Used: Southern Blot, Molecular Weight, Marker, Hybridization

Related Articles

Clone Assay:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Following agarose gel purification (QIAquick gel extraction kit; Qiagen GmbH, Hilden, Germany), Taq amplification of first-round PCR products resulted in cDNA fragments which were ligated into a pCR 2.1 cloning vector (TOPO TA cloning kit; Invitrogen, Karlsruhe, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: PCR products were cloned into NarI and AvrII cut WT DENV-Luc infectious clone using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) and transformed into Stbl3 bacteria (Berkeley MacroLabs). .. Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs).

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively. .. To facilitate detection, we also constructed pcDNA6-BVDVpro-V5, in which BVDV NS3-4A fragment was placed in frame with a C-terminal V5 epi-tag.

Article Title: Virstatin inhibits dimerization of the transcriptional activator ToxT
Article Snippet: .. To construct the MBP–ToxT fusion proteins, full-length (aa1–276 ) toxT WT and toxT L113P were C-terminally His6 -tagged and cloned between XbaI and PstI of pMALc2x (Invitrogen, Carlsbad, CA). .. The resulting plasmids were transformed into O395Δ toxT .

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. For primers and PCR conditions used to generate OA1 mutants see Supplementary Fig. 1B.

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific). .. The recombinant plasmid was then linearized with XbaI, treated with proteinase K, purified by phenol/chloroform extraction, and precipitated with ethanol.

Amplification:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ). .. The extracted DNA (50 ng) was amplified by use of a DiversiLab DNA fingerprinting kit and Rep1R-I (Bacterial BarCodes, Houston, Tex.).

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Following agarose gel purification (QIAquick gel extraction kit; Qiagen GmbH, Hilden, Germany), Taq amplification of first-round PCR products resulted in cDNA fragments which were ligated into a pCR 2.1 cloning vector (TOPO TA cloning kit; Invitrogen, Karlsruhe, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: To generate knockout mutants of uhpC , ybcM , and YE2575 by plasmid insertion via homologous recombination, short intragenic fragments from the target genes were amplified from Y. enterocolitica chromosomal DNA using the primers listed in Table . .. Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9.

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: To construct pcDNA6-BVDVpro and pcDNA6-YFVpro, cDNA encoding the bovine viral diarrhea virus (BVDV) NADL NS3-4A proteins was amplified by PCR from a plasmid containing a copy of the BVDV NADL genome (kindly provided by Ilya Frolov) with primers BVDV-NS3 (cgctagctctagaccatGGGGCCTGCCGTGTGTAAGAAG; lowercase letters, introduced sequences; capital letters, viral sequences) and BVDV-NS4A (tttctcgagaagcttaCAGTTCTTTCAGTTCAGTCTCTG; lowercase letters, introduced sequences; capital letters, viral sequences); cDNA encoding the Yellow Fever virus (YFV) 17D NS2B-NS3 fragment was amplified by PCR from a plasmid template containing a fragment of YFV 17D (provided by Ilya Frolov) using primers YF NS2B (gctagctctagaccatGAGTATCCCAGTGAATGAGGCAC; lowercase letters, introduced sequences; capital letters, viral sequences) and YF NS3 (gagctcgagtcgacttaCCTCCTACCTTCAGCAAACTTA; lowercase letters, introduced sequences; capital letters, viral sequences). .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. For primers and PCR conditions used to generate OA1 mutants see Supplementary Fig. 1B.

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: Forward oligonucleotides containing a T7 promoter, gRNA target site and partial gRNA scaffold sequences were designed for gRNA template synthesis through PCR amplification by using the pUC19-scaffold as the template , together with a universal reverse primer ( 5’-AAAAAAAGCACCGACTCGGTGCCAC-3’ ). .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The virus-specific cDNA was then used as a template for PCR amplification with Q5 High-Fidelity DNA Polymerase (New England Biolabs) (initial denaturation for 30 s at 98 °C, 40 cycles of denaturation for 10 s at 98 °C, annealing for 30 s at 70 °C, extension for 3 min at 72 °C, and a final extension for 2 min at 72 °C) using the primers H14_HedgehogT7_1F and H14_Hedgehog_4118RXbaI. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Filtration:

Article Title: Virstatin inhibits dimerization of the transcriptional activator ToxT
Article Snippet: Paragraph title: Gel Filtration Studies. ... To construct the MBP–ToxT fusion proteins, full-length (aa1–276 ) toxT WT and toxT L113P were C-terminally His6 -tagged and cloned between XbaI and PstI of pMALc2x (Invitrogen, Carlsbad, CA).

Stable Transfection:

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit. .. A stably transfected genotype 1a cell line was selected with 0.3 mg of Geneticin/ml (G418 sulfate; Gibco/BRL).

Synthesized:

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: Then, gRNAs were synthesized by in vitro transcription with T7 RNA polymerase (TAKARA) and purified by LiCl or ethanol precipitation. .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ).

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher). .. Routinely, 10 ng of in vitro synthesized RNA was injected, and [32 P]phosphate flux measurements were performed after 3–5 days (Markovich ).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: Briefly, primers were designed based on the sequence of the putative H14-hedgehog/2015/HUN (H14_HedgehogT7_1F, TAATACGACTCACTATA GGGTACATTATGGCCCAAAATGATG ; H14_Hedgehog_4118RXbaI, TCTCTAGACTCGA GCACTTATCTTGTACTAGGTTATC ; bold letters represent sequences from the virus under study). cDNA was synthesized using a RevertAid First Strand cDNA Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions from RNA extracted from hedgehog faeces using the primer H14_Hedgehog_4118RXbaI. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

TA Cloning:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Following agarose gel purification (QIAquick gel extraction kit; Qiagen GmbH, Hilden, Germany), Taq amplification of first-round PCR products resulted in cDNA fragments which were ligated into a pCR 2.1 cloning vector (TOPO TA cloning kit; Invitrogen, Karlsruhe, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Construct:

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: To construct pcDNA6-BVDVpro and pcDNA6-YFVpro, cDNA encoding the bovine viral diarrhea virus (BVDV) NADL NS3-4A proteins was amplified by PCR from a plasmid containing a copy of the BVDV NADL genome (kindly provided by Ilya Frolov) with primers BVDV-NS3 (cgctagctctagaccatGGGGCCTGCCGTGTGTAAGAAG; lowercase letters, introduced sequences; capital letters, viral sequences) and BVDV-NS4A (tttctcgagaagcttaCAGTTCTTTCAGTTCAGTCTCTG; lowercase letters, introduced sequences; capital letters, viral sequences); cDNA encoding the Yellow Fever virus (YFV) 17D NS2B-NS3 fragment was amplified by PCR from a plasmid template containing a fragment of YFV 17D (provided by Ilya Frolov) using primers YF NS2B (gctagctctagaccatGAGTATCCCAGTGAATGAGGCAC; lowercase letters, introduced sequences; capital letters, viral sequences) and YF NS3 (gagctcgagtcgacttaCCTCCTACCTTCAGCAAACTTA; lowercase letters, introduced sequences; capital letters, viral sequences). .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively.

