Structured Review

Promega xbai
(A) Southern blot hybridization with the <t>p1-9</t> probe of <t>XbaI-digested</t> genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain
Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 98/100, based on 170 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xbai/product/Promega
Average 98 stars, based on 170 article reviews
Price from $9.99 to $1999.99
xbai - by Bioz Stars, 2020-02
98/100 stars

Images

1) Product Images from "Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence"

Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00732-12

(A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain
Figure Legend Snippet: (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

Techniques Used: Southern Blot, Hybridization

2) Product Images from "Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves"

Article Title: Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.71.11.6680-6688.2005

(a) Rank abundance curve for the PFGE genotypes ( n = 56) observed in the Amp r single-pick collection ( n = 419), with nominated groups represented by the relevant letter, isolate pairs by “2,” and unique isolates by “1.” (b) Comparison of PFGE banding patterns after digestion with XbaI for a typical example from each of the nominated groups in both the Amp r ( n = 24) and Nal r ( *; n = 2) single-pick isolate collections, showing the percent similarity between group types and band sizes in kilobase pairs (kb).
Figure Legend Snippet: (a) Rank abundance curve for the PFGE genotypes ( n = 56) observed in the Amp r single-pick collection ( n = 419), with nominated groups represented by the relevant letter, isolate pairs by “2,” and unique isolates by “1.” (b) Comparison of PFGE banding patterns after digestion with XbaI for a typical example from each of the nominated groups in both the Amp r ( n = 24) and Nal r ( *; n = 2) single-pick isolate collections, showing the percent similarity between group types and band sizes in kilobase pairs (kb).

Techniques Used:

3) Product Images from "Differential regulation of mouse and human Mu opioid receptor gene depends on the single stranded DNA structure of its promoter and α-complex protein 1"

Article Title: Differential regulation of mouse and human Mu opioid receptor gene depends on the single stranded DNA structure of its promoter and α-complex protein 1

Journal: Biomedical Reports

doi: 10.3892/br.2017.877

S1 nuclease sensitivity of PPy/u motif-containing plasmids. (A) The PPy/u motif-containing promoters fused with the promoterless pGL3-basic vector (p322/292 and p336/306) and pGL3-basic (control) were treated with vehicle (lane 2 in each panel) and increasing quantities of S1 nuclease (lanes 3 and 4 in each panel) followed by digestion with the XbaI restriction enzyme. Lane 1, molecular size markers (1-kb ladder). The XbaI-linearized plasmid (denoted by the single asterisk) and the 3.2- and 1.8-kb fragments are indicated by arrows. (B) The luciferase activity of p322/292 and p336/306 plasmids. Activities of luciferase reporter were expressed as n-fold relative to the activity of each corresponding luciferase reporter transfected with vector p322/292, which was assigned an activity value of 1.0. Transfection efficiencies were normalized to β-galactosidase activity. Data are presented as the mean of three independent experiments with at least two different plasmid preparations. Standard deviation is indicated by the error bars. **P
Figure Legend Snippet: S1 nuclease sensitivity of PPy/u motif-containing plasmids. (A) The PPy/u motif-containing promoters fused with the promoterless pGL3-basic vector (p322/292 and p336/306) and pGL3-basic (control) were treated with vehicle (lane 2 in each panel) and increasing quantities of S1 nuclease (lanes 3 and 4 in each panel) followed by digestion with the XbaI restriction enzyme. Lane 1, molecular size markers (1-kb ladder). The XbaI-linearized plasmid (denoted by the single asterisk) and the 3.2- and 1.8-kb fragments are indicated by arrows. (B) The luciferase activity of p322/292 and p336/306 plasmids. Activities of luciferase reporter were expressed as n-fold relative to the activity of each corresponding luciferase reporter transfected with vector p322/292, which was assigned an activity value of 1.0. Transfection efficiencies were normalized to β-galactosidase activity. Data are presented as the mean of three independent experiments with at least two different plasmid preparations. Standard deviation is indicated by the error bars. **P

Techniques Used: Plasmid Preparation, Luciferase, Activity Assay, Transfection, Standard Deviation

4) Product Images from "Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance "

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance

Journal: The Journal of Cell Biology

doi:

Generation of recombinant adenovirus vectors AdαTmFLAG and AdcTnIFLAG. (A) The schematic of the structure of the recombinant adenoviruses shows the enzyme sites used for restriction enzyme Southern blot analysis: XbaI, XI; HindIII, H3; EcoRV, EV; Eco RI, EI. The sets of enzymes used in lane 2 of each blot cut out the cDNA plus the left end (∼600 bp) of the viral genome indicating the appropriate insertion of the cDNA into the viral genome. The left lane in each blot (U) is uncut viral DNA, and the right lane in each blot is the full-length cDNA. (B) Southern blot of AdαTmFLAG DNA. The cDNA for αTmFLAG is ∼300 bp smaller than the full-length αTm cDNA (see Materials and Methods). (C) Southern blot of AdcTnIFLAG DNA.
Figure Legend Snippet: Generation of recombinant adenovirus vectors AdαTmFLAG and AdcTnIFLAG. (A) The schematic of the structure of the recombinant adenoviruses shows the enzyme sites used for restriction enzyme Southern blot analysis: XbaI, XI; HindIII, H3; EcoRV, EV; Eco RI, EI. The sets of enzymes used in lane 2 of each blot cut out the cDNA plus the left end (∼600 bp) of the viral genome indicating the appropriate insertion of the cDNA into the viral genome. The left lane in each blot (U) is uncut viral DNA, and the right lane in each blot is the full-length cDNA. (B) Southern blot of AdαTmFLAG DNA. The cDNA for αTmFLAG is ∼300 bp smaller than the full-length αTm cDNA (see Materials and Methods). (C) Southern blot of AdcTnIFLAG DNA.

