xbai  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    XbaI 10 U µL
    Description:
    5 T ↓C T A G A 3 3 A G A T C ↑T 5 Thermo Scientific XbaI restriction enzyme recognizes T CTAGA sites and cuts best at 37°C in Tango buffer See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Note Also available as a FastDigest enzyme for rapid DNA digestion Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    Catalog Number:
    er0681
    Price:
    None
    Category:
    Proteins Enzymes Peptides
    Applications:
    Cloning|Restriction Enzyme Cloning
    Buy from Supplier


    Structured Review

    Thermo Fisher xbai
    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are <t>EcoRI,</t> HinDIII and <t>XbaI</t> . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
    5 T ↓C T A G A 3 3 A G A T C ↑T 5 Thermo Scientific XbaI restriction enzyme recognizes T CTAGA sites and cuts best at 37°C in Tango buffer See Reaction Conditions for Restriction Enzymes for a table of enzyme activity conditions for double digestion and heat inactivation for this and other restriction enzymes Note Also available as a FastDigest enzyme for rapid DNA digestion Thermo Scientific conventional restriction endonucleases are a large collection of high quality restriction enzymes optimized to work in one of the buffers of the Five Buffer System In addition the universal Tango buffer is provided for convenience in double digestions All of the enzymes exhibit 100 activity in the recommended buffer and reaction conditions To ensure consistent performance Thermo Scientific restriction enzyme reaction buffers contain premixed BSA which enhances the stability of many enzymes and binds contaminants that may be present in DNA preparations Features• Superior quality stringent quality control and industry leading manufacturing process• Convenient color coded Five Buffer System• Includes universal Tango buffer for double digestions• BSA premixed in reaction buffers• Wide selection of restriction endonuclease specificitiesApplications• Molecular cloning• Restriction site mapping• Genotyping• Southern blotting• Restriction fragment length polymorphism RFLP • SNPNote For methylation sensitivity refer to product specifications
    https://www.bioz.com/result/xbai/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2021-03
    86/100 stars

    Images

    1) Product Images from "Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)"

    Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

    Journal: 3 Biotech

    doi: 10.1007/s13205-018-1552-0

    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
    Figure Legend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Techniques Used: Southern Blot, Molecular Weight, Marker, Hybridization

    Related Articles

    Plasmid Preparation:

    Article Title: Bidirectional silencing of RNA polymerase I transcription by a strand switch region in Trypanosoma brucei
    Article Snippet: The product was digested with XbaI and SpeI (part of the amplified pBluescript backbone, compatible with XbaI) and cloned into the XbaI site of pG-640-CAT/EP2. pG-1240-CAT/EP2 (1240F ): the first 1240 bp of PAG1 were amplified by PCR with the primers PAG1down2 and 1240up on the genomic DNA clone λPAG2-711 and the product cloned into pCR®2.1-TOPO (Invitrogen). .. The insert was excised with XhoI (cuts within the vector backbone 5′ to the PAG1 insert) and XbaI and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240rev-CAT/EP2 (1240R ): the first 1240 bp of PAG1 were amplified by PCR from pG-1240-CAT/EP2 with the primers PAG1down3 and 1240up3 and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240-neo-CAT/EP2 (1240F -neo): the same strategy was used as for pG-640-neo-CAT/EP2, however the neo fragment was cloned into XbaI site of pG-1240-CAT/EP2. pG-PAG1end-CAT/EP2 (ORFF ): to obtain the fragment with the PAG1 sequence from its internal HindIII site at 1087 to position 2458, a PCR was performed with the template pBS-711-HN ( ) and the primers M13r (Invitrogen) and PAG1up2. .. The product was digested with HindIII and XbaI and cloned into the corresponding sites of pG-mcs-CAT/EP2. pG-PAG1end-rev-CAT/EP2 (ORFR ): the same strategy was used as for pG-PAG1end-CAT/EP2 using the primers PAGmid and PAG1up3. pG-662_1240-CAT/EP2 (MidF ): the PAG1 sequence from 662 to 1240 was amplified by PCR with the primers 640down and 1240up on template pG-1240-CAT/EP2.