Article Title: Virstatin inhibits dimerization of the transcriptional activator ToxT
Article Snippet: .. To construct the MBP–ToxT fusion proteins, full-length (aa1–276 ) toxT WT and toxT L113P were C-terminally His6 -tagged and cloned between XbaI and PstI of pMALc2x (Invitrogen, Carlsbad, CA). .. The resulting plasmids were transformed into O395Δ toxT .

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: Paragraph title: cDNA Constructs ... Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen).

Article Title: The in vivo impact of MsLAC1, a Miscanthus laccase isoform, on lignification and lignin composition contrasts with its in vitro substrate preference
Article Snippet: The purified PCR products of MsLAC1 and the vector pPICZαA were digested with EcoRI and XbaI , and then ligated at 4 °C overnight using T4 DNA ligase (Thermo Fisher Scientific, Catalog number: EL0014). .. Competent yeast strain X33 cells were prepared fresh, and 2 μg of the ligated constructs was used for transformation.

Incubation:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The nylon membrane blocked with DIG Easy Hyb was subsequently hybridized with DIG labeled STS probe in a hybridization chamber and incubated at 65 °C for 15 h. This was followed by repeated washing of the hybridized nylon membrane with 0.1× SSC buffer (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) containing 0.1% sodium dodecyl sulfate.

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher). .. Xenopus oocytes were purchased from Ecocyte (Germany) and incubated in Barth's solution.

Luciferase:

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: .. The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion). ..

Activity Assay:

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion). .. The poliovirus stem–loop IV plasmid was linearized with HindIII and transcribed in the presence of 1 mM ATP, 1 mM CTP, 1 mM GTP, 50 μM unlabeled UTP, and 50 μCi of (α-32 P)UTP (specific activity: 3000 Ci/mmole; Amersham Pharmacia Biotech).

Expressing:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Competent Escherichia coli bacteria (One-Shot TOP10 chemically competent E. coli ; Invitrogen, Karlsruhe, Germany) were transformed with the expression vector and propagated overnight. .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: To construct a GBV-B NS3/4A expression plasmid, cDNA encoding GBV-B NS3-4A was amplified by PCR from a GBV-B infectious clone ( ) using primers GBB NS3 Kpn (cggtaccatGGCACCTTTTACGCTGCAG; lowercase letters, introduced sequences; capital letters, viral sequences) and GBB 4A (-) (gggaatgaattattaACACTCCTCCACGATTTCTTC; lowercase letters, introduced sequences; capital letters, viral sequences). .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. For primers and PCR conditions used to generate OA1 mutants see Supplementary Fig. 1B.

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ). .. Then, the zCas9 mRNA was purified by LiCl precipitation.

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: Paragraph title: Molecular biology and expression studies ... For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

Article Title: The in vivo impact of MsLAC1, a Miscanthus laccase isoform, on lignification and lignin composition contrasts with its in vitro substrate preference
Article Snippet: Paragraph title: Heterologous expression of MsLAC1 protein in Pichia pastoris ... The purified PCR products of MsLAC1 and the vector pPICZαA were digested with EcoRI and XbaI , and then ligated at 4 °C overnight using T4 DNA ligase (Thermo Fisher Scientific, Catalog number: EL0014).

Transformation Assay:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Competent Escherichia coli bacteria (One-Shot TOP10 chemically competent E. coli ; Invitrogen, Karlsruhe, Germany) were transformed with the expression vector and propagated overnight. .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: PCR products were cloned into NarI and AvrII cut WT DENV-Luc infectious clone using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) and transformed into Stbl3 bacteria (Berkeley MacroLabs). .. Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs).

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9. .. The recombinant plasmids were transformed into E. coli S17.1 λ pir by electroporation and transferred into each individual Y. enterocolitica strain by plate mating (see above).

Article Title: Virstatin inhibits dimerization of the transcriptional activator ToxT
Article Snippet: To construct the MBP–ToxT fusion proteins, full-length (aa1–276 ) toxT WT and toxT L113P were C-terminally His6 -tagged and cloned between XbaI and PstI of pMALc2x (Invitrogen, Carlsbad, CA). .. The resulting plasmids were transformed into O395Δ toxT .

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Article Title: The in vivo impact of MsLAC1, a Miscanthus laccase isoform, on lignification and lignin composition contrasts with its in vitro substrate preference
Article Snippet: The purified PCR products of MsLAC1 and the vector pPICZαA were digested with EcoRI and XbaI , and then ligated at 4 °C overnight using T4 DNA ligase (Thermo Fisher Scientific, Catalog number: EL0014). .. Competent yeast strain X33 cells were prepared fresh, and 2 μg of the ligated constructs was used for transformation.

Derivative Assay:

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: Clone A cells that contain an HCV genotype 1b replicon (derived from Huh-7 cells, a human hepatoma cell line) were licensed from Apath, LLC. .. The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit.

Hybridization:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The nylon membrane blocked with DIG Easy Hyb was subsequently hybridized with DIG labeled STS probe in a hybridization chamber and incubated at 65 °C for 15 h. This was followed by repeated washing of the hybridized nylon membrane with 0.1× SSC buffer (15 mM sodium chloride, 1.5 mM sodium citrate, pH 7.0) containing 0.1% sodium dodecyl sulfate.

Electroporation:

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9. .. The recombinant plasmids were transformed into E. coli S17.1 λ pir by electroporation and transferred into each individual Y. enterocolitica strain by plate mating (see above).

Article Title: Monitoring FoxO1 localization in Chemically Identified Neurons
Article Snippet: FoxO1GFP was excised from pcDNA3-GFPFKHR (Addgene plasmid 9022)( ) by cutting with HindIII and XbaI, and then subcloned into pEGFP-C1 (Invitrogen) with HindIII and XbaI. .. This plasmid was subsequently linearized with IsceI and was used for electroporation.

Transfection:

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). .. Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production.