Techniques Used: Recombinant, Southern Blot

5) Product Images from "Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿"

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿

Journal: Applied and Environmental Microbiology

doi: 10.1128/AEM.01135-10

Restriction digest patterns electrophoresed on a 1.5% agarose gel and stained with ethidium bromide. (A) FnpΦ02 genomic DNA digested with restriction enzymes. Lanes: L1, 100-bp DNA ladder marker (Fermentas Inc., Canada); L2, 1-kb ladder marker (Fermentas Inc., Canada); L3, undigested DNA; L4, DNA/HindIII; L5, DNA/DraI; L6, DNA/XbaI; and L7, lambda DNA/HindIII. (B) Higher magnification of the bands of the digestion of FnpΦ02 with HindIII used for genome size determination. Selected sizes of the marker are indicated in panel A.
Figure Legend Snippet: Restriction digest patterns electrophoresed on a 1.5% agarose gel and stained with ethidium bromide. (A) FnpΦ02 genomic DNA digested with restriction enzymes. Lanes: L1, 100-bp DNA ladder marker (Fermentas Inc., Canada); L2, 1-kb ladder marker (Fermentas Inc., Canada); L3, undigested DNA; L4, DNA/HindIII; L5, DNA/DraI; L6, DNA/XbaI; and L7, lambda DNA/HindIII. (B) Higher magnification of the bands of the digestion of FnpΦ02 with HindIII used for genome size determination. Selected sizes of the marker are indicated in panel A.

Techniques Used: Agarose Gel Electrophoresis, Staining, Marker, Lambda DNA Preparation

Related Articles

Clone Assay:

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux. .. Site-directed mutagenesis was employed to inactivate putative Nkx3.1-binding sites located at −4973 (site 1) and −4922 (site 2) of the PSA promoter.

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech). .. The correct insertion of these 3′UTRs into the pGL3-promoter vector was verified by restriction analysis and sequencing.

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873). .. The resulting plasmid was digested with NotI, and the 35SMsSN1 restriction fragment was cloned into pART27 binary vector [ ].

Amplification:

Article Title: A Multisampling Reporter System for Monitoring MicroRNA Activity in the Same Population of Cells
Article Snippet: .. The amplicon was cut by HindIII and XbaI. pGL3-Control (Promega Inc., Madison, WI, USA) was cut using the same restriction enzymes to remove the firefly luciferase gene, and the MLuc amplicon was inserted. .. The recombinant vector was designated pMLuc.

Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence
Article Snippet: The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ). .. Integron cassette arrays were amplified by PCR using primers CS1 and CS2 ( ).

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: 3′UTR sequences were amplified from WI26 cDNA (for human 3′UTRs) and from total lung Balb/c mice cDNA (for murine 3′UTRs) by PCR (see for amplified 3′UTRs and primers) using the Easy-A® One-Tube RT-PCR System (#600182, Agilent Technologies-Stratagene Products). .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

Synthesized:

Article Title: Effect of Hepatitis C Virus (HCV) NS5B-Nucleolin Interaction on HCV Replication with HCV Subgenomic Replicon
Article Snippet: All plasmids harboring replicon RNA were linearized with XbaI and column purified (PCR purification kit; Promega). .. RNA was synthesized and purified as described previously ( ).

Article Title: 5α-Reduced Neurosteroids Sex-Dependently Reverse Central Prenatal Programming of Neuroendocrine Stress Responses in Rats
Article Snippet: To detect CRH mRNA, 35 S-UTP-labeled riboprobes were synthesized from a linearized Bluescript KS vector expressing a 519bp rat CRH cDNA fragment (generously provided by Megan Holmes, University of Edinburgh, UK). .. The plasmid was linearized with HindIII and XbaI, and sense and antisense riboprobes transcribed with T7 and T3 polymerase (Riboprobe Systems, Promega), respectively.

Construct:

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: Paragraph title: Plasmid Constructs ... In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI).

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: PSA–Lux constructs lacking various portions of the PSA promoter were prepared by PCR using PSA–Lux as template, Platinum Pfx DNA polymerase, 5′-GAATGCCAAGCTTGGGGCTGGGGAG-3′ as a 3′-primer and the following 5′-primers: BstEII (−4243 to +1), 5′-GGGTCTAGACCAAATCTTGTAGGGTGACCAGAG-3′, EcoRV (−4075 to +1), 5′-GGGTCTAGACAAGCCTCGATCTGAGAGAGATATCATC-3′, Apa I (−2858 to +1), 5′-GGGTCTAGACCTGATGAACACCATGGTGTGTACAGG-3′, and SexAI (−1729 to +1), 5′-GGGTCTAGAGGCTGGCCTCGAACTCCTGACCTGG-3′. .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: Paragraph title: Plasmid constructs ... After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: To produce recombinant bacteria expressing MsSN1 , plasmid pSJ33-MsSN1 carrying MsSN1 was constructed by subcloning the 0.5-kb EcoRI (Cat. # R6011, Promega) fragment from pCR2.1TOPO-MsSN1 into pSJ33 [ ], and afterward introduced in Escherichia coli for heterologous expression of MsSN1 . .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873).

Electrophoresis:

Article Title: Longitudinal Emergence and Distribution of Escherichia coli O157 Genotypes in a Beef Feedlot ▿
Article Snippet: E. coli O157 isolates were prepared for PFGE in agarose gel and digested using XbaI (Promega Corp., Madison, WI). .. Restriction fragments were separated by contour-clamped homogeneous field (CHEF) PFGE using a CHEF-DRII drive apparatus (electrophoresis cell, drive module, control module, pump, casting stand, combs, and CHEF-DR II Chiller system; Bio-Rad Laboratories, Richmond, CA).