    Article Title: Cloning and Expression of Recombinant Human Interleukin-7 in Chinese Hamster Ovary (CHO) Cells
    Article Snippet: Plasmid Construction The full-length coding sequence of human IL-7 ( ) was commercially synthesized in pUC57 by ShineGene (Shanghai, China). .. After digestion with SalI and XbaI restriction endonucleases (Thermo Fisher Scientific, Vilnius, Lithuania), the gelpurified DNA fragment (Silica Bead DNA Gel Extraction Kit, Invitrogen, CA, USA) was inserted into the SalI/XbaI site of the pBudCE4.1 expression vector (Invitrogen) downstream of the CMV promoter to create pBud-h IL -7. .. Following the ligation, pBud-h IL -7 was transformed into competent E. coli DH5α cells.

    Article Title: Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis
    Article Snippet: Construction of the recombinant pcDNA3.1 (+)/HspX-PPE44-EsxV vector The optimized HspX-PPE44-EsxV fusion segment was synthesized in the pGH vector by Generay Company (China) in BamHI and XbaI restriction sites at the 5´and 3´ ends. .. Then the generated HspX-PPE44-EsxV, along with vector, was digested with BamHI and XbaI restriction enzymes and ligated into pcDNA3.1 (+) (Invitrogen, USA) in BamHI and XbaI restriction sites at the 5´and 3´ ends ( ). .. This plasmid was used to transform competent E. coli , Top-10 strain.

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: 4.2. pP15A, kanaR Vector Confirmation PCR amplification of the M13K07 plasmid DNA fragment containing P15A origin of replication and kanaR gene resulted in a 2592-bp band on agarose gel electrophoresis ( ). .. The plasmid DNA purified from a single positive clone containing self-ligated pP15A, kanaR was confirmed by both single and double digestion reactions with BamHI and XbaI restriction enzymes ( ). .. ZFN Cloning in pP15A, kanaR Digestion of pZFN with BamHI-XbaI resulted in two restricted DNA fragments , which confirmed cloning of ZFN expression cassette in the pP15A,KanaR vector.

    Clone Assay:

    Article Title: Bidirectional silencing of RNA polymerase I transcription by a strand switch region in Trypanosoma brucei
    Article Snippet: The product was digested with XbaI and SpeI (part of the amplified pBluescript backbone, compatible with XbaI) and cloned into the XbaI site of pG-640-CAT/EP2. pG-1240-CAT/EP2 (1240F ): the first 1240 bp of PAG1 were amplified by PCR with the primers PAG1down2 and 1240up on the genomic DNA clone λPAG2-711 and the product cloned into pCR®2.1-TOPO (Invitrogen). .. The insert was excised with XhoI (cuts within the vector backbone 5′ to the PAG1 insert) and XbaI and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240rev-CAT/EP2 (1240R ): the first 1240 bp of PAG1 were amplified by PCR from pG-1240-CAT/EP2 with the primers PAG1down3 and 1240up3 and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240-neo-CAT/EP2 (1240F -neo): the same strategy was used as for pG-640-neo-CAT/EP2, however the neo fragment was cloned into XbaI site of pG-1240-CAT/EP2. pG-PAG1end-CAT/EP2 (ORFF ): to obtain the fragment with the PAG1 sequence from its internal HindIII site at 1087 to position 2458, a PCR was performed with the template pBS-711-HN ( ) and the primers M13r (Invitrogen) and PAG1up2. .. The product was digested with HindIII and XbaI and cloned into the corresponding sites of pG-mcs-CAT/EP2. pG-PAG1end-rev-CAT/EP2 (ORFR ): the same strategy was used as for pG-PAG1end-CAT/EP2 using the primers PAGmid and PAG1up3. pG-662_1240-CAT/EP2 (MidF ): the PAG1 sequence from 662 to 1240 was amplified by PCR with the primers 640down and 1240up on template pG-1240-CAT/EP2.