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit. .. Purified RNA transcripts were electroporated into RNA transfection-susceptible clonal cell lines (CV-H77SCR) with a BTX ECM 830 Electro Square Porator (HV setting, high-voltage mode, 99-μs pulse length/3.0 kV, voltage of 0.96 kV, five pulses).

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: A plasmid for transfection control (GFP alone) was generated by introducing a frame shift to the SLC34A1 open reading frame immediately after the start codon. .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

DNA Profiling:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ). .. The extracted DNA (50 ng) was amplified by use of a DiversiLab DNA fingerprinting kit and Rep1R-I (Bacterial BarCodes, Houston, Tex.).

Southern Blot:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Paragraph title: Southern blot analysis ... Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

Serial Dilution:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany). .. Calibration standards were produced by serial dilution of the plasmids, with final concentrations ranging from 101 to 107 copies/reaction.

Cell Culture:

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher). .. HKC‐8 cells were cultured as previously described (Hernando et al. ).

Generated:

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: .. Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). .. Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production.

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: .. The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion). ..

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: The catalytically inactive mutant of the GBV-B NS3/4A construct, pcDNA6-GBpro-S139A, was generated by QuikChange site-directed mutagenesis using pcDNA6-GBpro as a template. .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: Intramolecular deletions or mutations of OA1 (OA1/ΔSY, deleted of amino acids 222-231; OA1/LL→AA, mutated at amino acids 223-224; and OA1/WE→AA, mutated at amino acids 329-330) were generated by using a two-step PCR method ( ) using specific primers. .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen).

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: A plasmid for transfection control (GFP alone) was generated by introducing a frame shift to the SLC34A1 open reading frame immediately after the start codon. .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

DNA Sequencing:

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. DNA sequences of all constructs were confirmed by sequencing (Bio Molecular Research, DNA sequencing service at the University of Padua, Italy; ).

DNA Labeling:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Sequencing:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: The genotype 1a replicon plasmid was prepared by substituting the 5′ end up to and including the sequences encoding the first 11 amino acids of NS3 (i.e., 5′ NTR, genes for the structural proteins and NS2, and sequences encoding the first 11 amino acids of NS3) of the genotype 1a infectious DNA clone (pCV-H77C; isolate H77) with the 5′ NTR sequences, the neo gene, the encephalomyocarditis virus internal ribosome entry site, and HCV sequences encoding the first 11 amino acids of NS3 from pBB7 (genotype 1b sequence BB7 plasmid licensed from Apath, LLC). .. The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. DNA sequences of all constructs were confirmed by sequencing (Bio Molecular Research, DNA sequencing service at the University of Padua, Italy; ).

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: The open reading frames for green fluorescent protein (GFP) and red fluorescent protein (RFP) were introduced to the SLC34A1 sequence by overlapping PCR either at the 3′ or 5′ end. .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: Briefly, primers were designed based on the sequence of the putative H14-hedgehog/2015/HUN (H14_HedgehogT7_1F, TAATACGACTCACTATA GGGTACATTATGGCCCAAAATGATG ; H14_Hedgehog_4118RXbaI, TCTCTAGACTCGA GCACTTATCTTGTACTAGGTTATC ; bold letters represent sequences from the virus under study). cDNA was synthesized using a RevertAid First Strand cDNA Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions from RNA extracted from hedgehog faeces using the primer H14_Hedgehog_4118RXbaI. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Injection:

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher). .. Routinely, 10 ng of in vitro synthesized RNA was injected, and [32 P]phosphate flux measurements were performed after 3–5 days (Markovich ).

Recombinant:

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9. .. The recombinant plasmids were transformed into E. coli S17.1 λ pir by electroporation and transferred into each individual Y. enterocolitica strain by plate mating (see above).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific). .. The recombinant plasmid was then linearized with XbaI, treated with proteinase K, purified by phenol/chloroform extraction, and precipitated with ethanol.

Ziehl-Neelsen Stain:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: AFB colonies that grew on Middlebrook 7H10 agar were subcultured onto Lowenstein-Jensen agar for identification and further characterization. .. Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ).

Pulsed-Field Gel:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: Patient and environmental isolates of M. mageritense were subtyped by pulsed-field gel electrophoresis (PFGE) ( ) and repetitive-sequence PCR (rep-PCR) ( ). .. Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ).

DNA Extraction:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ). .. Isolates for rep-PCR subtyping were subcultured on Wallenstein medium at 37°C, and the DNA was extracted by using a 1-μl loop of culture and an UltraClean Microbial DNA isolation kit (Mo Bio Laboratories, Carlsbad, Calif.) in accordance with the manufacturer's instructions and extending the 10-min microbead vortex step to 30 min. Genomic integrity was checked by agarose gel electrophoresis, and sample DNA was diluted to approximately 25 ng/μl based on a comparison of band intensities to that of a 25-ng standard.

In Vivo:

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The genomic DNA of H14-hedgehog/2015/HUN was cloned for in vitro transcription and in vivo plant inoculation studies. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Mutagenesis:

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: The catalytically inactive mutant of the GBV-B NS3/4A construct, pcDNA6-GBpro-S139A, was generated by QuikChange site-directed mutagenesis using pcDNA6-GBpro as a template. .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively.

Article Title: Virstatin inhibits dimerization of the transcriptional activator ToxT
Article Snippet: To construct the MBP–ToxT fusion proteins, full-length (aa1–276 ) toxT WT and toxT L113P were C-terminally His6 -tagged and cloned between XbaI and PstI of pMALc2x (Invitrogen, Carlsbad, CA). .. An overnight culture of the ToxT fusions (wild-type and L113P mutant) was inoculated at a 1:500 dilution into 500 ml of LB in the presence or absence of 100 μM virstatin.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. For primers and PCR conditions used to generate OA1 mutants see Supplementary Fig. 1B.

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: Molecular biology and expression studies Site‐directed mutagenesis was performed using the Quickchange Lightning Kit (Agilent) and mutations were confirmed by sequencing. .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

Isolation:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: M. mucogenicum was isolated from tap water from the hand-washing sink. .. Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Labeling:

Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)
Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’. .. The electrophoretically separated DNA digest was subsequently blotted onto a nylon membrane filter (Hybond-N+, Amersham Pharmacia Biotech) and baked at 80 °C for 2 h. Digoxigenin labeled probes were designed from STS amplified DNA sequence using a digoxigenin DNA labeling and detection kit (Roche Diagnostics, Basel, Switzerland).

Purification:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany). ..

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). .. Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production.

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: Paragraph title: Transcription and RNA purification ... The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion).