Article Title: Differential regulation of mouse and human Mu opioid receptor gene depends on the single stranded DNA structure of its promoter and α-complex protein 1
Article Snippet: .. The resulting S1-treated plasmids were digested further using XbaI (Promega Corporation) and the products were resolved using electrophoresis on a 1% agarose gel at 100 V for 1 h. .. Mouse neuroblastoma NS20Y cells and human neuronal NMB cells obtained from the ATCC were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum (GE Healthcare Life Sciences, Chalfont, UK) at 37°C in a humidified atmosphere of 5% CO2 .

Article Title: Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves
Article Snippet: PFGE was performed using XbaI (Promega) according to standard procedures, with slight modifications ( , ). .. DNA fragments were resolved by electrophoresis in 1% agarose gels (pulsed-field certified agarose; Bio-Rad) with a CHEF DRII machine (Bio-Rad), using 0.5× Tris-borate-EDTA as the buffer.

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
Article Snippet: We tested the susceptibility of the nucleic acid to 17 restriction enzymes: BamHI, HindIII, KpnI, and PstL (Invitrogen) and BstEII, BfuCI, DraI, DpnI, EcoRI, EcoRV, HpaII, HaeIII, NotI, Sau3AI, SpeI, XbaI, and PvuI (Promega, Madison, WI). .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers.

Luciferase:

Article Title: A Multisampling Reporter System for Monitoring MicroRNA Activity in the Same Population of Cells
Article Snippet: .. The amplicon was cut by HindIII and XbaI. pGL3-Control (Promega Inc., Madison, WI, USA) was cut using the same restriction enzymes to remove the firefly luciferase gene, and the MLuc amplicon was inserted. .. The recombinant vector was designated pMLuc.

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: A firefly luciferase reporter construct (PSA–Lux) carrying a 5.3-kb portion of the PSA promoter was a gift from Dr Charles J. Bieberich and has been described in [ ]. .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: Plasmid constructs The luciferase-UTR reporter plasmids were constructed by introducing 3′UTR of 21 genes carrying putative miRNA binding sites into pGL3-promoter vector that contains an SV40 promoter upstream of the luciferase gene (#E1761, Promega). .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

Activity Assay:

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: The transcriptional activity of this construct has been shown not to be regulated by Sp family members [ , ]. .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Expressing:

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: Paragraph title: Expression and reporter plasmids ... The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: To produce recombinant bacteria expressing MsSN1 , plasmid pSJ33-MsSN1 carrying MsSN1 was constructed by subcloning the 0.5-kb EcoRI (Cat. # R6011, Promega) fragment from pCR2.1TOPO-MsSN1 into pSJ33 [ ], and afterward introduced in Escherichia coli for heterologous expression of MsSN1 . .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873).

Article Title: 5α-Reduced Neurosteroids Sex-Dependently Reverse Central Prenatal Programming of Neuroendocrine Stress Responses in Rats
Article Snippet: To detect CRH mRNA, 35 S-UTP-labeled riboprobes were synthesized from a linearized Bluescript KS vector expressing a 519bp rat CRH cDNA fragment (generously provided by Megan Holmes, University of Edinburgh, UK). .. The plasmid was linearized with HindIII and XbaI, and sense and antisense riboprobes transcribed with T7 and T3 polymerase (Riboprobe Systems, Promega), respectively.

Transformation Assay:

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI). .. DH5α cells (Invitrogen) were transformed with each construct.

Hybridization:

Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence
Article Snippet: .. The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ). ..

Transfection:

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI). .. After verifying the DNA sequence of the constructs, CHO cells were transfected.

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: A CAT (chloramphenicol acetyltransferase) reporter gene governed by a minimal portion of the adenovirus major late promoter, Δ53MLP-CAT (a gift from Dr Adrian R. Black, Roswell Park Cancer Institute, Buffalo, NY, U.S.A.) was employed in transcription experiments to normalize for plate-to-plate variations in transfection efficiency. .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Article Title: Tim-3 Negatively Regulates IL-12 Expression by Monocytes in HCV Infection
Article Snippet: Paragraph title: Huh-7 hepatocytes transfection by HCV-JFH-1 and co-culture with primary M/MØ ... The purified DNA was linearized with XbaI (Promega Corporation.

Southern Blot:

Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence
Article Snippet: .. The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ). ..

Introduce:

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: .. In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI). .. DH5α cells (Invitrogen) were transformed with each construct.

Polymerase Chain Reaction:

Article Title: Effect of Hepatitis C Virus (HCV) NS5B-Nucleolin Interaction on HCV Replication with HCV Subgenomic Replicon
Article Snippet: .. All plasmids harboring replicon RNA were linearized with XbaI and column purified (PCR purification kit; Promega). .. RNA was synthesized and purified as described previously ( ).

Article Title: A Multisampling Reporter System for Monitoring MicroRNA Activity in the Same Population of Cells
Article Snippet: Plasmid Construction The MLuc gene from the pMetLuc-Control plasmid (Clotech Inc., Palo Alto, CA, USA) was amplified by PCR using the forward primer 5′- CG AAGCTT ATGGACATCAAGGTGGTG -3′ and the reverse primer 5′-TATGA TCTAGA GTCGCGG-3′ (HindIII and XbaI restriction sites are indicated in bold letters). .. The amplicon was cut by HindIII and XbaI. pGL3-Control (Promega Inc., Madison, WI, USA) was cut using the same restriction enzymes to remove the firefly luciferase gene, and the MLuc amplicon was inserted.