    Article Title: The development and characterization of SDF1α-elastin-like-peptide nanoparticles for wound healing
    Article Snippet: SDF1 was fused to ELP via these 2 restriction sites. .. The NdeI and XbaI restriction enzymes and DNA ligation kit used for cloning were obtained from Thermo Fisher Scientific. .. The SDF1 gene string used was designed and ordered from Life Technologies as follows: GGCACCTCGATTAGTTCTCGTCTAGAATGAATGCGAAAGTCGTTGTCGTGCTGGTGTTGGTCTTAACTGCACTGTGTTTGTCTGATGGTAAACCGGTGAGTCTTTCGTACCGTTGCCCGTGCCGTTTCTTCGAATCACATGTTGCTCGCGCGAACGTGAAACACCTGAAAATTTTGAATACGCCGAATTGCGCACTGCAGATTGTGGCGCGTCTGAAAAACAATAACCGCCAGGTATGCATCGACCCTAAACTGAAGTGGATTCAAGAATATCTTGAAAAAGCACTTAACAAAGGTGGGGGTGGCTCTGGGGGCGGTGGTTCCGGAGGTGGTGGATCACATATGGAGTTCATGCGCTTCAAGGT The SDF1 Gene string™ was amplified using Pfu Ultra II (Agilent Technologies) and Kapa Hifi (Kapa Biosystems) polymerases.

    Amplification:

    Article Title: Bidirectional silencing of RNA polymerase I transcription by a strand switch region in Trypanosoma brucei
    Article Snippet: The product was digested with XbaI and SpeI (part of the amplified pBluescript backbone, compatible with XbaI) and cloned into the XbaI site of pG-640-CAT/EP2. pG-1240-CAT/EP2 (1240F ): the first 1240 bp of PAG1 were amplified by PCR with the primers PAG1down2 and 1240up on the genomic DNA clone λPAG2-711 and the product cloned into pCR®2.1-TOPO (Invitrogen). .. The insert was excised with XhoI (cuts within the vector backbone 5′ to the PAG1 insert) and XbaI and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240rev-CAT/EP2 (1240R ): the first 1240 bp of PAG1 were amplified by PCR from pG-1240-CAT/EP2 with the primers PAG1down3 and 1240up3 and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240-neo-CAT/EP2 (1240F -neo): the same strategy was used as for pG-640-neo-CAT/EP2, however the neo fragment was cloned into XbaI site of pG-1240-CAT/EP2. pG-PAG1end-CAT/EP2 (ORFF ): to obtain the fragment with the PAG1 sequence from its internal HindIII site at 1087 to position 2458, a PCR was performed with the template pBS-711-HN ( ) and the primers M13r (Invitrogen) and PAG1up2. .. The product was digested with HindIII and XbaI and cloned into the corresponding sites of pG-mcs-CAT/EP2. pG-PAG1end-rev-CAT/EP2 (ORFR ): the same strategy was used as for pG-PAG1end-CAT/EP2 using the primers PAGmid and PAG1up3. pG-662_1240-CAT/EP2 (MidF ): the PAG1 sequence from 662 to 1240 was amplified by PCR with the primers 640down and 1240up on template pG-1240-CAT/EP2.

    Polymerase Chain Reaction:

    Article Title: Bidirectional silencing of RNA polymerase I transcription by a strand switch region in Trypanosoma brucei
    Article Snippet: The product was digested with XbaI and SpeI (part of the amplified pBluescript backbone, compatible with XbaI) and cloned into the XbaI site of pG-640-CAT/EP2. pG-1240-CAT/EP2 (1240F ): the first 1240 bp of PAG1 were amplified by PCR with the primers PAG1down2 and 1240up on the genomic DNA clone λPAG2-711 and the product cloned into pCR®2.1-TOPO (Invitrogen). .. The insert was excised with XhoI (cuts within the vector backbone 5′ to the PAG1 insert) and XbaI and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240rev-CAT/EP2 (1240R ): the first 1240 bp of PAG1 were amplified by PCR from pG-1240-CAT/EP2 with the primers PAG1down3 and 1240up3 and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240-neo-CAT/EP2 (1240F -neo): the same strategy was used as for pG-640-neo-CAT/EP2, however the neo fragment was cloned into XbaI site of pG-1240-CAT/EP2. pG-PAG1end-CAT/EP2 (ORFF ): to obtain the fragment with the PAG1 sequence from its internal HindIII site at 1087 to position 2458, a PCR was performed with the template pBS-711-HN ( ) and the primers M13r (Invitrogen) and PAG1up2. .. The product was digested with HindIII and XbaI and cloned into the corresponding sites of pG-mcs-CAT/EP2. pG-PAG1end-rev-CAT/EP2 (ORFR ): the same strategy was used as for pG-PAG1end-CAT/EP2 using the primers PAGmid and PAG1up3. pG-662_1240-CAT/EP2 (MidF ): the PAG1 sequence from 662 to 1240 was amplified by PCR with the primers 640down and 1240up on template pG-1240-CAT/EP2.