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit. .. Purified RNA transcripts were electroporated into RNA transfection-susceptible clonal cell lines (CV-H77SCR) with a BTX ECM 830 Electro Square Porator (HV setting, high-voltage mode, 99-μs pulse length/3.0 kV, voltage of 0.96 kV, five pulses).

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: The products of 1st step amplifications A and B were subsequently purified and utilized together as template in 2nd step amplifications, which were performed with primers OA1/FXba-OA1/RHind and OA1/FXba-OA1CT2/Hind, as described above. .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen).

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: Then, gRNAs were synthesized by in vitro transcription with T7 RNA polymerase (TAKARA) and purified by LiCl or ethanol precipitation. .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The plasmid DNA was purified from an overnight bacterial culture using a Nucleospin Plasmid Purification Kit (Macherey Nagel). .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Article Title: The in vivo impact of MsLAC1, a Miscanthus laccase isoform, on lignification and lignin composition contrasts with its in vitro substrate preference
Article Snippet: .. The purified PCR products of MsLAC1 and the vector pPICZαA were digested with EcoRI and XbaI , and then ligated at 4 °C overnight using T4 DNA ligase (Thermo Fisher Scientific, Catalog number: EL0014). ..

Polymerase Chain Reaction:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: Patient and environmental isolates of M. mageritense were subtyped by pulsed-field gel electrophoresis (PFGE) ( ) and repetitive-sequence PCR (rep-PCR) ( ). .. Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ).

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Following agarose gel purification (QIAquick gel extraction kit; Qiagen GmbH, Hilden, Germany), Taq amplification of first-round PCR products resulted in cDNA fragments which were ligated into a pCR 2.1 cloning vector (TOPO TA cloning kit; Invitrogen, Karlsruhe, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: PCR products were cloned into NarI and AvrII cut WT DENV-Luc infectious clone using NEBuilder HiFi DNA Assembly Master Mix (New England BioLabs) and transformed into Stbl3 bacteria (Berkeley MacroLabs). .. Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs).

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9. .. To exclude illegitimate recombination, the correct insertion of the recombinant plasmid was confirmed by PCR using a gene-specific test primer and a plasmid-derived primer.

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively. .. To facilitate detection, we also constructed pcDNA6-BVDVpro-V5, in which BVDV NS3-4A fragment was placed in frame with a C-terminal V5 epi-tag.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: Intramolecular deletions or mutations of OA1 (OA1/ΔSY, deleted of amino acids 222-231; OA1/LL→AA, mutated at amino acids 223-224; and OA1/WE→AA, mutated at amino acids 329-330) were generated by using a two-step PCR method ( ) using specific primers. .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen).

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: Forward oligonucleotides containing a T7 promoter, gRNA target site and partial gRNA scaffold sequences were designed for gRNA template synthesis through PCR amplification by using the pUC19-scaffold as the template , together with a universal reverse primer ( 5’-AAAAAAAGCACCGACTCGGTGCCAC-3’ ). .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ).

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: The open reading frames for green fluorescent protein (GFP) and red fluorescent protein (RFP) were introduced to the SLC34A1 sequence by overlapping PCR either at the 3′ or 5′ end. .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Article Title: The in vivo impact of MsLAC1, a Miscanthus laccase isoform, on lignification and lignin composition contrasts with its in vitro substrate preference
Article Snippet: .. The purified PCR products of MsLAC1 and the vector pPICZαA were digested with EcoRI and XbaI , and then ligated at 4 °C overnight using T4 DNA ligase (Thermo Fisher Scientific, Catalog number: EL0014). ..

Electrophoretic Mobility Shift Assay:

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion). .. Transcribed RNA used as a probe in the electrophoretic mobility shift assays was generated in a similar manner.

Mouse Assay:

Article Title: Monitoring FoxO1 localization in Chemically Identified Neurons
Article Snippet: Paragraph title: Generation of FoxO1GFP mice and AGRP-IRES-CRE mice ... FoxO1GFP was excised from pcDNA3-GFPFKHR (Addgene plasmid 9022)( ) by cutting with HindIII and XbaI, and then subcloned into pEGFP-C1 (Invitrogen) with HindIII and XbaI.

Plasmid Preparation:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Plasmids were extracted from cell lysates by use of a QIAprep plasmid extraction kit (Qiagen, Hilden, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: .. Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9. .. The recombinant plasmids were transformed into E. coli S17.1 λ pir by electroporation and transferred into each individual Y. enterocolitica strain by plate mating (see above).

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: .. The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion). ..

Article Title: Monitoring FoxO1 localization in Chemically Identified Neurons
Article Snippet: .. FoxO1GFP was excised from pcDNA3-GFPFKHR (Addgene plasmid 9022)( ) by cutting with HindIII and XbaI, and then subcloned into pEGFP-C1 (Invitrogen) with HindIII and XbaI. .. The FoxO1GFP portion was excised from pEGFP-FoxO1GFP by digesting it with XhoI and BclI, and inserted into pBigT plasmid( ) digested with XhoI and BclI.

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: The resulting genotype 1a replicon plasmid (pCV-H77CSR) encodes an NS3 protein with a single amino acid change relative to isolate H77 (alanine to serine at amino acid position 7 of NS3) and no changes in the 5′ NTR. .. The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit.

Article Title: GB Virus B Disrupts RIG-I Signaling by NS3/4A-Mediated Cleavage of the Adaptor Protein MAVS ▿
Article Snippet: To construct pcDNA6-BVDVpro and pcDNA6-YFVpro, cDNA encoding the bovine viral diarrhea virus (BVDV) NADL NS3-4A proteins was amplified by PCR from a plasmid containing a copy of the BVDV NADL genome (kindly provided by Ilya Frolov) with primers BVDV-NS3 (cgctagctctagaccatGGGGCCTGCCGTGTGTAAGAAG; lowercase letters, introduced sequences; capital letters, viral sequences) and BVDV-NS4A (tttctcgagaagcttaCAGTTCTTTCAGTTCAGTCTCTG; lowercase letters, introduced sequences; capital letters, viral sequences); cDNA encoding the Yellow Fever virus (YFV) 17D NS2B-NS3 fragment was amplified by PCR from a plasmid template containing a fragment of YFV 17D (provided by Ilya Frolov) using primers YF NS2B (gctagctctagaccatGAGTATCCCAGTGAATGAGGCAC; lowercase letters, introduced sequences; capital letters, viral sequences) and YF NS3 (gagctcgagtcgacttaCCTCCTACCTTCAGCAAACTTA; lowercase letters, introduced sequences; capital letters, viral sequences). .. The BVDV NS3-4A and YFV NS2B-3 fragments were initially cloned using the pTOPO TA PCR cloning kit (Invitrogen) and subsequently released with XbaI and XhoI restriction enzymes and ligated into pcDNA6/V5-HisB (Invitrogen) digested with NheI and XhoI restriction sites, to result in the plasmids, pcDNA6-BVDVpro and pcDNA6-YFVpro, respectively.