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis. .. The COOH-terminal FLAG epitope (DYKDDDDK) ( Sigma ) was engineered by PCR mutagenesis using the following primer set to amplify a 204-bp fragment: forward primer 5′ AGAGATCAAGGTCCTTTCCG 3′ and reverse primer 5′ GAAGTGAAGCT* T* AGAAACTTA CTTGTCGTCATCGTCTTTGTAGTC TATGGAAGTCA-TATCGTTGAGAG 3′ (underline indicates FLAG epitope sequence).

Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence
Article Snippet: Paragraph title: SGI1 characterization, PCR mapping, and Southern blot hybridization. ... The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ).

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: .. In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI). .. DH5α cells (Invitrogen) were transformed with each construct.

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux. .. Site-directed mutagenesis was employed to inactivate putative Nkx3.1-binding sites located at −4973 (site 1) and −4922 (site 2) of the PSA promoter.

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: 3′UTR sequences were amplified from WI26 cDNA (for human 3′UTRs) and from total lung Balb/c mice cDNA (for murine 3′UTRs) by PCR (see for amplified 3′UTRs and primers) using the Easy-A® One-Tube RT-PCR System (#600182, Agilent Technologies-Stratagene Products). .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

Article Title: Tim-3 Negatively Regulates IL-12 Expression by Monocytes in HCV Infection
Article Snippet: The purified DNA was linearized with XbaI (Promega Corporation. .. Madison, WI) and Mung Bean Nuclease (New England BiolabsIpswich, MA), and further purified with OriGene powerprepTM Express PCR purification kit (OriGene Technologies, Inc. Rockville, MD).

DNA Sequencing:

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis. .. A Ppu M1, HindIII fragment of the PCR product was ligated to the Ppu M1 site in the αTm cDNA and the αTmFLAG cDNA was verified by DNA sequencing.

Sequencing:

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis. .. The COOH-terminal FLAG epitope (DYKDDDDK) ( Sigma ) was engineered by PCR mutagenesis using the following primer set to amplify a 204-bp fragment: forward primer 5′ AGAGATCAAGGTCCTTTCCG 3′ and reverse primer 5′ GAAGTGAAGCT* T* AGAAACTTA CTTGTCGTCATCGTCTTTGTAGTC TATGGAAGTCA-TATCGTTGAGAG 3′ (underline indicates FLAG epitope sequence).

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI). .. After verifying the DNA sequence of the constructs, CHO cells were transfected.

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech). .. The correct insertion of these 3′UTRs into the pGL3-promoter vector was verified by restriction analysis and sequencing.

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: The cDNA sequence was named MsSN1 (Medicago sativa snakin-1). .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873).

Recombinant:

Article Title: A Multisampling Reporter System for Monitoring MicroRNA Activity in the Same Population of Cells
Article Snippet: The amplicon was cut by HindIII and XbaI. pGL3-Control (Promega Inc., Madison, WI, USA) was cut using the same restriction enzymes to remove the firefly luciferase gene, and the MLuc amplicon was inserted. .. The recombinant vector was designated pMLuc.

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: Paragraph title: Generation of Recombinant Adenovirus ... A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis.

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: To produce recombinant bacteria expressing MsSN1 , plasmid pSJ33-MsSN1 carrying MsSN1 was constructed by subcloning the 0.5-kb EcoRI (Cat. # R6011, Promega) fragment from pCR2.1TOPO-MsSN1 into pSJ33 [ ], and afterward introduced in Escherichia coli for heterologous expression of MsSN1 . .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873).

Pulsed-Field Gel:

Article Title: Longitudinal Emergence and Distribution of Escherichia coli O157 Genotypes in a Beef Feedlot ▿
Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed on all fecal isolates obtained from samples collected on Mondays ( n = 322), with the exception of eight isolates that could not be found or for which E. coli O157 could not be isolated from the Protect beads. .. E. coli O157 isolates were prepared for PFGE in agarose gel and digested using XbaI (Promega Corp., Madison, WI).

Article Title: Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves
Article Snippet: Paragraph title: Characterization of isolates by pulsed-field gel electrophoresis. ... PFGE was performed using XbaI (Promega) according to standard procedures, with slight modifications ( , ).

Sensitive Assay:

Article Title: Differential regulation of mouse and human Mu opioid receptor gene depends on the single stranded DNA structure of its promoter and α-complex protein 1
Article Snippet: Paragraph title: S1 nuclease sensitivity assay ... The resulting S1-treated plasmids were digested further using XbaI (Promega Corporation) and the products were resolved using electrophoresis on a 1% agarose gel at 100 V for 1 h.

Mutagenesis:

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: .. A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis. .. The COOH-terminal FLAG epitope (DYKDDDDK) ( Sigma ) was engineered by PCR mutagenesis using the following primer set to amplify a 204-bp fragment: forward primer 5′ AGAGATCAAGGTCCTTTCCG 3′ and reverse primer 5′ GAAGTGAAGCT* T* AGAAACTTA CTTGTCGTCATCGTCTTTGTAGTC TATGGAAGTCA-TATCGTTGAGAG 3′ (underline indicates FLAG epitope sequence).

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux. .. Site-directed mutagenesis was employed to inactivate putative Nkx3.1-binding sites located at −4973 (site 1) and −4922 (site 2) of the PSA promoter.

Isolation:

Article Title: Longitudinal Emergence and Distribution of Escherichia coli O157 Genotypes in a Beef Feedlot ▿
Article Snippet: PFGE was also performed on isolates from samples collected on both days from water tanks ( n = 67), lagoon water ( n = 13), mixed feed ( n = 10), component feeds ( n = 3), bird feces ( n = 6), pen surfaces ( n = 2), and houseflies ( n = 52), with the exception of two water isolates, one postfeed isolate, and one fly isolate that could not be found or for which E. coli O157 could not be isolated from the Protect beads. .. E. coli O157 isolates were prepared for PFGE in agarose gel and digested using XbaI (Promega Corp., Madison, WI).