    Sequencing:

    Article Title: Bidirectional silencing of RNA polymerase I transcription by a strand switch region in Trypanosoma brucei
    Article Snippet: The product was digested with XbaI and SpeI (part of the amplified pBluescript backbone, compatible with XbaI) and cloned into the XbaI site of pG-640-CAT/EP2. pG-1240-CAT/EP2 (1240F ): the first 1240 bp of PAG1 were amplified by PCR with the primers PAG1down2 and 1240up on the genomic DNA clone λPAG2-711 and the product cloned into pCR®2.1-TOPO (Invitrogen). .. The insert was excised with XhoI (cuts within the vector backbone 5′ to the PAG1 insert) and XbaI and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240rev-CAT/EP2 (1240R ): the first 1240 bp of PAG1 were amplified by PCR from pG-1240-CAT/EP2 with the primers PAG1down3 and 1240up3 and cloned into the XhoI and XbaI sites of pG-mcs-CAT/EP2. pG-1240-neo-CAT/EP2 (1240F -neo): the same strategy was used as for pG-640-neo-CAT/EP2, however the neo fragment was cloned into XbaI site of pG-1240-CAT/EP2. pG-PAG1end-CAT/EP2 (ORFF ): to obtain the fragment with the PAG1 sequence from its internal HindIII site at 1087 to position 2458, a PCR was performed with the template pBS-711-HN ( ) and the primers M13r (Invitrogen) and PAG1up2. .. The product was digested with HindIII and XbaI and cloned into the corresponding sites of pG-mcs-CAT/EP2. pG-PAG1end-rev-CAT/EP2 (ORFR ): the same strategy was used as for pG-PAG1end-CAT/EP2 using the primers PAGmid and PAG1up3. pG-662_1240-CAT/EP2 (MidF ): the PAG1 sequence from 662 to 1240 was amplified by PCR with the primers 640down and 1240up on template pG-1240-CAT/EP2.

    Pulsed-Field Gel:

    Article Title: Molecular Characterization of Carbapenem Resistant Klebsiella pneumoniae and Klebsiella quasipneumoniae Isolated from Lebanon
    Article Snippet: .. Pulsed-field gel electrophoresis (PFGE) PFGE fingerprinting was performed using the XbaI restriction enzyme (ThermoScientific, Waltham, MA, USA), 1% SeaKem agarose gel, and the universal laboratory standard Salmonella enterica subsp. enterica serovar Braenderup (ATCC® BAA664™) according to the standard PulseNet protocol ( http://www.pulsenetinternational.org ). .. Electrophoresis was performed using the Bio-Rad laboratories CHEF DR-III system (Bio-Rad Laboratories, Bio-Rad Laboratories Inc., Hercules, CA, USA) with a run time of 12 h and switch time of 5–40 s ( https://www.cdc.gov/pulsenet/ ).

    Agarose Gel Electrophoresis:

    Article Title: Molecular Characterization of Carbapenem Resistant Klebsiella pneumoniae and Klebsiella quasipneumoniae Isolated from Lebanon
    Article Snippet: .. Pulsed-field gel electrophoresis (PFGE) PFGE fingerprinting was performed using the XbaI restriction enzyme (ThermoScientific, Waltham, MA, USA), 1% SeaKem agarose gel, and the universal laboratory standard Salmonella enterica subsp. enterica serovar Braenderup (ATCC® BAA664™) according to the standard PulseNet protocol ( http://www.pulsenetinternational.org ). .. Electrophoresis was performed using the Bio-Rad laboratories CHEF DR-III system (Bio-Rad Laboratories, Bio-Rad Laboratories Inc., Hercules, CA, USA) with a run time of 12 h and switch time of 5–40 s ( https://www.cdc.gov/pulsenet/ ).