Article Title: AN UNCONVENTIONAL DILEUCINE AND A NOVEL CYTOSOLIC MOTIF ARE REQUIRED FOR THE LYSOSOMAL/MELANOSOMAL TARGETING OF OA1
Article Snippet: .. Wild type and mutant OA1 amplification products were then digested with XbaI and HindIII and cloned into the same sites of the mammalian expression vector pcDNA 3.1/myc-His (−) C (Invitrogen). .. For primers and PCR conditions used to generate OA1 mutants see Supplementary Fig. 1B.

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ). .. Then, the zCas9 mRNA was purified by LiCl precipitation.

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: A plasmid for transfection control (GFP alone) was generated by introducing a frame shift to the SLC34A1 open reading frame immediately after the start codon. .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific). .. The recombinant plasmid was then linearized with XbaI, treated with proteinase K, purified by phenol/chloroform extraction, and precipitated with ethanol.

Article Title: The in vivo impact of MsLAC1, a Miscanthus laccase isoform, on lignification and lignin composition contrasts with its in vitro substrate preference
Article Snippet: .. The purified PCR products of MsLAC1 and the vector pPICZαA were digested with EcoRI and XbaI , and then ligated at 4 °C overnight using T4 DNA ligase (Thermo Fisher Scientific, Catalog number: EL0014). ..

Agarose Gel Electrophoresis:

Article Title: Furunculosis Due to Mycobacterium mageritense Associated with Footbaths at a Nail Salon
Article Snippet: Restriction of genomic DNA was performed with 40 U of XbaI (Invitrogen, Carlsbad, Calif.), and the resulting fragments were separated with a CHEF-DR system (Bio-Rad, Richmond, Calif.) at 14°C with pulse times ramped from 5 to 20 s at 200 V. PFGE patterns were interpreted by using criteria described by Tenover et al. ( ). .. Isolates for rep-PCR subtyping were subcultured on Wallenstein medium at 37°C, and the DNA was extracted by using a 1-μl loop of culture and an UltraClean Microbial DNA isolation kit (Mo Bio Laboratories, Carlsbad, Calif.) in accordance with the manufacturer's instructions and extending the 10-min microbead vortex step to 30 min. Genomic integrity was checked by agarose gel electrophoresis, and sample DNA was diluted to approximately 25 ng/μl based on a comparison of band intensities to that of a 25-ng standard.

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Following agarose gel purification (QIAquick gel extraction kit; Qiagen GmbH, Hilden, Germany), Taq amplification of first-round PCR products resulted in cDNA fragments which were ligated into a pCR 2.1 cloning vector (TOPO TA cloning kit; Invitrogen, Karlsruhe, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

In Vitro:

Article Title: The ER membrane protein complex is required to ensure correct topology and stable expression of flavivirus polyproteins
Article Snippet: .. Plasmids were linearized with XbaI and RNA was generated by in-vitro transcription using the MEGAscript T7 Kit (Invitrogen) with the reaction containing 5mM m7G(5')ppp(5')G RNA Cap Structure Analog (New England BioLabs). .. Resulting RNA was purified by lithium chloride precipitation and transfected into BHK-21 cells using Lipofectamine 3000 for viral production.

Article Title: Multimerization of poly(rC) binding protein 2 is required for translation initiation mediated by a viral IRES
Article Snippet: .. The luciferase RNAs used in the in vitro translation experiments were generated by in vitro transcription of p5′PVLuc plasmid linearized with XbaI using the T7-based Megascript in vitro transcription kit (Ambion). ..

Article Title: Novel Nonnucleoside Inhibitor of Hepatitis C Virus RNA-Dependent RNA Polymerase
Article Snippet: .. The pCV-H77CSR DNA was linearized with XbaI or ScaI, and in vitro transcription was performed by using Ambion's Megascript T7 high-yield transcription kit. .. Purified RNA transcripts were electroporated into RNA transfection-susceptible clonal cell lines (CV-H77SCR) with a BTX ECM 830 Electro Square Porator (HV setting, high-voltage mode, 99-μs pulse length/3.0 kV, voltage of 0.96 kV, five pulses).

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ). .. Then, the zCas9 mRNA was purified by LiCl precipitation.

Article Title: Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations. Clinical, biochemical, and pathophysiological analysis of SLC34A1 mutations
Article Snippet: .. For oocyte injections, plasmids were linearized using XbaI and in vitro transcribed using the T7 mMessageMachine kit (ThermoFisher). .. Xenopus oocytes were purchased from Ecocyte (Germany) and incubated in Barth's solution.

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The genomic DNA of H14-hedgehog/2015/HUN was cloned for in vitro transcription and in vivo plant inoculation studies. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Ethanol Precipitation:

Article Title: One-step efficient generation of dual-function conditional knockout and geno-tagging alleles in zebrafish
Article Snippet: Then, gRNAs were synthesized by in vitro transcription with T7 RNA polymerase (TAKARA) and purified by LiCl or ethanol precipitation. .. The zebrafish codon-optimized Cas9 expression vector pGH-T7-zCas9 was linearized by XbaI and used as the template for generating zCas9 mRNA through in vitro transcription using the mMessage mMachine T7 kit (Ambion) ( ).

Knock-Out:

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: Paragraph title: Construction of insertional knockout mutants and complementing vectors. ... Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9.

Produced:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany). .. Calibration standards were produced by serial dilution of the plasmids, with final concentrations ranging from 101 to 107 copies/reaction.

Gel Extraction:

Article Title: Cytokine Expression in the Colonic Mucosa of Human Immunodeficiency Virus-Infected Individuals before and during 9 Months of Antiretroviral Therapy ▿
Article Snippet: Following agarose gel purification (QIAquick gel extraction kit; Qiagen GmbH, Hilden, Germany), Taq amplification of first-round PCR products resulted in cDNA fragments which were ligated into a pCR 2.1 cloning vector (TOPO TA cloning kit; Invitrogen, Karlsruhe, Germany). .. Purified plasmids were linearized by use of EcoRI, HindIII, or XbaI (GIBCO BRL, Eggenstein, Germany).