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
Article Snippet: Phage DNA was isolated from 50 ml lysate (6.75 × 107 PFU/ml) by using the Qiagen lambda midikit (Promega, Madison, WI) according to the manufacturer's instructions. .. We tested the susceptibility of the nucleic acid to 17 restriction enzymes: BamHI, HindIII, KpnI, and PstL (Invitrogen) and BstEII, BfuCI, DraI, DpnI, EcoRI, EcoRV, HpaII, HaeIII, NotI, Sau3AI, SpeI, XbaI, and PvuI (Promega, Madison, WI).

Subcloning:

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: An EcoRI fragment containing the full-length αTm cDNA was subcloned into pCA4 plasmid to add additional restriction enzyme sites for future subcloning ( , ). .. A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis.

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: To produce recombinant bacteria expressing MsSN1 , plasmid pSJ33-MsSN1 carrying MsSN1 was constructed by subcloning the 0.5-kb EcoRI (Cat. # R6011, Promega) fragment from pCR2.1TOPO-MsSN1 into pSJ33 [ ], and afterward introduced in Escherichia coli for heterologous expression of MsSN1 . .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873).

Purification:

Article Title: Effect of Hepatitis C Virus (HCV) NS5B-Nucleolin Interaction on HCV Replication with HCV Subgenomic Replicon
Article Snippet: .. All plasmids harboring replicon RNA were linearized with XbaI and column purified (PCR purification kit; Promega). .. RNA was synthesized and purified as described previously ( ).

Article Title: Tim-3 Negatively Regulates IL-12 Expression by Monocytes in HCV Infection
Article Snippet: .. The purified DNA was linearized with XbaI (Promega Corporation. .. Madison, WI) and Mung Bean Nuclease (New England BiolabsIpswich, MA), and further purified with OriGene powerprepTM Express PCR purification kit (OriGene Technologies, Inc. Rockville, MD).

Article Title: Isomerization of Asp7 in Beta-Amyloid Enhances Inhibition of the α7 Nicotinic Receptor and Promotes Neurotoxicity
Article Snippet: Electrophysiology Rat α7nAChR in the pSGEM vector were linearized using XbaI (Promega, USA). mRNAs were transcribed in vitro using the T7 mMessage mMachine (Ambion Inc., Austin, TX, USA) transcription kit. .. RNAs were purified by phenol:chloroform extraction and isopropanol precipitation.

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
Article Snippet: Paragraph title: Purification of bacteriophage DNA and restriction analysis. ... We tested the susceptibility of the nucleic acid to 17 restriction enzymes: BamHI, HindIII, KpnI, and PstL (Invitrogen) and BstEII, BfuCI, DraI, DpnI, EcoRI, EcoRV, HpaII, HaeIII, NotI, Sau3AI, SpeI, XbaI, and PvuI (Promega, Madison, WI).

Reverse Transcription Polymerase Chain Reaction:

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: 3′UTR sequences were amplified from WI26 cDNA (for human 3′UTRs) and from total lung Balb/c mice cDNA (for murine 3′UTRs) by PCR (see for amplified 3′UTRs and primers) using the Easy-A® One-Tube RT-PCR System (#600182, Agilent Technologies-Stratagene Products). .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

Co-Culture Assay:

Article Title: Tim-3 Negatively Regulates IL-12 Expression by Monocytes in HCV Infection
Article Snippet: Paragraph title: Huh-7 hepatocytes transfection by HCV-JFH-1 and co-culture with primary M/MØ ... The purified DNA was linearized with XbaI (Promega Corporation.

Chloramphenicol Acetyltransferase Assay:

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: A CAT (chloramphenicol acetyltransferase) reporter gene governed by a minimal portion of the adenovirus major late promoter, Δ53MLP-CAT (a gift from Dr Adrian R. Black, Roswell Park Cancer Institute, Buffalo, NY, U.S.A.) was employed in transcription experiments to normalize for plate-to-plate variations in transfection efficiency. .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Mouse Assay:

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: 3′UTR sequences were amplified from WI26 cDNA (for human 3′UTRs) and from total lung Balb/c mice cDNA (for murine 3′UTRs) by PCR (see for amplified 3′UTRs and primers) using the Easy-A® One-Tube RT-PCR System (#600182, Agilent Technologies-Stratagene Products). .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

In Situ Hybridization:

Article Title: 5α-Reduced Neurosteroids Sex-Dependently Reverse Central Prenatal Programming of Neuroendocrine Stress Responses in Rats
Article Snippet: Paragraph title: In situ hybridization. ... The plasmid was linearized with HindIII and XbaI, and sense and antisense riboprobes transcribed with T7 and T3 polymerase (Riboprobe Systems, Promega), respectively.

Plasmid Preparation:

Article Title: A Multisampling Reporter System for Monitoring MicroRNA Activity in the Same Population of Cells
Article Snippet: Paragraph title: 2.1. Plasmid Construction ... The amplicon was cut by HindIII and XbaI. pGL3-Control (Promega Inc., Madison, WI, USA) was cut using the same restriction enzymes to remove the firefly luciferase gene, and the MLuc amplicon was inserted.

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: An EcoRI fragment containing the full-length αTm cDNA was subcloned into pCA4 plasmid to add additional restriction enzyme sites for future subcloning ( , ). .. A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis.

Article Title: Quantitative and Qualitative Methods Using Fluorescence Microscopy for the Study of Modified Low Density Lipoproteins Uptake
Article Snippet: Paragraph title: Plasmid Constructs ... In order to introduce the SRA-I and SRA-II PCR products into the vectors, both were previously digested with KpnI and XbaI and then ligated with T4 DNA Ligase (Promega, Madison, WI).