    Gel Extraction:

    Article Title: Cloning and Expression of Recombinant Human Interleukin-7 in Chinese Hamster Ovary (CHO) Cells
    Article Snippet: Plasmid Construction The full-length coding sequence of human IL-7 ( ) was commercially synthesized in pUC57 by ShineGene (Shanghai, China). .. After digestion with SalI and XbaI restriction endonucleases (Thermo Fisher Scientific, Vilnius, Lithuania), the gelpurified DNA fragment (Silica Bead DNA Gel Extraction Kit, Invitrogen, CA, USA) was inserted into the SalI/XbaI site of the pBudCE4.1 expression vector (Invitrogen) downstream of the CMV promoter to create pBud-h IL -7. .. Following the ligation, pBud-h IL -7 was transformed into competent E. coli DH5α cells.

    Expressing:

    Article Title: Cloning and Expression of Recombinant Human Interleukin-7 in Chinese Hamster Ovary (CHO) Cells
    Article Snippet: Plasmid Construction The full-length coding sequence of human IL-7 ( ) was commercially synthesized in pUC57 by ShineGene (Shanghai, China). .. After digestion with SalI and XbaI restriction endonucleases (Thermo Fisher Scientific, Vilnius, Lithuania), the gelpurified DNA fragment (Silica Bead DNA Gel Extraction Kit, Invitrogen, CA, USA) was inserted into the SalI/XbaI site of the pBudCE4.1 expression vector (Invitrogen) downstream of the CMV promoter to create pBud-h IL -7. .. Following the ligation, pBud-h IL -7 was transformed into competent E. coli DH5α cells.

    Generated:

    Article Title: Construction of a Novel DNA Vaccine Candidate Encoding an HspX-PPE44-EsxV Fusion Antigen of Mycobacterium tuberculosis
    Article Snippet: Construction of the recombinant pcDNA3.1 (+)/HspX-PPE44-EsxV vector The optimized HspX-PPE44-EsxV fusion segment was synthesized in the pGH vector by Generay Company (China) in BamHI and XbaI restriction sites at the 5´and 3´ ends. .. Then the generated HspX-PPE44-EsxV, along with vector, was digested with BamHI and XbaI restriction enzymes and ligated into pcDNA3.1 (+) (Invitrogen, USA) in BamHI and XbaI restriction sites at the 5´and 3´ ends ( ). .. This plasmid was used to transform competent E. coli , Top-10 strain.

    Purification:

    Article Title: Zinc Finger Nuclease: A New Approach to Overcome Beta-Lactam Antibiotic Resistance
    Article Snippet: 4.2. pP15A, kanaR Vector Confirmation PCR amplification of the M13K07 plasmid DNA fragment containing P15A origin of replication and kanaR gene resulted in a 2592-bp band on agarose gel electrophoresis ( ). .. The plasmid DNA purified from a single positive clone containing self-ligated pP15A, kanaR was confirmed by both single and double digestion reactions with BamHI and XbaI restriction enzymes ( ). .. ZFN Cloning in pP15A, kanaR Digestion of pZFN with BamHI-XbaI resulted in two restricted DNA fragments , which confirmed cloning of ZFN expression cassette in the pP15A,KanaR vector.