Article Title: Analysis of a novel RNA virus in a wild northern white-breasted hedgehog (Erinaceus roumanicus)
Article Snippet: The PCR-product was isolated from a 1.2% agarose gel using a GeneJet Gel Extraction Kit (Thermo Fisher Scientific), and it was then ligated into pJET1.2/blunt Cloning Vector (CloneJET PCR Cloning Kit, Thermo Fisher Scientific), introduced into E. coli (DH5alpha) by transformation. .. Using restriction endonuclease sites for NotI (site on the pJET1.2 vector) and XbaI, the entire virus genome was excised from pJET1.2 and then cloned into a pUC18 vector digested with SmaI and XbaI (Thermo Fisher Scientific).

Homologous Recombination:

Article Title: Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth
Article Snippet: To generate knockout mutants of uhpC , ybcM , and YE2575 by plasmid insertion via homologous recombination, short intragenic fragments from the target genes were amplified from Y. enterocolitica chromosomal DNA using the primers listed in Table . .. Fragments were digested with XbaI (MBI Fermentas, Vilnius, Lithunia) and SacI (New England Biolabs, Beverly, Mass.) and ligated into XbaI/SacI-restricted suicide plasmid pKRG9.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • N/A
    5 T ↓C T A G A 3 3 A G A T C ↑T 5 Invitrogen Anza 12 XbaI is a restriction enzyme that cuts DNA at this recognition
      Buy from Supplier

    90
    Thermo Fisher xbai
    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are <t>EcoRI,</t> HinDIII and <t>XbaI</t> . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
    Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 666 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Thermo Fisher
    Average 90 stars, based on 666 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Journal: 3 Biotech

    Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

    doi: 10.1007/s13205-018-1552-0

    Figure Lengend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

    Techniques: Southern Blot, Molecular Weight, Marker, Hybridization

    Coinjection of Cas9 mRNA and Cas9 protein into zygotes. a Strategy for insertion of a Venus reporter into the mouse Rosa26 locus. sgRosa26-1 and Cas9 introduce a double-strand break between 1 kb and 0.8 kb fragments used as homology arms in the pR26-Venus targeting vector. The locations of PCR primers in the targeted and wildtype Rosa26 alleles are indicated. SA- splice acceptor, pA polyadenylation site. b Mouse zygotes were microinjected with pR26-Venus, sgRosa26-1 and Cas9 mRNA or Cas9 mRNA and protein. The embryos were cultured for 4 days and genomic DNA was isolated from 12 blastocysts each, for PCR-based detection of HDR or deletion events. Top panel: gel electrophoresis of PCR products. Targeted alleles (KI) are detected by amplification of a 1.3 kb genomic segment using the vector-specific primer VenusF and the R26R3 primer, located downstream of the vector homology region. The presence of integrated or nonintegrated vector DNA was tested using the R26F2/R2 primer pair, amplifying a 1.4 kb vector segment as well as 0.2 kb of the Rosa26 target region (middle panel). Lower panel: Rosa26 alleles with sequence deletions were detected by 0.2 kb of the target region (R26F2/R26R2 primers), followed by XbaI digestion and gel separation. XbaI resistant PCR products indicate the presence of sequence deletions (mut, 0.2 kb) whereas wildtype products are reduced to 0.12 kb fragments (wt). c Sequencing of PCR products amplified with primers VenusF and R26R3 (from B, top) showed the predicted recombination between the targeting vectors homology region and adjacent downstream genomic sequence

    Journal: BMC Biotechnology

    Article Title: Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes

    doi: 10.1186/s12896-016-0234-4

    Figure Lengend Snippet: Coinjection of Cas9 mRNA and Cas9 protein into zygotes. a Strategy for insertion of a Venus reporter into the mouse Rosa26 locus. sgRosa26-1 and Cas9 introduce a double-strand break between 1 kb and 0.8 kb fragments used as homology arms in the pR26-Venus targeting vector. The locations of PCR primers in the targeted and wildtype Rosa26 alleles are indicated. SA- splice acceptor, pA polyadenylation site. b Mouse zygotes were microinjected with pR26-Venus, sgRosa26-1 and Cas9 mRNA or Cas9 mRNA and protein. The embryos were cultured for 4 days and genomic DNA was isolated from 12 blastocysts each, for PCR-based detection of HDR or deletion events. Top panel: gel electrophoresis of PCR products. Targeted alleles (KI) are detected by amplification of a 1.3 kb genomic segment using the vector-specific primer VenusF and the R26R3 primer, located downstream of the vector homology region. The presence of integrated or nonintegrated vector DNA was tested using the R26F2/R2 primer pair, amplifying a 1.4 kb vector segment as well as 0.2 kb of the Rosa26 target region (middle panel). Lower panel: Rosa26 alleles with sequence deletions were detected by 0.2 kb of the target region (R26F2/R26R2 primers), followed by XbaI digestion and gel separation. XbaI resistant PCR products indicate the presence of sequence deletions (mut, 0.2 kb) whereas wildtype products are reduced to 0.12 kb fragments (wt). c Sequencing of PCR products amplified with primers VenusF and R26R3 (from B, top) showed the predicted recombination between the targeting vectors homology region and adjacent downstream genomic sequence

    Article Snippet: For the RLFP assay, PCR products were digested with the restriction enzyme XbaI (Thermo Scientific).

    Techniques: Introduce, Plasmid Preparation, Polymerase Chain Reaction, Cell Culture, Isolation, Nucleic Acid Electrophoresis, Amplification, Sequencing

    CRISPR/Cas9 induced DSBs at the Rosa26 intronic XbaI site in mouse zygotes. a : Diagram of the mouse Rosa26 locus. The sgRosa26-1 target sequence upstream of the protospacer adjacent motif (PAM) and the XbaI site within the first intron are indicated. The locations of primers used for nested PCR are shown (1. PCR: R26F1/R26R1, 2. PCR: R26F2/R26R2). b : In vitro blastocyst assay: zygotes microinjected with Cas9 mRNA and sgRosa26-1 RNA were cultured for 4 days to blastocysts. Genomic DNA was extracted from each blastocyst and used for PCR amplification of the target region and genotyping by XbaI or T7 endonuclease I (T7EI). c : Agarose gel electrophoresis of 0.2 kb PCR products amplified with the R26F2/R26R2 primer pair from blastocysts derived from microinjected zygotes (25 ng/μl sgRosa26-1 and 50 ng/μl Cas9 mRNA) (top). PCR products were either digested with XbaI (middle) or with T7EI (bottom). XbaI resistant 0.2 kb or T7EI sensitive 0.1 kb bands (arrows) indicate the presence of modified Rosa26 alleles harboring sequence deletions. WT – wildtype control, M – size marker. d : Sequence comparison of cloned PCR products (from c ) amplified from blastocysts #4 - #7 (from B). Deleted nucleotides are shown as dashes, the sgRosa26-1 PAM sequence is shown in red. e : Frequency of blastocysts showing NHEJ-based mutagenesis as indicated by the presence of XbaI resistant Rosa26 PCR products, in relation to the concentrations of Cas9 and sgRosa26-1 RNAs used for the microinjection of zygotes