Article Title: Nkx3.1 binds and negatively regulates the transcriptional activity of Sp-family members in prostate-derived cells
Article Snippet: A second adenovirus-derived reporter plasmid carrying this same promoter fragment linked to Renilla luciferase was prepared by annealing the following oligonucleotide and its complement, 5′-GGGCTCGAGGTTCACAATTTTCTGGTGGTGGGCTATAAAAAAAGCTTGGG-3′, digestion with XhoI and HindIII, and cloning into phRL-basic (Promega), generating phRL-Δ53MLP. .. The resulting PCR products were cleaved with XbaI and HindIII and were cloned in pGL3-basic (Promega), generating pBstEII-Lux, pEcoRV-Lux, pApaI-Lux and pSexAI-Lux.

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech). .. The correct insertion of these 3′UTRs into the pGL3-promoter vector was verified by restriction analysis and sequencing.

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873). .. The resulting plasmid was digested with NotI, and the 35SMsSN1 restriction fragment was cloned into pART27 binary vector [ ].

Article Title: Tim-3 Negatively Regulates IL-12 Expression by Monocytes in HCV Infection
Article Snippet: Huh-7 hepatocytes transfection by HCV-JFH-1 and co-culture with primary M/MØ HCV JFH-1 (kindly provided by Dr. T. Wakita, Department of Virology II, NIH of Japan through a MTA) was transfected into MAX Efficiency® DH5α™ Competent Cells, replicated, and purified by a plasmid miniprep kit (Invitrogen corporation, Carlsbad, CA). .. The purified DNA was linearized with XbaI (Promega Corporation.

Article Title: Isomerization of Asp7 in Beta-Amyloid Enhances Inhibition of the α7 Nicotinic Receptor and Promotes Neurotoxicity
Article Snippet: .. Electrophysiology Rat α7nAChR in the pSGEM vector were linearized using XbaI (Promega, USA). mRNAs were transcribed in vitro using the T7 mMessage mMachine (Ambion Inc., Austin, TX, USA) transcription kit. .. RNAs were purified by phenol:chloroform extraction and isopropanol precipitation.

Article Title: 5α-Reduced Neurosteroids Sex-Dependently Reverse Central Prenatal Programming of Neuroendocrine Stress Responses in Rats
Article Snippet: .. The plasmid was linearized with HindIII and XbaI, and sense and antisense riboprobes transcribed with T7 and T3 polymerase (Riboprobe Systems, Promega), respectively. .. For ERβ mRNA, 35 S-UTP-labeled riboprobes were synthesized from the linearized pBluescript KS vector expressing a 400 bp cDNA fragment encoding rat ERβ (generously provided by Megan Holmes, University of Edinburgh, UK).

Software:

Article Title: Longitudinal Emergence and Distribution of Escherichia coli O157 Genotypes in a Beef Feedlot ▿
Article Snippet: E. coli O157 isolates were prepared for PFGE in agarose gel and digested using XbaI (Promega Corp., Madison, WI). .. PFGE patterns were photographed and scanned using Bio-Rad's gel documentation systems (Gel Doc 2000) and TDS Quantity One software.

Article Title: Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves
Article Snippet: PFGE was performed using XbaI (Promega) according to standard procedures, with slight modifications ( , ). .. Gels were stained with 0.5 μg/ml of ethidium bromide in distilled water and photographed using a software-based image capturing system (Gel Doc 2000; Bio-Rad).

Binding Assay:

Article Title: MicroRNAs Profiling in Murine Models of Acute and Chronic Asthma: A Relationship with mRNAs Targets
Article Snippet: Plasmid constructs The luciferase-UTR reporter plasmids were constructed by introducing 3′UTR of 21 genes carrying putative miRNA binding sites into pGL3-promoter vector that contains an SV40 promoter upstream of the luciferase gene (#E1761, Promega). .. After double digestion by FseI and XbaI of the pGL3-promoter vector (#E1761, Promega), the 3′UTRs were cloned into this vector using the In-Fusion cloning kit (#639619, ClonTech).

Agarose Gel Electrophoresis:

Article Title: Longitudinal Emergence and Distribution of Escherichia coli O157 Genotypes in a Beef Feedlot ▿
Article Snippet: .. E. coli O157 isolates were prepared for PFGE in agarose gel and digested using XbaI (Promega Corp., Madison, WI). .. Restriction fragments were separated by contour-clamped homogeneous field (CHEF) PFGE using a CHEF-DRII drive apparatus (electrophoresis cell, drive module, control module, pump, casting stand, combs, and CHEF-DR II Chiller system; Bio-Rad Laboratories, Richmond, CA).

Article Title: Differential regulation of mouse and human Mu opioid receptor gene depends on the single stranded DNA structure of its promoter and α-complex protein 1
Article Snippet: .. The resulting S1-treated plasmids were digested further using XbaI (Promega Corporation) and the products were resolved using electrophoresis on a 1% agarose gel at 100 V for 1 h. .. Mouse neuroblastoma NS20Y cells and human neuronal NMB cells obtained from the ATCC were grown in Dulbecco's modified Eagle's medium supplemented with 10% heat-inactivated fetal bovine serum (GE Healthcare Life Sciences, Chalfont, UK) at 37°C in a humidified atmosphere of 5% CO2 .

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
Article Snippet: We tested the susceptibility of the nucleic acid to 17 restriction enzymes: BamHI, HindIII, KpnI, and PstL (Invitrogen) and BstEII, BfuCI, DraI, DpnI, EcoRI, EcoRV, HpaII, HaeIII, NotI, Sau3AI, SpeI, XbaI, and PvuI (Promega, Madison, WI). .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers.