    DNA Ligation:

    Article Title: The development and characterization of SDF1α-elastin-like-peptide nanoparticles for wound healing
    Article Snippet: SDF1 was fused to ELP via these 2 restriction sites. .. The NdeI and XbaI restriction enzymes and DNA ligation kit used for cloning were obtained from Thermo Fisher Scientific. .. The SDF1 gene string used was designed and ordered from Life Technologies as follows: GGCACCTCGATTAGTTCTCGTCTAGAATGAATGCGAAAGTCGTTGTCGTGCTGGTGTTGGTCTTAACTGCACTGTGTTTGTCTGATGGTAAACCGGTGAGTCTTTCGTACCGTTGCCCGTGCCGTTTCTTCGAATCACATGTTGCTCGCGCGAACGTGAAACACCTGAAAATTTTGAATACGCCGAATTGCGCACTGCAGATTGTGGCGCGTCTGAAAAACAATAACCGCCAGGTATGCATCGACCCTAAACTGAAGTGGATTCAAGAATATCTTGAAAAAGCACTTAACAAAGGTGGGGGTGGCTCTGGGGGCGGTGGTTCCGGAGGTGGTGGATCACATATGGAGTTCATGCGCTTCAAGGT The SDF1 Gene string™ was amplified using Pfu Ultra II (Agilent Technologies) and Kapa Hifi (Kapa Biosystems) polymerases.

    Mutagenesis:

    Article Title: Mutation of the histidin residue of the DRH motif in vasopressin V2 receptor expression and function
    Article Snippet: The PCR products were confirmed by staining of the agarose gel with ethidium bromide using a UV transilluminator, and the obtained DNA bands were detected. .. The products containing the desired mutation were digested by BamHI, EcoRI and XbaI restriction enzymes (Fermentas). .. DNA was extracted from the agarose gel using QIAquic kit (Qiagen, Valencia, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Thermo Fisher xbai
    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are <t>EcoRI,</t> HinDIII and <t>XbaI</t> . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization
    Xbai, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2021-03
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher xba i
    Combined numerical analysis of PFGE results obtained after <t>Xba</t> I and <t>Dra</t> I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.
    Xba I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2021-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Journal: 3 Biotech

    Article Title: Sequence-tagged site-based diagnostic markers linked to a novel anthracnose resistance gene RCt1 in chili pepper (Capsicum annuum L.)

    doi: 10.1007/s13205-018-1552-0

    Figure Lengend Snippet: Southern blot analysis of the four STS markers- CtR-431, CtR-594., CtR-496, and AFLP-376. Restriction enzymes used are EcoRI, HinDIII and XbaI . M, molecular weight marker; R resistant genotype Punjab Lal; S susceptible genotype Arka Lohit. Hybridization

    Article Snippet: Three different restriction endonucleases- EcoRI, HinDIII and XbaI (Thermo Fischer Scientific, USA) were used to digest the genomic DNA from the resistant line ‘Punjab Lal’ and the susceptible line ‘Arka Lohit’.

    Techniques: Southern Blot, Molecular Weight, Marker, Hybridization

    Combined numerical analysis of PFGE results obtained after Xba I and Dra I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.

    Journal: Journal of Clinical Microbiology

    Article Title: A Molecular Epidemiological Study of Mycobacterium simiae Isolated from AIDS Patients in Guadeloupe

    doi:

    Figure Lengend Snippet: Combined numerical analysis of PFGE results obtained after Xba I and Dra I digestions using the unweighted pair group method using arithmetic averages. A to I, individual patient isolates (A1, A2, etc., represent serial isolates from a same patient). The scale shows the Dice index.

    Article Snippet: Plugs were prepared as previously described , and bacterial DNA was digested with 30 U of Dra I or 60 U of Xba I (Gibco-BRL Life Technologies) at 37°C for 2 h. After digestion, the plugs were loaded into a 1% (wt/vol) agarose gel (Gibco BRL).

    Techniques:

    RAPD (A to D) and PFGE (E to H) profiles of M. simiae isolates. Representative RAPD patterns with the primers 4 (A) and 10 (C) for one isolate per patient and the results obtained with serial isolates from selected patients with primer 4 (B and D) are shown. Panels E and F show representative PFGE patterns obtained with Xba I- and Dra I-digested DNAs for patients with polyclonal infections. All of the 22 PFGE profiles obtained are illustrated in dendrograms shown in panels G and H. Samples for RAPD experiments were run in duplicate. T, template DNA control; M, molecular weight marker; A to I, individual patient isolates (A1, A2, etc., represent serial isolates from the same patient). The scale in panels G and H shows the Dice index.

    Journal: Journal of Clinical Microbiology

    Article Title: A Molecular Epidemiological Study of Mycobacterium simiae Isolated from AIDS Patients in Guadeloupe

    doi:

    Figure Lengend Snippet: RAPD (A to D) and PFGE (E to H) profiles of M. simiae isolates. Representative RAPD patterns with the primers 4 (A) and 10 (C) for one isolate per patient and the results obtained with serial isolates from selected patients with primer 4 (B and D) are shown. Panels E and F show representative PFGE patterns obtained with Xba I- and Dra I-digested DNAs for patients with polyclonal infections. All of the 22 PFGE profiles obtained are illustrated in dendrograms shown in panels G and H. Samples for RAPD experiments were run in duplicate. T, template DNA control; M, molecular weight marker; A to I, individual patient isolates (A1, A2, etc., represent serial isolates from the same patient). The scale in panels G and H shows the Dice index.

    Article Snippet: Plugs were prepared as previously described , and bacterial DNA was digested with 30 U of Dra I or 60 U of Xba I (Gibco-BRL Life Technologies) at 37°C for 2 h. After digestion, the plugs were loaded into a 1% (wt/vol) agarose gel (Gibco BRL).

    Techniques: Molecular Weight, Marker

    Dendrogram generated by BioNumerics software with 1% optimization and 1% position tolerance, showing the results of cluster analysis of band patterns after digestion of DNA from 42 isolates of Salmonella enterica serovar Typhimurium with the XbaI restriction

    Journal: Canadian Journal of Veterinary Research

    Article Title: Antimicrobial resistance, virulence-associated genes, and pulsed-field gel electrophoresis profiles of Salmonella enterica subsp. enterica serovar Typhimurium isolated from piglets with diarrhea in Korea

    doi:

    Figure Lengend Snippet: Dendrogram generated by BioNumerics software with 1% optimization and 1% position tolerance, showing the results of cluster analysis of band patterns after digestion of DNA from 42 isolates of Salmonella enterica serovar Typhimurium with the XbaI restriction

    Article Snippet: Briefly, agarose-embedded DNA was digested with 30 U of restriction enzyme XbaI (Fermentas International, Burlington, Ontario) overnight in a water bath at 37°C.

    Techniques: Generated, Software

    The 576-bp PcCdc42 probe hybridizes to Pneumocystis genomic DNA. Freshly isolated Pc ( lanes 1–3 ) and rat ( lanes 5–7 ) genomic DNA were digested with the restriction endonucleases Bam HI ( lanes 1 and 5 ), Xho I ( lanes 2 and 6 ), and Xba I ( lanes 3 and 7 ). The digestion products were separated by electrophoresis and transferred to nitrocellulose. The 576-bp PcCdc42 amplicon was labeled and hybridized to the membrane showing specific interaction with the Pc digestions. No hybridization was noted in the rat genomic DNA lane.

    Journal: American Journal of Physiology - Lung Cellular and Molecular Physiology

    Article Title: Characterization of the PcCdc42 small G protein from Pneumocystis carinii, which interacts with the PcSte20 life cycle regulatory kinase

    doi: 10.1152/ajplung.00191.2009

    Figure Lengend Snippet: The 576-bp PcCdc42 probe hybridizes to Pneumocystis genomic DNA. Freshly isolated Pc ( lanes 1–3 ) and rat ( lanes 5–7 ) genomic DNA were digested with the restriction endonucleases Bam HI ( lanes 1 and 5 ), Xho I ( lanes 2 and 6 ), and Xba I ( lanes 3 and 7 ). The digestion products were separated by electrophoresis and transferred to nitrocellulose. The 576-bp PcCdc42 amplicon was labeled and hybridized to the membrane showing specific interaction with the Pc digestions. No hybridization was noted in the rat genomic DNA lane.

    Article Snippet: In addition, the 576-bp amplicon was also hybridized to Pc genomic DNA digested with the restriction enzymes Bam HI, Xho I, and Xba I (Invitrogen).

    Techniques: Isolation, Electrophoresis, Amplification, Labeling, Hybridization