    Journal: BMC Biotechnology

    Article Title: Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes

    doi: 10.1186/s12896-016-0234-4

    Figure Lengend Snippet: CRISPR/Cas9 induced DSBs at the Rosa26 intronic XbaI site in mouse zygotes. a : Diagram of the mouse Rosa26 locus. The sgRosa26-1 target sequence upstream of the protospacer adjacent motif (PAM) and the XbaI site within the first intron are indicated. The locations of primers used for nested PCR are shown (1. PCR: R26F1/R26R1, 2. PCR: R26F2/R26R2). b : In vitro blastocyst assay: zygotes microinjected with Cas9 mRNA and sgRosa26-1 RNA were cultured for 4 days to blastocysts. Genomic DNA was extracted from each blastocyst and used for PCR amplification of the target region and genotyping by XbaI or T7 endonuclease I (T7EI). c : Agarose gel electrophoresis of 0.2 kb PCR products amplified with the R26F2/R26R2 primer pair from blastocysts derived from microinjected zygotes (25 ng/μl sgRosa26-1 and 50 ng/μl Cas9 mRNA) (top). PCR products were either digested with XbaI (middle) or with T7EI (bottom). XbaI resistant 0.2 kb or T7EI sensitive 0.1 kb bands (arrows) indicate the presence of modified Rosa26 alleles harboring sequence deletions. WT – wildtype control, M – size marker. d : Sequence comparison of cloned PCR products (from c ) amplified from blastocysts #4 - #7 (from B). Deleted nucleotides are shown as dashes, the sgRosa26-1 PAM sequence is shown in red. e : Frequency of blastocysts showing NHEJ-based mutagenesis as indicated by the presence of XbaI resistant Rosa26 PCR products, in relation to the concentrations of Cas9 and sgRosa26-1 RNAs used for the microinjection of zygotes

    Article Snippet: For the RLFP assay, PCR products were digested with the restriction enzyme XbaI (Thermo Scientific).

    Techniques: CRISPR, Sequencing, Nested PCR, Polymerase Chain Reaction, In Vitro, Cell Culture, Amplification, Agarose Gel Electrophoresis, Derivative Assay, Modification, Marker, Clone Assay, Non-Homologous End Joining, Mutagenesis

    Knock-in of a conditional Cas9 transgene into Rosa26 of C57BL/6 zygotes. a : Strategy for insertion of the CAG-loxPSTOPloxP-Cas9-IRES-EGFP cassette into the mouse Rosa26 locus. sgRosa26-1 and Cas9 introduce a double-strand break between 1 kb and 4 kb fragments used as homology arms in the targeting vector. Homology-directed repair (HDR) leads to the insertion of the cassette into the genome. The locations of PCR primers, restriction sites and the Rosa26 hybridisation probe in the targeted and wildtype alleles are indicated. b : Gel electrophoresis of XbaI digested Rosa26 PCR products (R26F2/R2 primers) amplified from pups (#7-#46) derived from microinjections of targeting vector, sgRosa26-1 and Cas9 RNAs. 0.2 kb bands of XbaI resistant products (mut) indicate sequence deletions, wildtype products (wt) are reduced to 0.1 kb. M - size marker, B6 - C57BL/6 wildtype control. c : PCR detection of an internal segment of Cas9 in pups derived from microinjections using primers Cas9F/Cas9R (top). Bottom: three primer PCR for the simultaneous detection of the Rosa26 target region (R26F2/R2 primers, 0.2 kb) and of vector sequences (R26F2-SAR, 0.12 kb), showing that all samples harbor at least one nonrecombined Rosa26 allele. V – vector positive control, H 2 O – negative control. d : Cas9-positive mice (from b ) were further tested for correct knock-in (KI) into Rosa26 using a PCR reaction with a forward primer located outside of the 5′-homology region (R26F3) and a reverse primer located in transgene (SAR); the predicted band has a size of 1.38 kb (top). Bottom: DNA quality was controlled with a Cas9 internal PCR (Cas9F/R primers,0.38 kb). H 2 O – negative control. e : Southern blot analysis of EcoRI digested tail DNA from Cas9-positive mice (from b ) using an external Rosa26 -specific hybridization. Knock-in alleles are predicted to show a 6 kb band. Control – DNA from a Rosa26 knock-in mouse generated from ES cells, C57BL/6 – wildtype control. f : Genotyping PCR of 15 F1 pups derived from founder mutants #35 or #39 using the Cas9 internal primer pair Cas9F/R. g : Southern blot analysis of EcoRI digested tail DNA from two F1 pups using an external Rosa26 -specific hybridization probe. Control – DNA from a Rosa26 knock-in mouse generated from ES cells, C57BL/6 – wildtype control

    Journal: BMC Biotechnology

    Article Title: Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes

    doi: 10.1186/s12896-016-0234-4

    Figure Lengend Snippet: Knock-in of a conditional Cas9 transgene into Rosa26 of C57BL/6 zygotes. a : Strategy for insertion of the CAG-loxPSTOPloxP-Cas9-IRES-EGFP cassette into the mouse Rosa26 locus. sgRosa26-1 and Cas9 introduce a double-strand break between 1 kb and 4 kb fragments used as homology arms in the targeting vector. Homology-directed repair (HDR) leads to the insertion of the cassette into the genome. The locations of PCR primers, restriction sites and the Rosa26 hybridisation probe in the targeted and wildtype alleles are indicated. b : Gel electrophoresis of XbaI digested Rosa26 PCR products (R26F2/R2 primers) amplified from pups (#7-#46) derived from microinjections of targeting vector, sgRosa26-1 and Cas9 RNAs. 0.2 kb bands of XbaI resistant products (mut) indicate sequence deletions, wildtype products (wt) are reduced to 0.1 kb. M - size marker, B6 - C57BL/6 wildtype control. c : PCR detection of an internal segment of Cas9 in pups derived from microinjections using primers Cas9F/Cas9R (top). Bottom: three primer PCR for the simultaneous detection of the Rosa26 target region (R26F2/R2 primers, 0.2 kb) and of vector sequences (R26F2-SAR, 0.12 kb), showing that all samples harbor at least one nonrecombined Rosa26 allele. V – vector positive control, H 2 O – negative control. d : Cas9-positive mice (from b ) were further tested for correct knock-in (KI) into Rosa26 using a PCR reaction with a forward primer located outside of the 5′-homology region (R26F3) and a reverse primer located in transgene (SAR); the predicted band has a size of 1.38 kb (top). Bottom: DNA quality was controlled with a Cas9 internal PCR (Cas9F/R primers,0.38 kb). H 2 O – negative control. e : Southern blot analysis of EcoRI digested tail DNA from Cas9-positive mice (from b ) using an external Rosa26 -specific hybridization. Knock-in alleles are predicted to show a 6 kb band. Control – DNA from a Rosa26 knock-in mouse generated from ES cells, C57BL/6 – wildtype control. f : Genotyping PCR of 15 F1 pups derived from founder mutants #35 or #39 using the Cas9 internal primer pair Cas9F/R. g : Southern blot analysis of EcoRI digested tail DNA from two F1 pups using an external Rosa26 -specific hybridization probe. Control – DNA from a Rosa26 knock-in mouse generated from ES cells, C57BL/6 – wildtype control

    Article Snippet: For the RLFP assay, PCR products were digested with the restriction enzyme XbaI (Thermo Scientific).

    Techniques: Knock-In, Introduce, Plasmid Preparation, Polymerase Chain Reaction, Hybridization, Nucleic Acid Electrophoresis, Amplification, Derivative Assay, Sequencing, Marker, Positive Control, Negative Control, Mouse Assay, Southern Blot, Generated

    Cas9 is functional in B cells of Rosa26 LSL-Cas9 knock-in mice. a : Scheme of genome editing in primary mouse B cells using CRISPR/Cas9. Naive B cells from spleens of three individual heterozygous Rosa26 LSL-Cas9 F1 mice were isolated using CD43 depletion, treated with TAT-Cre and stimulated with LPS for 24 h. TAT-Cre/LPS treated B cells were transduced with retroviral particles co-expressing sgRosa26-1 and BFP to target the Rosa26 locus. One day later, the transduced B cells were selected with puromycin until day 5. b : FACS analysis of B cells (from a ) before (day 2) and after puromycin selection (day 5). The gate indicates the fraction (percentage) of successfully transduced BFP + cells. c : Gel electrophoresis of T7EI or XbaI digested PCR products (R26T7F/R26T7R primers) amplified from DNA of FACS sorted BFP + cells (from b ), indicating sequence deletions by the presence of T7EI sensitive or XbaI resistant bands (arrows)

    Journal: BMC Biotechnology

    Article Title: Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes

    doi: 10.1186/s12896-016-0234-4

    Figure Lengend Snippet: Cas9 is functional in B cells of Rosa26 LSL-Cas9 knock-in mice. a : Scheme of genome editing in primary mouse B cells using CRISPR/Cas9. Naive B cells from spleens of three individual heterozygous Rosa26 LSL-Cas9 F1 mice were isolated using CD43 depletion, treated with TAT-Cre and stimulated with LPS for 24 h. TAT-Cre/LPS treated B cells were transduced with retroviral particles co-expressing sgRosa26-1 and BFP to target the Rosa26 locus. One day later, the transduced B cells were selected with puromycin until day 5. b : FACS analysis of B cells (from a ) before (day 2) and after puromycin selection (day 5). The gate indicates the fraction (percentage) of successfully transduced BFP + cells. c : Gel electrophoresis of T7EI or XbaI digested PCR products (R26T7F/R26T7R primers) amplified from DNA of FACS sorted BFP + cells (from b ), indicating sequence deletions by the presence of T7EI sensitive or XbaI resistant bands (arrows)

    Article Snippet: For the RLFP assay, PCR products were digested with the restriction enzyme XbaI (Thermo Scientific).

    Techniques: Functional Assay, Knock-In, Mouse Assay, CRISPR, Isolation, Transduction, Expressing, FACS, Selection, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Amplification, Sequencing

    Sender plasmids expressed in Escherichia coli BL21. (A) The modular Sender vector allows facile cloning of any EcoRI , XbaI -flanked synthase open reading frame (ORF) and co-expression with mCherry (mCh) from a single bicistronic mRNA. The vector is represented as SBOL [ 44 ] glyphs (top) and a scaled circular map (bottom). (B) Optical density (OD) readings for E . coli cultures expressing each of the Sender plasmids. (C) mCherry expression is shown as end-point RFP signal normalized to OD 600 after an 8 hour growth period.

    Journal: PLoS ONE

    Article Title: Characterization of diverse homoserine lactone synthases in Escherichia coli

    doi: 10.1371/journal.pone.0202294

    Figure Lengend Snippet: Sender plasmids expressed in Escherichia coli BL21. (A) The modular Sender vector allows facile cloning of any EcoRI , XbaI -flanked synthase open reading frame (ORF) and co-expression with mCherry (mCh) from a single bicistronic mRNA. The vector is represented as SBOL [ 44 ] glyphs (top) and a scaled circular map (bottom). (B) Optical density (OD) readings for E . coli cultures expressing each of the Sender plasmids. (C) mCherry expression is shown as end-point RFP signal normalized to OD 600 after an 8 hour growth period.

    Article Snippet: The Modular Sender Vector and each HSL synthase oligo were cut with EcoRI and XbaI (Thermo Fisher Scientific) and ligated using T4 ligase (New England Biolabs).

    Techniques: Plasmid Preparation, Clone Assay, Expressing

    Southern blot of REFs and SRPPs in genomic DNA isolated from rubber tree clone RY 7-33-97. Endonucleases Eco R I, Hind III, Xba I, and Xho I were used for digestion of genomic DNA. DNA molecular mass markers are shown on the left.

    Journal: International Journal of Molecular Sciences

    Article Title: Comparative Proteomics of Rubber Latex Revealed Multiple Protein Species of REF/SRPP Family Respond Diversely to Ethylene Stimulation among Different Rubber Tree Clones

    doi: 10.3390/ijms18050958

    Figure Lengend Snippet: Southern blot of REFs and SRPPs in genomic DNA isolated from rubber tree clone RY 7-33-97. Endonucleases Eco R I, Hind III, Xba I, and Xho I were used for digestion of genomic DNA. DNA molecular mass markers are shown on the left.

    Article Snippet: H. brasiliensis genomic DNA was extracted from the leaves of rubber tree and digested with Bam H I, Eco R I, Hind III, and Xba I (Thermo Scientific, Guangzhou, China).

    Techniques: Southern Blot, Isolation