In Vitro:

Article Title: Effect of Hepatitis C Virus (HCV) NS5B-Nucleolin Interaction on HCV Replication with HCV Subgenomic Replicon
Article Snippet: Paragraph title: In vitro transcription and purification of RNA. ... All plasmids harboring replicon RNA were linearized with XbaI and column purified (PCR purification kit; Promega).

Article Title: Isomerization of Asp7 in Beta-Amyloid Enhances Inhibition of the α7 Nicotinic Receptor and Promotes Neurotoxicity
Article Snippet: .. Electrophysiology Rat α7nAChR in the pSGEM vector were linearized using XbaI (Promega, USA). mRNAs were transcribed in vitro using the T7 mMessage mMachine (Ambion Inc., Austin, TX, USA) transcription kit. .. RNAs were purified by phenol:chloroform extraction and isopropanol precipitation.

Transgenic Assay:

Article Title: Alfalfa snakin-1 prevents fungal colonization and probably coevolved with rhizobia
Article Snippet: .. To produce transgenic alfalfa lines overexpressing MsSN1 , pCR2.1TOPO-NotI-MsSN1 was digested with KpnI (Cat. # R6341, Promega) and XbaI (Cat. # R6181, Promega), and the MsSN1 restriction fragment was cloned into pKANNIBAL vector (GenBank accession number AJ311873). .. The resulting plasmid was digested with NotI, and the 35SMsSN1 restriction fragment was cloned into pART27 binary vector [ ].

FLAG-tag:

Article Title: Thin Filament Protein Dynamics in Fully Differentiated Adult Cardiac Myocytes: Toward A Model of Sarcomere Maintenance
Article Snippet: A XbaI, HindIII fragment containing the full-length αTm cDNA was subcloned into pSP72 ( Promega ) for mutagenesis. .. The COOH-terminal FLAG epitope (DYKDDDDK) ( Sigma ) was engineered by PCR mutagenesis using the following primer set to amplify a 204-bp fragment: forward primer 5′ AGAGATCAAGGTCCTTTCCG 3′ and reverse primer 5′ GAAGTGAAGCT* T* AGAAACTTA CTTGTCGTCATCGTCTTTGTAGTC TATGGAAGTCA-TATCGTTGAGAG 3′ (underline indicates FLAG epitope sequence).

Marker:

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
Article Snippet: We tested the susceptibility of the nucleic acid to 17 restriction enzymes: BamHI, HindIII, KpnI, and PstL (Invitrogen) and BstEII, BfuCI, DraI, DpnI, EcoRI, EcoRV, HpaII, HaeIII, NotI, Sau3AI, SpeI, XbaI, and PvuI (Promega, Madison, WI). .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers.

Staining:

Article Title: Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves
Article Snippet: PFGE was performed using XbaI (Promega) according to standard procedures, with slight modifications ( , ). .. Gels were stained with 0.5 μg/ml of ethidium bromide in distilled water and photographed using a software-based image capturing system (Gel Doc 2000; Bio-Rad).

Article Title: Isolation of a Novel Bacteriophage Specific for the Periodontal Pathogen Fusobacterium nucleatum ▿
Article Snippet: We tested the susceptibility of the nucleic acid to 17 restriction enzymes: BamHI, HindIII, KpnI, and PstL (Invitrogen) and BstEII, BfuCI, DraI, DpnI, EcoRI, EcoRV, HpaII, HaeIII, NotI, Sau3AI, SpeI, XbaI, and PvuI (Promega, Madison, WI). .. The DNA digestion mixtures were analyzed by electrophoresis at 50 V for 3.5 h in a 1.5% Tris-acetate-EDTA (TAE) agarose gel stained with ethidium bromide using a 1-kb DNA ladder (New England Biolabs) and lambda mix marker (New England Biolabs) as molecular size markers.

Variant Assay:

Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence
Article Snippet: The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ). .. To assess variant SGI1 MDR regions and their insertion sites identified in this study, a complete integron PCR mapping and integron junction PCR were also performed using primers previously described ( , , ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega xbai restriction enzymes
    Map of the pWSRi plasmid and its construction . (a) The circular map of the BCTV genome displays the positions of the primers (blue arrows) used to construct pWSRi relative to the positions of the viral genes (green arrows). (b) The circular BCTV genome was inserted into a pCR2.1 plasmid vector (indicated in blue). In plant cells, the viral vector is released by recombination within the overlap (repeated) regions of the viral genome marked in red. The full-length BCTV L1 , L2 , L3 , L4 , and R3 are indicated with green arrows. The positions of the truncated R1 and R2 genes, interrupted by the <t>NotI-XbaI</t> linker for insertion of targeting sequences (in purple), are also indicated in green. Direction of the arrows indicates direction of gene transcription. (c) The nucleotide sequence near the targeting sequence insertion site is shown. The truncated R1 and R2 reading frames are denoted by arrows underneath the sequences; 14 nt were deleted from the 3' end of R2 and 626 nt were deleted from within R1. The remainder of the R1 transcription unit continues downstream of the <t>XhoI</t> site. The L3 reading frame, which is not truncated, is similarly marked with an arrow in the direction of the transcription. The linker containing NotI/XhoI cloning sites is shown in purple.
    Xbai Restriction Enzymes, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai restriction enzymes/product/Promega
    Average 99 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xbai restriction enzymes - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    98
    Promega xbai
    (A) Southern blot hybridization with the <t>p1-9</t> probe of <t>XbaI-digested</t> genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain
    Xbai, supplied by Promega, used in various techniques. Bioz Stars score: 98/100, based on 170 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/Promega
    Average 98 stars, based on 170 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-02
    98/100 stars
      Buy from Supplier

    Image Search Results


    Map of the pWSRi plasmid and its construction . (a) The circular map of the BCTV genome displays the positions of the primers (blue arrows) used to construct pWSRi relative to the positions of the viral genes (green arrows). (b) The circular BCTV genome was inserted into a pCR2.1 plasmid vector (indicated in blue). In plant cells, the viral vector is released by recombination within the overlap (repeated) regions of the viral genome marked in red. The full-length BCTV L1 , L2 , L3 , L4 , and R3 are indicated with green arrows. The positions of the truncated R1 and R2 genes, interrupted by the NotI-XbaI linker for insertion of targeting sequences (in purple), are also indicated in green. Direction of the arrows indicates direction of gene transcription. (c) The nucleotide sequence near the targeting sequence insertion site is shown. The truncated R1 and R2 reading frames are denoted by arrows underneath the sequences; 14 nt were deleted from the 3' end of R2 and 626 nt were deleted from within R1. The remainder of the R1 transcription unit continues downstream of the XhoI site. The L3 reading frame, which is not truncated, is similarly marked with an arrow in the direction of the transcription. The linker containing NotI/XhoI cloning sites is shown in purple.

    Journal: Plant Methods

    Article Title: Development of a gene silencing DNA vector derived from a broad host range geminivirus

    doi: 10.1186/1746-4811-5-9

    Figure Lengend Snippet: Map of the pWSRi plasmid and its construction . (a) The circular map of the BCTV genome displays the positions of the primers (blue arrows) used to construct pWSRi relative to the positions of the viral genes (green arrows). (b) The circular BCTV genome was inserted into a pCR2.1 plasmid vector (indicated in blue). In plant cells, the viral vector is released by recombination within the overlap (repeated) regions of the viral genome marked in red. The full-length BCTV L1 , L2 , L3 , L4 , and R3 are indicated with green arrows. The positions of the truncated R1 and R2 genes, interrupted by the NotI-XbaI linker for insertion of targeting sequences (in purple), are also indicated in green. Direction of the arrows indicates direction of gene transcription. (c) The nucleotide sequence near the targeting sequence insertion site is shown. The truncated R1 and R2 reading frames are denoted by arrows underneath the sequences; 14 nt were deleted from the 3' end of R2 and 626 nt were deleted from within R1. The remainder of the R1 transcription unit continues downstream of the XhoI site. The L3 reading frame, which is not truncated, is similarly marked with an arrow in the direction of the transcription. The linker containing NotI/XhoI cloning sites is shown in purple.

    Article Snippet: The two constructs were digested with XhoI and XbaI restriction enzymes following the manufacturer's protocol (Promega, Madison, WI).

    Techniques: Plasmid Preparation, Construct, Sequencing, Clone Assay

    Pulsed-field gel electrophoresis (PFGE) of XbaI-digested DNA of E. cloacae isolates. Lane M PFGE marker, Salmonella ser. Braenderup H9812; lanes 1 – 10 representative NDM-1-producing E. cloacae

    Journal: Annals of Clinical Microbiology and Antimicrobials

    Article Title: Transmission and characterization of blaNDM-1 in Enterobacter cloacae at a teaching hospital in Yunnan, China

    doi: 10.1186/s12941-017-0232-y

    Figure Lengend Snippet: Pulsed-field gel electrophoresis (PFGE) of XbaI-digested DNA of E. cloacae isolates. Lane M PFGE marker, Salmonella ser. Braenderup H9812; lanes 1 – 10 representative NDM-1-producing E. cloacae

    Article Snippet: Pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST) Bacterial genomic DNA was prepared in agarose plugs and digested with the restriction enzymes XbaI (Promega, USA).

    Techniques: Pulsed-Field Gel, Electrophoresis, Marker

    (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

    doi: 10.1128/AAC.00732-12

    Figure Lengend Snippet: (A) Southern blot hybridization with the p1-9 probe of XbaI-digested genomic DNAs of S. enterica serovar Typhimurium DT104 control strain BN9181 carrying SGI1 (lane 2), serovar Virchow control strain SV20 carrying SGI1-J4 (lane 3), serovar Kentucky strain

    Article Snippet: The atypical insertion site of the complex integrons InSGI1-J (in ORF S023) was further assessed by Southern blot hybridization of whole genomic DNA cut by XbaI (Promega, Charbonnières, France) by using probe p1-9 as previously described ( , , , ).

    Techniques: Southern Blot, Hybridization

    (a) Rank abundance curve for the PFGE genotypes ( n = 56) observed in the Amp r single-pick collection ( n = 419), with nominated groups represented by the relevant letter, isolate pairs by “2,” and unique isolates by “1.” (b) Comparison of PFGE banding patterns after digestion with XbaI for a typical example from each of the nominated groups in both the Amp r ( n = 24) and Nal r ( *; n = 2) single-pick isolate collections, showing the percent similarity between group types and band sizes in kilobase pairs (kb).

    Journal: Applied and Environmental Microbiology

    Article Title: Molecular Epidemiology of Antimicrobial-Resistant Commensal Escherichia coli Strains in a Cohort of Newborn Calves

    doi: 10.1128/AEM.71.11.6680-6688.2005

    Figure Lengend Snippet: (a) Rank abundance curve for the PFGE genotypes ( n = 56) observed in the Amp r single-pick collection ( n = 419), with nominated groups represented by the relevant letter, isolate pairs by “2,” and unique isolates by “1.” (b) Comparison of PFGE banding patterns after digestion with XbaI for a typical example from each of the nominated groups in both the Amp r ( n = 24) and Nal r ( *; n = 2) single-pick isolate collections, showing the percent similarity between group types and band sizes in kilobase pairs (kb).

    Article Snippet: PFGE was performed using XbaI (Promega) according to standard procedures, with slight modifications ( , ).

    Techniques: