xbai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    XbaI
    Description:
    XbaI 15 000 units
    Catalog Number:
    R0145L
    Price:
    285
    Size:
    15 000 units
    Category:
    Restriction Enzymes
    Score:
    85
    		Buy from Supplier

    Structured Review

    New England Biolabs xbai
    XbaI
    XbaI 15 000 units
    https://www.bioz.com/result/xbai/product/New England Biolabs
    Average 99 stars, based on 190 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-01
    99/100 stars

    Related Products / Commonly Used Together

    xbai New England Biolabs
    xbai Thermo Fisher
    xbai Promega
    ecori New England Biolabs
    bamhi New England Biolabs
    hindiii New England Biolabs
    t4 dna ligase New England Biolabs
    xbai Takara
    xbai Roche
    xhoi New England Biolabs
    qiaquick pcr purification kit Qiagen
    bamhi Thermo Fisher
    hindiii Thermo Fisher
    kpni New England Biolabs
    t4 dna ligase Thermo Fisher

    Images

    1) Product Images from "Generation of an Oncolytic Herpes Simplex Virus 1 Expressing Human MelanA"

    Article Title: Generation of an Oncolytic Herpes Simplex Virus 1 Expressing Human MelanA

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2019.00002

    Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).
    Figure Legend Snippet: Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).

    Techniques Used: Agarose Gel Electrophoresis, Amplification, Expressing, Plasmid Preparation, Infection, Immunofluorescence, Microscopy, Cotransfection, Inverted Microscopy

    2) Product Images from "Organization of the cpe Locus in CPE-Positive Clostridium perfringens Type C and D Isolates"

    Article Title: Organization of the cpe Locus in CPE-Positive Clostridium perfringens Type C and D Isolates

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0010932

    RFLP analyses of cpe -positive type A, C, and D isolates and type E isolates carrying silent cpe sequences. DNA from each isolate was digested with XbaI prior to conventional agarose gel electrophoresis and Southern blot hybridization with a cpe -specific probe. The migration of molecular weight markers is shown on the left of the blot.
    Figure Legend Snippet: RFLP analyses of cpe -positive type A, C, and D isolates and type E isolates carrying silent cpe sequences. DNA from each isolate was digested with XbaI prior to conventional agarose gel electrophoresis and Southern blot hybridization with a cpe -specific probe. The migration of molecular weight markers is shown on the left of the blot.

    Techniques Used: Agarose Gel Electrophoresis, Southern Blot, Hybridization, Migration, Molecular Weight

    3) Product Images from "The NF90/NF45 Complex Participates in DNA Break Repair via Nonhomologous End Joining ▿ †"

    Article Title: The NF90/NF45 Complex Participates in DNA Break Repair via Nonhomologous End Joining ▿ †

    Journal:

    doi: 10.1128/MCB.05849-11

    In vitro NHEJ assay using DNA substrate with noncohesive ends. (A) Schematic showing the derivation of the 5.7-kb fragment with noncohesive BstXI termini, A and B. Corresponding PCR primers a and b contain HindIII and XbaI sites, respectively. Possible
    Figure Legend Snippet: In vitro NHEJ assay using DNA substrate with noncohesive ends. (A) Schematic showing the derivation of the 5.7-kb fragment with noncohesive BstXI termini, A and B. Corresponding PCR primers a and b contain HindIII and XbaI sites, respectively. Possible

    Techniques Used: In Vitro, Non-Homologous End Joining, Polymerase Chain Reaction

    4) Product Images from "Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene"

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0106864

    Transgenic founder pigs carrying the DsRed gene were detected by (a) PCR and (b) Southern blot analysis. The presence of transgenes in DsRed2 pigs were confirmed by using a DsRed primer, which produced a 780-bp PCR product. The genomic DNA of these 2 transgenic pigs (Nos. 1 and 3) were digested using XbaI and DraI. The digested DNA was subsequently hybridized using a 1.1-kb probe.
    Figure Legend Snippet: Transgenic founder pigs carrying the DsRed gene were detected by (a) PCR and (b) Southern blot analysis. The presence of transgenes in DsRed2 pigs were confirmed by using a DsRed primer, which produced a 780-bp PCR product. The genomic DNA of these 2 transgenic pigs (Nos. 1 and 3) were digested using XbaI and DraI. The digested DNA was subsequently hybridized using a 1.1-kb probe.

    Techniques Used: Transgenic Assay, Polymerase Chain Reaction, Southern Blot, Produced

    The DsRed-Monomer transgenic construct pCX-DsRed-Monomer. Arrows indicate the positions of the PCR DsRed primers. XbaI and DraI were restriction enzyme digestion sites. The thick black line indicates the position of the Southern blot probe.
    Figure Legend Snippet: The DsRed-Monomer transgenic construct pCX-DsRed-Monomer. Arrows indicate the positions of the PCR DsRed primers. XbaI and DraI were restriction enzyme digestion sites. The thick black line indicates the position of the Southern blot probe.

    Techniques Used: Transgenic Assay, Construct, Polymerase Chain Reaction, Southern Blot

    5) Product Images from "Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C"

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C

    Journal: Molecular Systems Biology

    doi: 10.15252/msb.20188293

    Diagram of the workflow (related to Fig 1 ) Annotation (SK1 background) corresponds to CDS, ARS, telomere regions, retrotransposable elements, mating type loci, tRNA, Sn/Sno RNA, rDNA, ncRNA, intron motives, and TATA boxes. All those features but CDS and transposons were labeled as “forbidden”, preventing any nucleotide substitution in these regions. DpnII, HindIII, SacI, EcoRI, NdeI, SacII, SalI, XbaI, and XhoI. Putative restriction sites are DNA sequences differing with only one base pair from a RS recognized by a RE. The sequence modifications were allowed only in non‐forbidden positions. In CDS, silent mutations were introduced. When two sites overlapped, the minimum changes needed were selected. When possible, we favored A ↔ G and C ↔ T substitutions. A validation step to test whether or not the deletion of one site creates a new site was performed after each modification, and if so, a new modification was sought for. Modifications to generate new sites were also only introduced at non‐forbidden positions. Only silent mutations were introduced within coding regions. 583 × 150 kb windows with 10‐kb overlaps were generated over the entire genome, excluding telomeres and 75 kb from each side of centromeres. Here, 400, 1,500, 2,000 and 6,000 bp. For each 150‐kb window and each interval, the following steps were performed: for each enzyme, for each starting point: putative sites within the first bin of the window (0− 0+spacing). find the putative sites at position n +1 at a distance interval ± 10% from position n until the end of window. For each window, a score is calculated as follows: for each interval, a score is calculated for each enzyme based on the median absolute deviation (MAD). the best enzyme exhibiting the lowest score was chosen for each interval. Each spacing must have a different enzyme, so multiple combinations of enzymes were computed for each window. The window score is calculated as the sum of the four chosen interval scores. A final step of manual curation was performed to introduced PCRTags (Richardson et al , 2017 ).
    Figure Legend Snippet: Diagram of the workflow (related to Fig 1 ) Annotation (SK1 background) corresponds to CDS, ARS, telomere regions, retrotransposable elements, mating type loci, tRNA, Sn/Sno RNA, rDNA, ncRNA, intron motives, and TATA boxes. All those features but CDS and transposons were labeled as “forbidden”, preventing any nucleotide substitution in these regions. DpnII, HindIII, SacI, EcoRI, NdeI, SacII, SalI, XbaI, and XhoI. Putative restriction sites are DNA sequences differing with only one base pair from a RS recognized by a RE. The sequence modifications were allowed only in non‐forbidden positions. In CDS, silent mutations were introduced. When two sites overlapped, the minimum changes needed were selected. When possible, we favored A ↔ G and C ↔ T substitutions. A validation step to test whether or not the deletion of one site creates a new site was performed after each modification, and if so, a new modification was sought for. Modifications to generate new sites were also only introduced at non‐forbidden positions. Only silent mutations were introduced within coding regions. 583 × 150 kb windows with 10‐kb overlaps were generated over the entire genome, excluding telomeres and 75 kb from each side of centromeres. Here, 400, 1,500, 2,000 and 6,000 bp. For each 150‐kb window and each interval, the following steps were performed: for each enzyme, for each starting point: putative sites within the first bin of the window (0− 0+spacing). find the putative sites at position n +1 at a distance interval ± 10% from position n until the end of window. For each window, a score is calculated as follows: for each interval, a score is calculated for each enzyme based on the median absolute deviation (MAD). the best enzyme exhibiting the lowest score was chosen for each interval. Each spacing must have a different enzyme, so multiple combinations of enzymes were computed for each window. The window score is calculated as the sum of the four chosen interval scores. A final step of manual curation was performed to introduced PCRTags (Richardson et al , 2017 ).

    Techniques Used: Labeling, Sequencing, Modification, Generated

    6) Product Images from "Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13"

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0006232

    Southern blot analyses of C. perfringens random mutants obtained after electroporation with EZ-Tn 5 transposomes. After selection on BHI plates containing Erm (40 µg/ml), DNA was extracted from strain 13 transformants. Following digestion with EcoRI (A) or XbaI (B), the digested DNA was electrophoresed and blotted to a nylon membrane. DNA on the membranes was then hybridized with a Dig-labeled erm probe, as found in the C. perfringens -modified EZ-Tn5, and blots were developed as described in the Materials and Methods . Size of DNA fragments, in kilobases (kb), is shown at left.
    Figure Legend Snippet: Southern blot analyses of C. perfringens random mutants obtained after electroporation with EZ-Tn 5 transposomes. After selection on BHI plates containing Erm (40 µg/ml), DNA was extracted from strain 13 transformants. Following digestion with EcoRI (A) or XbaI (B), the digested DNA was electrophoresed and blotted to a nylon membrane. DNA on the membranes was then hybridized with a Dig-labeled erm probe, as found in the C. perfringens -modified EZ-Tn5, and blots were developed as described in the Materials and Methods . Size of DNA fragments, in kilobases (kb), is shown at left.

    Techniques Used: Southern Blot, Electroporation, Selection, Labeling, Modification

    7) Product Images from "Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria"

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria

    Journal: Korean Journal for Food Science of Animal Resources

    doi: 10.5851/kosfa.2018.e17

    Restriction of pTG262 ( luc + ) (A) and physical genetic map of pTG262::pFI2576 rep ( luc + ) (B). M: HyperLadder™ 1 kb (Bioline Reagents Ltd.); 1: pTG262 [CCC (covalently closed circular) type]; 2: pTG262 ( luc + ) (CCC type); 3: pTG262 ( luc + ) (EcoRI-XbaI).
    Figure Legend Snippet: Restriction of pTG262 ( luc + ) (A) and physical genetic map of pTG262::pFI2576 rep ( luc + ) (B). M: HyperLadder™ 1 kb (Bioline Reagents Ltd.); 1: pTG262 [CCC (covalently closed circular) type]; 2: pTG262 ( luc + ) (CCC type); 3: pTG262 ( luc + ) (EcoRI-XbaI).

    Techniques Used: Countercurrent Chromatography

    8) Product Images from "Generation of an Oncolytic Herpes Simplex Virus 1 Expressing Human MelanA"

    Article Title: Generation of an Oncolytic Herpes Simplex Virus 1 Expressing Human MelanA

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2019.00002

    Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 ( 29 ) using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).
    Figure Legend Snippet: Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 ( 29 ) using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).

    Techniques Used: Agarose Gel Electrophoresis, Amplification, Expressing, Plasmid Preparation, Infection, Immunofluorescence, Microscopy, Cotransfection, Inverted Microscopy

    9) Product Images from "CTAG-Containing Cleavage Site Profiling to Delineate Salmonella into Natural Clusters"

    Article Title: CTAG-Containing Cleavage Site Profiling to Delineate Salmonella into Natural Clusters

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0103388

    Physical map comparison between S. gallinarum strains 287/91 and SARB21. The map of SARB21 was reported previously [21] ; here letter designations for the cleavage fragments of SARB21 have been changed according to the homologues in strain 287/91 for the convenience of comparison. Note that all XbaI, I-CeuI and AvrII (maps from top to bottom) cleavage sites are conserved in the two strains except the AvrII site between fragments F and J in 287/91 (open arrow), which is missing from SARB21. Lines with solid arrowheads at both ends indicate the ranges of genomic inversions via rrn -mediated recombination between the two strains and filled arrows indicate recombination sites that have resulted in the translocation of I-CeuI fragment D.
    Figure Legend Snippet: Physical map comparison between S. gallinarum strains 287/91 and SARB21. The map of SARB21 was reported previously [21] ; here letter designations for the cleavage fragments of SARB21 have been changed according to the homologues in strain 287/91 for the convenience of comparison. Note that all XbaI, I-CeuI and AvrII (maps from top to bottom) cleavage sites are conserved in the two strains except the AvrII site between fragments F and J in 287/91 (open arrow), which is missing from SARB21. Lines with solid arrowheads at both ends indicate the ranges of genomic inversions via rrn -mediated recombination between the two strains and filled arrows indicate recombination sites that have resulted in the translocation of I-CeuI fragment D.

    Techniques Used: Translocation Assay

    XbaI and AvrII cleavage patterns of S. gallinarum strains 287/91 and SARB21 after PFGE separation. (A) XbaI cleavage. Lanes: 1, SARB21; 2, 287/91; 3, λDNA as molecular size marker. (B) AvrII cleavage. Lanes: 1, λDNA as molecular size marker; 2, SARB21; 3, 287/91. Letter designations are for strain 287/91; the same letters are used for homologous fragments in strain SARB21. In the designation of fragments in SARB21, C′ means a fragment homologous to C in 287/91 but truncated on the right-hand part by genomic rearrangement, and ‘C means truncation on the left-hand part of the fragment.
    Figure Legend Snippet: XbaI and AvrII cleavage patterns of S. gallinarum strains 287/91 and SARB21 after PFGE separation. (A) XbaI cleavage. Lanes: 1, SARB21; 2, 287/91; 3, λDNA as molecular size marker. (B) AvrII cleavage. Lanes: 1, λDNA as molecular size marker; 2, SARB21; 3, 287/91. Letter designations are for strain 287/91; the same letters are used for homologous fragments in strain SARB21. In the designation of fragments in SARB21, C′ means a fragment homologous to C in 287/91 but truncated on the right-hand part by genomic rearrangement, and ‘C means truncation on the left-hand part of the fragment.

    Techniques Used: Marker

    10) Product Images from "DNA Topoisomerases Participate in Fragility of the Oncogene RET"

    Article Title: DNA Topoisomerases Participate in Fragility of the Oncogene RET

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075741

    Location of APH-induced DNA breakpoints within intron 11 of RET detected by LM-PCR. (A) The location of 144 APH-induced DNA breakpoints isolated within intron 11 of RET by LM-PCR were determined by DNA sequencing (arrowheads). DNA breaks identified on the strand shown by the sequence are indicated by black arrowheads, and on the complementary strand by grey arrowheads. Open arrowheads indicate the locations of known patient breakpoints observed in PTC tumors containing RET/PTC rearrangements [ 39 , 47 – 50 ]. The location of BanI and XbaI digestion sites within intron 11 are labeled. RET primer sets (see Table S1 ) are indicated by arrows. Lines with circles are dual biotin-labeled primers followed by two nested primers. The dashed black lines represent primer set 1, dashed grey lines primer set 2, solid black lines primer set 3, and solid grey lines primer set 4. The sequence of intron 11 is displayed along with the flanking exon 10 and 11 sequences, shown in italics. (B) The distribution of APH-induced DNA breakpoints within intron 11 are depicted as a smooth curve fit of the percentage of breakpoints (y axis) located every 50 bp of intron 11 in a 5’ to 3’ direction (x axis).
    Figure Legend Snippet: Location of APH-induced DNA breakpoints within intron 11 of RET detected by LM-PCR. (A) The location of 144 APH-induced DNA breakpoints isolated within intron 11 of RET by LM-PCR were determined by DNA sequencing (arrowheads). DNA breaks identified on the strand shown by the sequence are indicated by black arrowheads, and on the complementary strand by grey arrowheads. Open arrowheads indicate the locations of known patient breakpoints observed in PTC tumors containing RET/PTC rearrangements [ 39 , 47 – 50 ]. The location of BanI and XbaI digestion sites within intron 11 are labeled. RET primer sets (see Table S1 ) are indicated by arrows. Lines with circles are dual biotin-labeled primers followed by two nested primers. The dashed black lines represent primer set 1, dashed grey lines primer set 2, solid black lines primer set 3, and solid grey lines primer set 4. The sequence of intron 11 is displayed along with the flanking exon 10 and 11 sequences, shown in italics. (B) The distribution of APH-induced DNA breakpoints within intron 11 are depicted as a smooth curve fit of the percentage of breakpoints (y axis) located every 50 bp of intron 11 in a 5’ to 3’ direction (x axis).

    Techniques Used: Polymerase Chain Reaction, Isolation, DNA Sequencing, Sequencing, Labeling

    11) Product Images from "Occurrence of Extended-Spectrum ?-Lactamases in Members of the Genus Shigella in the Republic of Korea"

    Article Title: Occurrence of Extended-Spectrum ?-Lactamases in Members of the Genus Shigella in the Republic of Korea

    Journal:

    doi: 10.1128/JCM.42.11.5264-5269.2004

    Clustering of XbaI-digested PFGE patterns for ESBL-producing S. sonnei strains.
    Figure Legend Snippet: Clustering of XbaI-digested PFGE patterns for ESBL-producing S. sonnei strains.

    Techniques Used:

    12) Product Images from "β-nicotinamide mononucleotide (NMN) production in Escherichia coli"

    Article Title: β-nicotinamide mononucleotide (NMN) production in Escherichia coli

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-30792-0

    pET28a-baPrs-hdNadV bicistronic vector construction. Prs gene from Bacillus amyloliquefaciens with L135I mutation (ctc to ata) was cloned in pUC57-kan vector (GenScript synthesis). pET28a-hdNadV Vector and PCR amplification of prs fragment were digested (with NcoI and XbaI restriction enzymes) and the fragments corresponding to 1030 bp and 6687 bp were purified and ligated. The DNA construct was chemically transformed in Escherichia coli DH5α, verified by agarose gel electrophoresis and transformed in strain BL21(DE3)pLysS. After transformation, cells were grown into a 500 mL bench-top bioreactor system and the NMN yield was determined by derivatization followed by fluorimetric assay.
    Figure Legend Snippet: pET28a-baPrs-hdNadV bicistronic vector construction. Prs gene from Bacillus amyloliquefaciens with L135I mutation (ctc to ata) was cloned in pUC57-kan vector (GenScript synthesis). pET28a-hdNadV Vector and PCR amplification of prs fragment were digested (with NcoI and XbaI restriction enzymes) and the fragments corresponding to 1030 bp and 6687 bp were purified and ligated. The DNA construct was chemically transformed in Escherichia coli DH5α, verified by agarose gel electrophoresis and transformed in strain BL21(DE3)pLysS. After transformation, cells were grown into a 500 mL bench-top bioreactor system and the NMN yield was determined by derivatization followed by fluorimetric assay.

    Techniques Used: Plasmid Preparation, Mutagenesis, Clone Assay, Polymerase Chain Reaction, Amplification, Purification, Construct, Transformation Assay, Agarose Gel Electrophoresis, Fluorimetry Assay

    13) Product Images from "Genetic and phenotypic diversity of Ralstonia solanacearum biovar 2 strains obtained from Dutch waterways"

    Article Title: Genetic and phenotypic diversity of Ralstonia solanacearum biovar 2 strains obtained from Dutch waterways

    Journal: Antonie Van Leeuwenhoek

    doi: 10.1007/s10482-009-9400-1

    a Agarose gel of uncut genomic DNA of R. solancearum strains, showing the two circular replicons. Lane M : H. wingei chromosomal marker, lane 1 : GMI1000 (biovar 3), lane 2 : 1609, lane 3 : 715, lane 4 : KZR-5, lane 5 : PA2, lane 6 : PA5. Run conditions were: 0.8% chromosomal-grade agarose (1× TAE), switch time of 500 s, 3 V/cm, 14°C for 48 h. b Agarose gel showing pulsed field gel electrophoresis profiles of XbaI digested genomic DNA of R. solanacearum strains. Lane M : lambda marker, lane 1 : 715, lane 2 : 1609, lane 3 : KZR-1, lane 4 : KZR-2, lane 5 : KZR-3, lane 6 : KZR-5, lane 7 : PA1, lane 8 : PA2, lane 9 : PA4, lane 10 : PA5, lane 11 : WA19, lane 12 : WC76, lane 13 : WC78. Arrows : polymorphic bands. Run conditions were: 1% pulsed field certified agarose (0.5× TBE), switch time 1–80 s, 6 V/cm, 14°C for 22 h
    Figure Legend Snippet: a Agarose gel of uncut genomic DNA of R. solancearum strains, showing the two circular replicons. Lane M : H. wingei chromosomal marker, lane 1 : GMI1000 (biovar 3), lane 2 : 1609, lane 3 : 715, lane 4 : KZR-5, lane 5 : PA2, lane 6 : PA5. Run conditions were: 0.8% chromosomal-grade agarose (1× TAE), switch time of 500 s, 3 V/cm, 14°C for 48 h. b Agarose gel showing pulsed field gel electrophoresis profiles of XbaI digested genomic DNA of R. solanacearum strains. Lane M : lambda marker, lane 1 : 715, lane 2 : 1609, lane 3 : KZR-1, lane 4 : KZR-2, lane 5 : KZR-3, lane 6 : KZR-5, lane 7 : PA1, lane 8 : PA2, lane 9 : PA4, lane 10 : PA5, lane 11 : WA19, lane 12 : WC76, lane 13 : WC78. Arrows : polymorphic bands. Run conditions were: 1% pulsed field certified agarose (0.5× TBE), switch time 1–80 s, 6 V/cm, 14°C for 22 h

    Techniques Used: Agarose Gel Electrophoresis, Marker, Pulsed-Field Gel, Electrophoresis

    14) Product Images from "Diverse genome structures of Salmonella paratyphi C"

    Article Title: Diverse genome structures of Salmonella paratyphi C

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-8-290

    PFGE separation of cleaved genomic DNA of S. paratyphi C RKS4594 . (A), cleavage with XbaI; (B), cleavage with AvrII.
    Figure Legend Snippet: PFGE separation of cleaved genomic DNA of S. paratyphi C RKS4594 . (A), cleavage with XbaI; (B), cleavage with AvrII.

    Techniques Used:

    15) Product Images from "RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical workflow to evaluate inherent biases"

    Article Title: RNA-DNA hybrid (R-loop) immunoprecipitation mapping: an analytical workflow to evaluate inherent biases

    Journal:

    doi: 10.1101/gr.219394.116

    Experimental design: constructing DRIP schemes. ( A ) Experiments 1–16 explore the effect of formaldehyde-fixation (Step 1), nucleic acid isolation (Step 2), removal of free RNA (Step 3), and nucleic acid fragmentation (Step 4) on the outcome of RNA-DNA hybrid detection. Each experiment was performed at two parallel cell lysis temperatures (65°C and 37°C), respectively. The temperature variable is not depicted in the cartoon, but it is referred in the main text. ( B ) Experiments 17–24 test the impact of acoustic sharing performed on a chromatin prep rather than on naked nucleic acid, similarly to the ChIP protocol. Each experiment was performed at 65°C cell lysis temperature. ( C ) Workflow of a ChIP experiment (shown only for comparison with the DRIP pipeline). (HCHO) Formaldehyde fixation, (Phe/Chl) phenol-chloroform extraction, (Kit) silica membrane-based nucleic acid purification, (RNase A) Ribonuclease A digestion performed at high (300 mM) NaCl concentration, (Son) sonication, (RE) restriction enzyme cocktail digestion (HindIII, EcoRI, BsrGI, XbaI, and SspI). As a negative control, RNase H digestion was applied in all DRIP experiments (not indicated in the cartoon).
    Figure Legend Snippet: Experimental design: constructing DRIP schemes. ( A ) Experiments 1–16 explore the effect of formaldehyde-fixation (Step 1), nucleic acid isolation (Step 2), removal of free RNA (Step 3), and nucleic acid fragmentation (Step 4) on the outcome of RNA-DNA hybrid detection. Each experiment was performed at two parallel cell lysis temperatures (65°C and 37°C), respectively. The temperature variable is not depicted in the cartoon, but it is referred in the main text. ( B ) Experiments 17–24 test the impact of acoustic sharing performed on a chromatin prep rather than on naked nucleic acid, similarly to the ChIP protocol. Each experiment was performed at 65°C cell lysis temperature. ( C ) Workflow of a ChIP experiment (shown only for comparison with the DRIP pipeline). (HCHO) Formaldehyde fixation, (Phe/Chl) phenol-chloroform extraction, (Kit) silica membrane-based nucleic acid purification, (RNase A) Ribonuclease A digestion performed at high (300 mM) NaCl concentration, (Son) sonication, (RE) restriction enzyme cocktail digestion (HindIII, EcoRI, BsrGI, XbaI, and SspI). As a negative control, RNase H digestion was applied in all DRIP experiments (not indicated in the cartoon).

    Techniques Used: Isolation, Lysis, Chromatin Immunoprecipitation, Nucleic Acid Purification, Concentration Assay, Sonication, Negative Control

    16) Product Images from "Defining natural species of bacteria: clear-cut genomic boundaries revealed by a turning point in nucleotide sequence divergence"

    Article Title: Defining natural species of bacteria: clear-cut genomic boundaries revealed by a turning point in nucleotide sequence divergence

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-14-489

    Genomic DNA PFGE patterns of representative Salmonella strains, cleaved with I-CeuI (a), XbaI (b) and SpeI (c), respectively. Lanes: 1, DNA size Marker; 2-5, S. enteritidis (SE310, SE154, SE301, LK5); 6-14, S. pullorum (RKS5078, CDC1983-67, SARB51, 04–6767, NS387, 00–19557, 02–15951, 03–16062, 98–13777); 15–20, S. gallinarum (287/91, RKS5021, SGSC2293, 91–29327, 90–5289, 92–7995).
    Figure Legend Snippet: Genomic DNA PFGE patterns of representative Salmonella strains, cleaved with I-CeuI (a), XbaI (b) and SpeI (c), respectively. Lanes: 1, DNA size Marker; 2-5, S. enteritidis (SE310, SE154, SE301, LK5); 6-14, S. pullorum (RKS5078, CDC1983-67, SARB51, 04–6767, NS387, 00–19557, 02–15951, 03–16062, 98–13777); 15–20, S. gallinarum (287/91, RKS5021, SGSC2293, 91–29327, 90–5289, 92–7995).

    Techniques Used: Marker

    17) Product Images from "Organization of the cpe Locus in CPE-Positive Clostridium perfringens Type C and D Isolates"

    Article Title: Organization of the cpe Locus in CPE-Positive Clostridium perfringens Type C and D Isolates

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0010932

    RFLP analyses of cpe -positive type A, C, and D isolates and type E isolates carrying silent cpe sequences. DNA from each isolate was digested with XbaI prior to conventional agarose gel electrophoresis and Southern blot hybridization with a cpe -specific probe. The migration of molecular weight markers is shown on the left of the blot.
    Figure Legend Snippet: RFLP analyses of cpe -positive type A, C, and D isolates and type E isolates carrying silent cpe sequences. DNA from each isolate was digested with XbaI prior to conventional agarose gel electrophoresis and Southern blot hybridization with a cpe -specific probe. The migration of molecular weight markers is shown on the left of the blot.

    Techniques Used: Agarose Gel Electrophoresis, Southern Blot, Hybridization, Migration, Molecular Weight

    Related Articles

    Clone Assay:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. In addition, a series of forward primers containing a Kpn I site was generated , corresponding to internal regions of the Danio rerio GIP promoter.

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: Following amplification the DNA was purified using the QIAquick PCR Purification Kit (Qiagen), quantified on an agarose gel, digested with Kpn I and Xho I (NEB), repurified, and ligated into pBluescript SK+ (Stratagene), which had been digested with Kpn I and Xho I and gel purified (Zymoclean Gel DNA Recovery Kit, Zymo Research). .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB). .. Gel-purified vector was ligated to TcBuster1 right end PCR product and digested with Sac I and Xba I.

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB). .. This vector was then digested with Nde I and Kpn I and the resulting Nde I-Tarp200- Kpn I fragment was subcloned into the corresponding sites of pCX340 (provided by Prof. Gadi Frankel, Imperial College).

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: For the generation of a recipient line, the endogenous actin 1 gene containing silent restriction sites to facilitate subdomain exchanges were ordered from GeneArt (Invitrogen Corp) and cloned into the Pb238 vector [ , ] with BamHI and XbaI restriction sites. .. The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. The flanking actin 3′ UTR was amplified using primers 3 and 4 and cloned into the transfection vector via AvrII and KpnI restriction sites.

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: After digestion of this HCVcc backbone with enzyme Afe I (New England Biolabs), E1E2 inserts amplified from library plasmids were inserted in frame using In-Fusion cloning. .. To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion).

    Article Title: PME-1, an Extended-Spectrum ?-Lactamase Identified in Pseudomonas aeruginosa
    Article Snippet: Paragraph title: PCR cloning of bla PME-1 . ... The PCR product and pBC-SK(−) (Stratagene) were double digested with XbaI and HindIII (New England Biolabs), ligated, and used to transform E. coli DH10B by electroporation.

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: Paragraph title: Construction of chimeric full-length cDNA clones. ... After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Centrifugation:

    Article Title: MicroRNA-133 overexpression promotes the therapeutic efficacy of mesenchymal stem cells on acute myocardial infarction
    Article Snippet: The vector and pre-miR-133a fragments amplified from rat genomic DNA were digested with Xba I and Eco RI (NEB, USA) and ligated with T4 ligase (TAKARA). .. For lentiviral production, HEK293NT cells were cotransfected with control vector or lentiviral plasmid carrying pre-miR-133 fragments, along with lentiviral packaging mix.

    Amplification:

    Article Title: MicroRNA-133 overexpression promotes the therapeutic efficacy of mesenchymal stem cells on acute myocardial infarction
    Article Snippet: The vector pCDH-CMV-MCS-EF1-copGFP was used as a backbone plasmid to reconstruct lentiviral vector containing miR-133a. .. The vector and pre-miR-133a fragments amplified from rat genomic DNA were digested with Xba I and Eco RI (NEB, USA) and ligated with T4 ligase (TAKARA). .. The primers used for amplification of pre-miR-133a are as follows: sense, 5′-ATGTCTAGACCCTCTAATACTCGTCAT-3′; and antisense, 5′-GAATTCGACCGTTGTTAGTTGTTT-3′.

    Article Title: Biosynthesis of fragin is controlled by a novel quorum sensing signal
    Article Snippet: The amplified fragments were separated on agarose gels, excised and purified with the QIAquick gel extraction kit (Qiagen). .. The expression vector pBBR1MCS2 was digested with the restriction enzymes Hin dIII and Xba I (New England BioLabs Inc.; expression of hamA , hamB , hamD , hamF , and hamG ) or Xho I and Xba I (New England BioLabs Inc.; expression of hamC and hamE ) according to the manufacturer’s instructions and subsequently purified by the QIAquick PCR purification kit (Qiagen).

    Article Title: A novel mutation in EYA1 in a Chinese family with Branchio-oto-renal syndrome
    Article Snippet: The genomic DNA of III:1 (control sample) and III:2 (case sample) were PCR amplified with Q5 hot start high-fidelity DNA polymerases (New England Biolabs, MA, USA) for exon 11 of EYA1 (2,051 bp total, 967 bp upstream, and 1,000 bp downstream, according to c.967A). .. Next, the PCR products were digested with Xba I and Xho I (New England Biolabs) and ligated in carrier pCMV-Tag-2B (Agilent Technologies) to generate pCMV-con (c.967A) and pCMV-case (only c.967 T was picked).

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: Following amplification the DNA was purified using the QIAquick PCR Purification Kit (Qiagen), quantified on an agarose gel, digested with Kpn I and Xho I (NEB), repurified, and ligated into pBluescript SK+ (Stratagene), which had been digested with Kpn I and Xho I and gel purified (Zymoclean Gel DNA Recovery Kit, Zymo Research). .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB).

    Article Title: Genome Rearrangements Caused by Depletion of Essential DNA Replication Proteins in Saccharomyces cerevisiae
    Article Snippet: Genomic DNA was isolated (Qiagen) from wild-type strains R1158 and BY4741 and digested with Eco RI and Xba I (New England Biolabs) using the suggested conditions. .. Digested fragments were separated on a 1% agarose gel and hybridized with and FS2-2 probes for Southern blot analysis ( ).

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: For Southern-blot analysis, a digoxigenin ( )-labeled probe covering 353 bp of exon 1 of LesaDOG1 was amplified with primers LesaDOG1a-FP3-wgDNA and GSP-3 ( ) from 20 pg of pGEM-T Easy vector (Promega) containing the genomic sequence of LesaDOG1 using the PCR Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Article Title: Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2
    Article Snippet: For reporter-based luciferase activity assays, we flanked a SESN2 3’UTR fragment with the primers SESN2 _s: 5’-gggAgAATTCTgTTCTCCCAg-3’ and SESN2 _as: 5’-TgCACTTgAACACTggATACC-3’ using Phusion Hot Start II PCR (Cat #: F549S, Thermo Fisher Scientific Inc., Waltham, MA). .. The amplicon was digested with XbaI (Cat #: R0145S, New England Biolabs Inc., Ipswich, MA) for a 637-bp fragment which was subsequently inserted into pGL4.10-Luc2 vector (Promega, Madison, WI). .. The cytomegalovirus (CMV) promoter was placed into the pGL4.10-Luc-SESN2 3’UTR vector ( ) to promote gene transcription, and form pCL-SESN2 _3’UTR construct for reporter assay.

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: Briefly, RSP_1566 plus ~1-kbp flanking DNA up- and downstream of RSP_1566 was amplified from R. sphaeroides genomic DNA with primers g1566_F_XbaI and g1566_R_HindIII. .. The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566. .. The RSP_1566 coding sequence was deleted from pK18mobsacB _genomicRSP1566 by PCR with phosphorylated primers RSP_1566_deletionF and RSP_1566_deletionR.

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: For the generation of a recipient line, the endogenous actin 1 gene containing silent restriction sites to facilitate subdomain exchanges were ordered from GeneArt (Invitrogen Corp) and cloned into the Pb238 vector [ , ] with BamHI and XbaI restriction sites. .. The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. The flanking actin 3′ UTR was amplified using primers 3 and 4 and cloned into the transfection vector via AvrII and KpnI restriction sites.

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: After digestion of this HCVcc backbone with enzyme Afe I (New England Biolabs), E1E2 inserts amplified from library plasmids were inserted in frame using In-Fusion cloning. .. To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion).

    Article Title: PME-1, an Extended-Spectrum ?-Lactamase Identified in Pseudomonas aeruginosa
    Article Snippet: The structural gene corresponding to the enzyme was amplified with primers bla PME-1 -F-XbaI (5′-GCG TCTAGA ATGTTCCTTTACTTCACA-3′; the XbaI site is underlined) and bla PME-1 -R-HindIII (5′-GCG AAGCTT TCAATCGCCCGCCCAG-3′; the HindIII site is underlined). .. The PCR product and pBC-SK(−) (Stratagene) were double digested with XbaI and HindIII (New England Biolabs), ligated, and used to transform E. coli DH10B by electroporation.

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: Using the purified EAV2ab34 and APRRS56 products as templates, the hybrid fragment EAV2ab34–APRRS56 was amplified via splicing overlap extension (SOE) PCR with the primer pair FE234asc–RA14780 ( ). .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Synthesized:

    Article Title: A novel mutation in EYA1 in a Chinese family with Branchio-oto-renal syndrome
    Article Snippet: Next, the PCR products were digested with Xba I and Xho I (New England Biolabs) and ligated in carrier pCMV-Tag-2B (Agilent Technologies) to generate pCMV-con (c.967A) and pCMV-case (only c.967 T was picked). .. Next, the PCR products were digested with Xba I and Xho I (New England Biolabs) and ligated in carrier pCMV-Tag-2B (Agilent Technologies) to generate pCMV-con (c.967A) and pCMV-case (only c.967 T was picked).

    Neutralization:

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion). .. Transfection supernatants were collected 4–6 days later and stored at −80 °C for titring by HCV NS5A immunostaining.

    Immunostaining:

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion). .. Five micrograms of RNA was transfected into 1.8e6 Huh7.5.1 cells using Nucleofector kit T (Amaxa) and plated in a 6 cm plate.

    Electrophoresis:

    Article Title: Features of Infections Due to Klebsiella pneumoniae Carbapenemase-Producing Escherichia coli: Emergence of Sequence Type 131
    Article Snippet: Genomic DNA of the isolates were prepared as described elsewhere [ ]. .. Fingerprints were generated by Xba I (New England Biolabs) and subjected to electrophoresis using a CHEF DR III system (Bio-Rad). .. The relatedness of PFGE patterns was determined by unweighted-pair group method using average linkages and the DICE setting clustering analysis on Bionumerics software, version 6.0 (Applied Maths).

    Incubation:

    Article Title: MicroRNA-133 overexpression promotes the therapeutic efficacy of mesenchymal stem cells on acute myocardial infarction
    Article Snippet: The vector and pre-miR-133a fragments amplified from rat genomic DNA were digested with Xba I and Eco RI (NEB, USA) and ligated with T4 ligase (TAKARA). .. For lentiviral production, HEK293NT cells were cotransfected with control vector or lentiviral plasmid carrying pre-miR-133 fragments, along with lentiviral packaging mix.

    Article Title: A novel mutation in EYA1 in a Chinese family with Branchio-oto-renal syndrome
    Article Snippet: Next, the PCR products were digested with Xba I and Xho I (New England Biolabs) and ligated in carrier pCMV-Tag-2B (Agilent Technologies) to generate pCMV-con (c.967A) and pCMV-case (only c.967 T was picked). .. The two plasmids were transformed in 293 T cells using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. -labeled probe (4 µL per mL of hybridization solution Easy Hyb [Roche]) was hybridized to the membrane at 41.5°C for 18 h followed by high-stringency washes in 0.5× SSC + 0.1% (w/v) SDS at 65°C.

    Article Title: In vivo production of RNA nanostructures via programmed folding of single-stranded RNAs
    Article Snippet: Double-stranded DNA template and pET23a plasmid (GenScript Inc.) were double-digested by XbaI and StyI-HF restriction enzymes (New England BioLabs Inc.) by following the manufacturer-recommended protocol. .. Double-stranded DNA template and pET23a plasmid (GenScript Inc.) were double-digested by XbaI and StyI-HF restriction enzymes (New England BioLabs Inc.) by following the manufacturer-recommended protocol.

    Luciferase:

    Article Title: Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2
    Article Snippet: For reporter-based luciferase activity assays, we flanked a SESN2 3’UTR fragment with the primers SESN2 _s: 5’-gggAgAATTCTgTTCTCCCAg-3’ and SESN2 _as: 5’-TgCACTTgAACACTggATACC-3’ using Phusion Hot Start II PCR (Cat #: F549S, Thermo Fisher Scientific Inc., Waltham, MA). .. The amplicon was digested with XbaI (Cat #: R0145S, New England Biolabs Inc., Ipswich, MA) for a 637-bp fragment which was subsequently inserted into pGL4.10-Luc2 vector (Promega, Madison, WI).

    Activity Assay:

    Article Title: Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2
    Article Snippet: For reporter-based luciferase activity assays, we flanked a SESN2 3’UTR fragment with the primers SESN2 _s: 5’-gggAgAATTCTgTTCTCCCAg-3’ and SESN2 _as: 5’-TgCACTTgAACACTggATACC-3’ using Phusion Hot Start II PCR (Cat #: F549S, Thermo Fisher Scientific Inc., Waltham, MA). .. The amplicon was digested with XbaI (Cat #: R0145S, New England Biolabs Inc., Ipswich, MA) for a 637-bp fragment which was subsequently inserted into pGL4.10-Luc2 vector (Promega, Madison, WI).

    Infection:

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion). .. Transfection supernatants were collected 4–6 days later and stored at −80 °C for titring by HCV NS5A immunostaining.

    Expressing:

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Paragraph title: Construction of Plant X-tender expression vectors ... Vectors pK7WG, pB7WG and pH7WG (Karimi et al., 2002) were digested with Xba I and Sac I (NEB), allowing the release of T35S–AttR2–ccd B–AttR1 cassette from the vector backbone and purified from the gel ( ).

    Article Title: Biosynthesis of fragin is controlled by a novel quorum sensing signal
    Article Snippet: The purified fragments were digested with the restriction enzymes (New England BioLabs Inc.) indicated in Supplementary Data according to the manufacturer’s instructions and again purified by the QIAquick PCR purification kit (Qiagen). .. The expression vector pBBR1MCS2 was digested with the restriction enzymes Hin dIII and Xba I (New England BioLabs Inc.; expression of hamA , hamB , hamD , hamF , and hamG ) or Xho I and Xba I (New England BioLabs Inc.; expression of hamC and hamE ) according to the manufacturer’s instructions and subsequently purified by the QIAquick PCR purification kit (Qiagen). .. The promoter fragments were ligated into pSU11 with T4 ligase (New England BioLabs Inc.) according to the manufacturer’s instructions.

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: The BL21star expression strain was transformed or co-transformed with pET200-TARP200, pET101-Slc1, pET101-Slc2, and pET56-Scc1-FLAG, as appropriate. .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB). .. These digested inserts were then ligated into the corresponding Xba I and Sca I sites of pBAD18 (( ); American Tissue Culture Collection). mcsc and slc1 were cloned into the pBAD-TOPO vector.

    Modification:

    Article Title: A novel mutation in EYA1 in a Chinese family with Branchio-oto-renal syndrome
    Article Snippet: Next, the PCR products were digested with Xba I and Xho I (New England Biolabs) and ligated in carrier pCMV-Tag-2B (Agilent Technologies) to generate pCMV-con (c.967A) and pCMV-case (only c.967 T was picked). .. The two plasmids were transformed in 293 T cells using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Transformation Assay:

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Vectors pK7WG, pB7WG and pH7WG (Karimi et al., 2002) were digested with Xba I and Sac I (NEB), allowing the release of T35S–AttR2–ccd B–AttR1 cassette from the vector backbone and purified from the gel ( ). .. The ccd B region was amplified from AssemblX pL0A_0–1 Level 0 plasmid [ ] using KG15/KG16 primers, purified from the gel and amplified with KG15/KG18 for pCAMBIA1300 and KG19/KG21 primers for the other three plasmid backbones to add homology regions with flanking restriction enzyme recognition sites (see for the list of primers).

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: The BL21star expression strain was transformed or co-transformed with pET200-TARP200, pET101-Slc1, pET101-Slc2, and pET56-Scc1-FLAG, as appropriate. .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566. .. The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566.

    Genetically Modified:

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: Plasmid DNA was purified from the TOP10 genetically-modified strains by using Qiaprep Spin Miniprep Kit.(Qiagen). .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Blocking Assay:

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. -labeled probe (4 µL per mL of hybridization solution Easy Hyb [Roche]) was hybridized to the membrane at 41.5°C for 18 h followed by high-stringency washes in 0.5× SSC + 0.1% (w/v) SDS at 65°C.

    Hybridization:

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Conjugation Assay:

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566. .. The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566.

    Transfection:

    Article Title: MicroRNA-133 overexpression promotes the therapeutic efficacy of mesenchymal stem cells on acute myocardial infarction
    Article Snippet: The vector and pre-miR-133a fragments amplified from rat genomic DNA were digested with Xba I and Eco RI (NEB, USA) and ligated with T4 ligase (TAKARA). .. For lentiviral production, HEK293NT cells were cotransfected with control vector or lentiviral plasmid carrying pre-miR-133 fragments, along with lentiviral packaging mix.

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: Transfection vectors were generated using standard molecular biology techniques. .. The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs).

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion). .. To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion).

    Southern Blot:

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: For Southern-blot analysis, a digoxigenin ( )-labeled probe covering 353 bp of exon 1 of LesaDOG1 was amplified with primers LesaDOG1a-FP3-wgDNA and GSP-3 ( ) from 20 pg of pGEM-T Easy vector (Promega) containing the genomic sequence of LesaDOG1 using the PCR Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Introduce:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. PCR products were isolated and cloned into the pGL3 basic vector, and inserts were sequenced (GeneCore) to confirm identity.

    Generated:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. The reverse primer (pGL3R, ) corresponded to a sequence 128 bp downstream of the multiple cloning region of the pGL3 basic vector, and was used to generate all constructs.

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB). .. This vector was then digested with Nde I and Kpn I and the resulting Nde I-Tarp200- Kpn I fragment was subcloned into the corresponding sites of pCX340 (provided by Prof. Gadi Frankel, Imperial College).

    Article Title: Features of Infections Due to Klebsiella pneumoniae Carbapenemase-Producing Escherichia coli: Emergence of Sequence Type 131
    Article Snippet: Genomic DNA of the isolates were prepared as described elsewhere [ ]. .. Fingerprints were generated by Xba I (New England Biolabs) and subjected to electrophoresis using a CHEF DR III system (Bio-Rad). .. The relatedness of PFGE patterns was determined by unweighted-pair group method using average linkages and the DICE setting clustering analysis on Bionumerics software, version 6.0 (Applied Maths).

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: Transfection vectors were generated using standard molecular biology techniques. .. The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs).

    Article Title: Extended-Spectrum Beta-lactamase Producers: Detection for the Diagnostic Laboratory
    Article Snippet: Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.). .. Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.).

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: Amplified sections were re-assembled using In-Fusion cloning (Clontech), and this reassembly generated an Afe I restriction site at the location of the omitted nucleotides. .. To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion).

    other:

    Article Title: Strong influence of livestock environments on the emergence and dissemination of distinct multidrug-resistant phenotypes among the population of non-typhoidal Salmonella
    Article Snippet: Briefly, genomic DNA was digested with the restriction enzyme XbaI (New England Biolabs Inc., Beverly MA) overnight at 25°C.

    Overlap Extension Polymerase Chain Reaction:

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: Using the purified EAV2ab34 and APRRS56 products as templates, the hybrid fragment EAV2ab34–APRRS56 was amplified via splicing overlap extension (SOE) PCR with the primer pair FE234asc–RA14780 ( ). .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Polymerase Chain Reaction:

    Article Title: Biosynthesis of fragin is controlled by a novel quorum sensing signal
    Article Snippet: The purified fragments were digested with the restriction enzymes (New England BioLabs Inc.) indicated in Supplementary Data according to the manufacturer’s instructions and again purified by the QIAquick PCR purification kit (Qiagen). .. The expression vector pBBR1MCS2 was digested with the restriction enzymes Hin dIII and Xba I (New England BioLabs Inc.; expression of hamA , hamB , hamD , hamF , and hamG ) or Xho I and Xba I (New England BioLabs Inc.; expression of hamC and hamE ) according to the manufacturer’s instructions and subsequently purified by the QIAquick PCR purification kit (Qiagen). .. The promoter fragments were ligated into pSU11 with T4 ligase (New England BioLabs Inc.) according to the manufacturer’s instructions.

    Article Title: A novel mutation in EYA1 in a Chinese family with Branchio-oto-renal syndrome
    Article Snippet: The genomic DNA of III:1 (control sample) and III:2 (case sample) were PCR amplified with Q5 hot start high-fidelity DNA polymerases (New England Biolabs, MA, USA) for exon 11 of EYA1 (2,051 bp total, 967 bp upstream, and 1,000 bp downstream, according to c.967A). .. Next, the PCR products were digested with Xba I and Xho I (New England Biolabs) and ligated in carrier pCMV-Tag-2B (Agilent Technologies) to generate pCMV-con (c.967A) and pCMV-case (only c.967 T was picked). .. The two plasmids were transformed in 293 T cells using Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions.

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: A series of Danio rerio GIP promoter deletion constructs was created using PCR. .. The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. The reverse primer (pGL3R, ) corresponded to a sequence 128 bp downstream of the multiple cloning region of the pGL3 basic vector, and was used to generate all constructs.

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: Following amplification the DNA was purified using the QIAquick PCR Purification Kit (Qiagen), quantified on an agarose gel, digested with Kpn I and Xho I (NEB), repurified, and ligated into pBluescript SK+ (Stratagene), which had been digested with Kpn I and Xho I and gel purified (Zymoclean Gel DNA Recovery Kit, Zymo Research). .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB).

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: The presence of the correct plasmids was determined by colony PCR and sequencing. .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Article Title: Genome Rearrangements Caused by Depletion of Essential DNA Replication Proteins in Saccharomyces cerevisiae
    Article Snippet: Genomic DNA was isolated (Qiagen) from wild-type strains R1158 and BY4741 and digested with Eco RI and Xba I (New England Biolabs) using the suggested conditions. .. Digested fragments were separated on a 1% agarose gel and hybridized with and FS2-2 probes for Southern blot analysis ( ).

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: For Southern-blot analysis, a digoxigenin ( )-labeled probe covering 353 bp of exon 1 of LesaDOG1 was amplified with primers LesaDOG1a-FP3-wgDNA and GSP-3 ( ) from 20 pg of pGEM-T Easy vector (Promega) containing the genomic sequence of LesaDOG1 using the PCR Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Article Title: Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2
    Article Snippet: For reporter-based luciferase activity assays, we flanked a SESN2 3’UTR fragment with the primers SESN2 _s: 5’-gggAgAATTCTgTTCTCCCAg-3’ and SESN2 _as: 5’-TgCACTTgAACACTggATACC-3’ using Phusion Hot Start II PCR (Cat #: F549S, Thermo Fisher Scientific Inc., Waltham, MA). .. The amplicon was digested with XbaI (Cat #: R0145S, New England Biolabs Inc., Ipswich, MA) for a 637-bp fragment which was subsequently inserted into pGL4.10-Luc2 vector (Promega, Madison, WI).

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566. .. The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566.

    Article Title: PME-1, an Extended-Spectrum ?-Lactamase Identified in Pseudomonas aeruginosa
    Article Snippet: The structural gene corresponding to the enzyme was amplified with primers bla PME-1 -F-XbaI (5′-GCG TCTAGA ATGTTCCTTTACTTCACA-3′; the XbaI site is underlined) and bla PME-1 -R-HindIII (5′-GCG AAGCTT TCAATCGCCCGCCCAG-3′; the HindIII site is underlined). .. The PCR product and pBC-SK(−) (Stratagene) were double digested with XbaI and HindIII (New England Biolabs), ligated, and used to transform E. coli DH10B by electroporation. .. Transformants harboring the bla PME-1 gene were selected on LB agar plates containing chloramphenicol (30 μg/ml) and ampicillin (50 μg/ml).

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: This fragment was subsequently cloned into the pCR-Blunt II-TOPO vector (Invitrogen) according to the manufacturer's recommendations in order to construct an intermediate plasmid. .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Injection:

    Article Title: Highly Efficient Targeted Mutagenesis in Mice Using TALENs
    Article Snippet: The injection of TALEN mRNA and targeting molecules (ODNs) was performed as described in , ), except that injections were done only into pronuclei. .. Briefly, capped TALEN mRNA was prepared in a single step by in vitro transcription from pT7-TALEN-95A plasmid DNA linearized with Xba I and Ale I (New England Biolabs, Frankfurt, Germany), using the mMessage mMachine T7 Ultra kit (omitting the polyadenylation step) and the MEGAclear kit (Life Technologies, Carlsbad, CA).

    Binding Assay:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. PCR products were isolated and cloned into the pGL3 basic vector, and inserts were sequenced (GeneCore) to confirm identity.

    Article Title: Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2
    Article Snippet: The amplicon was digested with XbaI (Cat #: R0145S, New England Biolabs Inc., Ipswich, MA) for a 637-bp fragment which was subsequently inserted into pGL4.10-Luc2 vector (Promega, Madison, WI). .. The cytomegalovirus (CMV) promoter was placed into the pGL4.10-Luc-SESN2 3’UTR vector ( ) to promote gene transcription, and form pCL-SESN2 _3’UTR construct for reporter assay.

    Pulsed-Field Gel:

    Article Title: Features of Infections Due to Klebsiella pneumoniae Carbapenemase-Producing Escherichia coli: Emergence of Sequence Type 131
    Article Snippet: Paragraph title: Multilocus Sequence Typing and Pulsed-Field Gel Electrophoresis ... Fingerprints were generated by Xba I (New England Biolabs) and subjected to electrophoresis using a CHEF DR III system (Bio-Rad).

    DNA Extraction:

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. Finally the positive-negative selection cassette hdhfr-yfcu (standing for human dihydrofolate reductase, yeast cytosine deaminase and uridyl phosphoribosyl transferase fusion enzyme) [ ] replaced the original selection cassette using primers 5 and 6 and restriction enzymes EcoRV and AvrII.

    Electroporation:

    Article Title: PME-1, an Extended-Spectrum ?-Lactamase Identified in Pseudomonas aeruginosa
    Article Snippet: The structural gene corresponding to the enzyme was amplified with primers bla PME-1 -F-XbaI (5′-GCG TCTAGA ATGTTCCTTTACTTCACA-3′; the XbaI site is underlined) and bla PME-1 -R-HindIII (5′-GCG AAGCTT TCAATCGCCCGCCCAG-3′; the HindIII site is underlined). .. The PCR product and pBC-SK(−) (Stratagene) were double digested with XbaI and HindIII (New England Biolabs), ligated, and used to transform E. coli DH10B by electroporation. .. Transformants harboring the bla PME-1 gene were selected on LB agar plates containing chloramphenicol (30 μg/ml) and ampicillin (50 μg/ml).

    Mutagenesis:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: Paragraph title: Construction of Danio rerio GIP promoter deletion and mutation constructs ... The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions.

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: Paragraph title: Mutant construction. ... The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566.

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: Paragraph title: Generation of chimeric or mutant parasite lines ... The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs).

    Isolation:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. In addition, a series of forward primers containing a Kpn I site was generated , corresponding to internal regions of the Danio rerio GIP promoter.

    Article Title: Genome Rearrangements Caused by Depletion of Essential DNA Replication Proteins in Saccharomyces cerevisiae
    Article Snippet: PCR primers designed for probe construction are listed in . .. Genomic DNA was isolated (Qiagen) from wild-type strains R1158 and BY4741 and digested with Eco RI and Xba I (New England Biolabs) using the suggested conditions. .. Digested fragments were separated on a 1% agarose gel and hybridized with and FS2-2 probes for Southern blot analysis ( ).

    Article Title: Extended-Spectrum Beta-lactamase Producers: Detection for the Diagnostic Laboratory
    Article Snippet: PFGE method was carried out on all the isolates from the medical and surgical Intensive Care Units (ICUs) over a 6-month period including a random computer selected control group to confirm genetic relatedness among the isolates causing infections in closed spaces. .. Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.). .. PFGE was performed with the CHEF II system (Bio-Rad, Hercules, CA).

    Size-exclusion Chromatography:

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: The primers used were TcBuster1 L For (AATGGTACCCTTTAGGC CAGTGTTCTTCAACCT G (TIR in boldface type) and TcBuster1 L Rev (CATCTCGAGATTTCTGAACGATTCTAGGTTAGGATCAAAC) with the following PCR program: 94° 2 min, 3 × (94° for 20 sec, 62° for 20 sec, 72° for 30 sec), 26 × (94° for 20 sec, 70° for 20 sec, 72° for 20 sec), 72° for 5 min, 4°. .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB).

    Labeling:

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: The probe was purified through a cellulose acetate syringe filter (Whatman). .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. DNA was transferred onto Nytran Supercharge membranes (Whatman) using a TurboBlotter (Whatman).

    Purification:

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Vector pCAMBIA1300 (Marker Gene Technologies, M1591) was digested with Bam HI and Hin dIII (NEB) and purified from the gel ( ). .. Vectors pK7WG, pB7WG and pH7WG (Karimi et al., 2002) were digested with Xba I and Sac I (NEB), allowing the release of T35S–AttR2–ccd B–AttR1 cassette from the vector backbone and purified from the gel ( ). .. The ccd B region was amplified from AssemblX pL0A_0–1 Level 0 plasmid [ ] using KG15/KG16 primers, purified from the gel and amplified with KG15/KG18 for pCAMBIA1300 and KG19/KG21 primers for the other three plasmid backbones to add homology regions with flanking restriction enzyme recognition sites (see for the list of primers).

    Article Title: Biosynthesis of fragin is controlled by a novel quorum sensing signal
    Article Snippet: The purified fragments were digested with the restriction enzymes (New England BioLabs Inc.) indicated in Supplementary Data according to the manufacturer’s instructions and again purified by the QIAquick PCR purification kit (Qiagen). .. The expression vector pBBR1MCS2 was digested with the restriction enzymes Hin dIII and Xba I (New England BioLabs Inc.; expression of hamA , hamB , hamD , hamF , and hamG ) or Xho I and Xba I (New England BioLabs Inc.; expression of hamC and hamE ) according to the manufacturer’s instructions and subsequently purified by the QIAquick PCR purification kit (Qiagen). .. The promoter fragments were ligated into pSU11 with T4 ligase (New England BioLabs Inc.) according to the manufacturer’s instructions.

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: Following amplification the DNA was purified using the QIAquick PCR Purification Kit (Qiagen), quantified on an agarose gel, digested with Kpn I and Xho I (NEB), repurified, and ligated into pBluescript SK+ (Stratagene), which had been digested with Kpn I and Xho I and gel purified (Zymoclean Gel DNA Recovery Kit, Zymo Research). .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB).

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: Plasmid DNA was purified from the TOP10 genetically-modified strains by using Qiaprep Spin Miniprep Kit.(Qiagen). .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: Using the purified EAV2ab34 and APRRS56 products as templates, the hybrid fragment EAV2ab34–APRRS56 was amplified via splicing overlap extension (SOE) PCR with the primer pair FE234asc–RA14780 ( ). .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Sequencing:

    Article Title: MicroRNA-133 overexpression promotes the therapeutic efficacy of mesenchymal stem cells on acute myocardial infarction
    Article Snippet: The vector and pre-miR-133a fragments amplified from rat genomic DNA were digested with Xba I and Eco RI (NEB, USA) and ligated with T4 ligase (TAKARA). .. The primers used for amplification of pre-miR-133a are as follows: sense, 5′-ATGTCTAGACCCTCTAATACTCGTCAT-3′; and antisense, 5′-GAATTCGACCGTTGTTAGTTGTTT-3′.

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: The clone pBSTcBusterL was made by PCR amplification using primers that encompassed the region from the TSD of TcBuster1 to the sequence immediately upstream of the ATG of the TcBuster1 ORF. .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB).

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: The presence of the correct plasmids was determined by colony PCR and sequencing. .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Article Title: Genome Rearrangements Caused by Depletion of Essential DNA Replication Proteins in Saccharomyces cerevisiae
    Article Snippet: Paragraph title: Restriction digestion and sequencing analysis of FS1 and FS2 ... Genomic DNA was isolated (Qiagen) from wild-type strains R1158 and BY4741 and digested with Eco RI and Xba I (New England Biolabs) using the suggested conditions.

    Article Title: Features of Infections Due to Klebsiella pneumoniae Carbapenemase-Producing Escherichia coli: Emergence of Sequence Type 131
    Article Snippet: Paragraph title: Multilocus Sequence Typing and Pulsed-Field Gel Electrophoresis ... Fingerprints were generated by Xba I (New England Biolabs) and subjected to electrophoresis using a CHEF DR III system (Bio-Rad).

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: For Southern-blot analysis, a digoxigenin ( )-labeled probe covering 353 bp of exon 1 of LesaDOG1 was amplified with primers LesaDOG1a-FP3-wgDNA and GSP-3 ( ) from 20 pg of pGEM-T Easy vector (Promega) containing the genomic sequence of LesaDOG1 using the PCR Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Positron Emission Tomography:

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: These new entry vectors were recombined with pET-56-DEST using LR recombinase II reaction mix (Invitrogen), transformed into TOP10, and selected for on LB+carb agar overnight. .. For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Construct:

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: A series of Danio rerio GIP promoter deletion constructs was created using PCR. .. The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. The reverse primer (pGL3R, ) corresponded to a sequence 128 bp downstream of the multiple cloning region of the pGL3 basic vector, and was used to generate all constructs.

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: An in-frame, markerless deletion of RSP_1566 was constructed using the suicide vector pK18mobsacB ( ). .. The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566.

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. Finally the positive-negative selection cassette hdhfr-yfcu (standing for human dihydrofolate reductase, yeast cytosine deaminase and uridyl phosphoribosyl transferase fusion enzyme) [ ] replaced the original selection cassette using primers 5 and 6 and restriction enzymes EcoRV and AvrII.

    Article Title: Extended-Spectrum Beta-lactamase Producers: Detection for the Diagnostic Laboratory
    Article Snippet: Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.). .. Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.).

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: This fragment was subsequently cloned into the pCR-Blunt II-TOPO vector (Invitrogen) according to the manufacturer's recommendations in order to construct an intermediate plasmid. .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Gel Extraction:

    Article Title: Biosynthesis of fragin is controlled by a novel quorum sensing signal
    Article Snippet: The amplified fragments were separated on agarose gels, excised and purified with the QIAquick gel extraction kit (Qiagen). .. The expression vector pBBR1MCS2 was digested with the restriction enzymes Hin dIII and Xba I (New England BioLabs Inc.; expression of hamA , hamB , hamD , hamF , and hamG ) or Xho I and Xba I (New England BioLabs Inc.; expression of hamC and hamE ) according to the manufacturer’s instructions and subsequently purified by the QIAquick PCR purification kit (Qiagen).

    Plasmid Preparation:

    Article Title: MicroRNA-133 overexpression promotes the therapeutic efficacy of mesenchymal stem cells on acute myocardial infarction
    Article Snippet: The vector pCDH-CMV-MCS-EF1-copGFP was used as a backbone plasmid to reconstruct lentiviral vector containing miR-133a. .. The vector and pre-miR-133a fragments amplified from rat genomic DNA were digested with Xba I and Eco RI (NEB, USA) and ligated with T4 ligase (TAKARA). .. The primers used for amplification of pre-miR-133a are as follows: sense, 5′-ATGTCTAGACCCTCTAATACTCGTCAT-3′; and antisense, 5′-GAATTCGACCGTTGTTAGTTGTTT-3′.

    Article Title: Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants
    Article Snippet: Vector pCAMBIA1300 (Marker Gene Technologies, M1591) was digested with Bam HI and Hin dIII (NEB) and purified from the gel ( ). .. Vectors pK7WG, pB7WG and pH7WG (Karimi et al., 2002) were digested with Xba I and Sac I (NEB), allowing the release of T35S–AttR2–ccd B–AttR1 cassette from the vector backbone and purified from the gel ( ). .. The ccd B region was amplified from AssemblX pL0A_0–1 Level 0 plasmid [ ] using KG15/KG16 primers, purified from the gel and amplified with KG15/KG18 for pCAMBIA1300 and KG19/KG21 primers for the other three plasmid backbones to add homology regions with flanking restriction enzyme recognition sites (see for the list of primers).

    Article Title: Biosynthesis of fragin is controlled by a novel quorum sensing signal
    Article Snippet: The purified fragments were digested with the restriction enzymes (New England BioLabs Inc.) indicated in Supplementary Data according to the manufacturer’s instructions and again purified by the QIAquick PCR purification kit (Qiagen). .. The expression vector pBBR1MCS2 was digested with the restriction enzymes Hin dIII and Xba I (New England BioLabs Inc.; expression of hamA , hamB , hamD , hamF , and hamG ) or Xho I and Xba I (New England BioLabs Inc.; expression of hamC and hamE ) according to the manufacturer’s instructions and subsequently purified by the QIAquick PCR purification kit (Qiagen). .. The promoter fragments were ligated into pSU11 with T4 ligase (New England BioLabs Inc.) according to the manufacturer’s instructions.

    Article Title: EVOLUTIONARY CONSERVATION OF GLUCOSE-DEPENDENT INSULINOTROPIC POLYPEPTIDE (GIP) GENE REGULATION AND THE ENTEROINSULAR AXIS
    Article Snippet: The pGL3/1072 bp Danio rerio GIP promoter construct was linearized with Xba I (NEB) and used as a template for subsequent PCR reactions. .. In addition, a series of forward primers containing a Kpn I site was generated , corresponding to internal regions of the Danio rerio GIP promoter.

    Article Title: Chlamydia trachomatis Slc1 is a type III secretion chaperone that enhances the translocation of its invasion effector substrate TARP
    Article Snippet: Paragraph title: Plasmid construction ... For the expression of chlamydial proteins in Yersinia , slc1 and scc1 were subcloned from pET101-Slc2 and pET101-Scc1 using Xba I and Sca I-HF (NEB).

    Article Title: Highly Efficient Targeted Mutagenesis in Mice Using TALENs
    Article Snippet: The injection of TALEN mRNA and targeting molecules (ODNs) was performed as described in , ), except that injections were done only into pronuclei. .. Briefly, capped TALEN mRNA was prepared in a single step by in vitro transcription from pT7-TALEN-95A plasmid DNA linearized with Xba I and Ale I (New England Biolabs, Frankfurt, Germany), using the mMessage mMachine T7 Ultra kit (omitting the polyadenylation step) and the MEGAclear kit (Life Technologies, Carlsbad, CA). .. The quality of synthesized mRNAs was controlled by agarose gel electrophoresis under denaturing conditions, using the NorthernMax-Gly system and the RNA Millenium size marker (Life Technologies).

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: For Southern-blot analysis, a digoxigenin ( )-labeled probe covering 353 bp of exon 1 of LesaDOG1 was amplified with primers LesaDOG1a-FP3-wgDNA and GSP-3 ( ) from 20 pg of pGEM-T Easy vector (Promega) containing the genomic sequence of LesaDOG1 using the PCR Probe Synthesis Kit (Roche) according to the manufacturer’s instructions. .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche).

    Article Title: Arsenic trioxide-mediated suppression of miR-182-5p is associated with potent anti-oxidant effects through up-regulation of SESN2
    Article Snippet: For reporter-based luciferase activity assays, we flanked a SESN2 3’UTR fragment with the primers SESN2 _s: 5’-gggAgAATTCTgTTCTCCCAg-3’ and SESN2 _as: 5’-TgCACTTgAACACTggATACC-3’ using Phusion Hot Start II PCR (Cat #: F549S, Thermo Fisher Scientific Inc., Waltham, MA). .. The amplicon was digested with XbaI (Cat #: R0145S, New England Biolabs Inc., Ipswich, MA) for a 637-bp fragment which was subsequently inserted into pGL4.10-Luc2 vector (Promega, Madison, WI). .. The cytomegalovirus (CMV) promoter was placed into the pGL4.10-Luc-SESN2 3’UTR vector ( ) to promote gene transcription, and form pCL-SESN2 _3’UTR construct for reporter assay.

    Article Title: Combining Genome-Scale Experimental and Computational Methods To Identify Essential Genes in Rhodobacter sphaeroides
    Article Snippet: An in-frame, markerless deletion of RSP_1566 was constructed using the suicide vector pK18mobsacB ( ). .. The amplified products were digested with XbaI and HindIII restriction enzymes (New England Biolabs) and ligated into pK18mobsacB to generate pK18mobsacB _genomicRSP1566.

    Article Title: In vivo production of RNA nanostructures via programmed folding of single-stranded RNAs
    Article Snippet: Final reconstruction results were visualized by UCSF Chimera software . .. Double-stranded DNA template and pET23a plasmid (GenScript Inc.) were double-digested by XbaI and StyI-HF restriction enzymes (New England BioLabs Inc.) by following the manufacturer-recommended protocol. .. The reaction was performed in 100 µL CutSmart® buffer at 37 °C for 2 h, and 20 units of each enzyme were added.

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: For the generation of a recipient line, the endogenous actin 1 gene containing silent restriction sites to facilitate subdomain exchanges were ordered from GeneArt (Invitrogen Corp) and cloned into the Pb238 vector [ , ] with BamHI and XbaI restriction sites. .. The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. The flanking actin 3′ UTR was amplified using primers 3 and 4 and cloned into the transfection vector via AvrII and KpnI restriction sites.

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: After digestion of this HCVcc backbone with enzyme Afe I (New England Biolabs), E1E2 inserts amplified from library plasmids were inserted in frame using In-Fusion cloning. .. To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion). .. RNA clean-up was performed using RNeasy mini kit (Qiagen), quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific) and stored at −80 °C.

    Article Title: PME-1, an Extended-Spectrum ?-Lactamase Identified in Pseudomonas aeruginosa
    Article Snippet: The PCR product and pBC-SK(−) (Stratagene) were double digested with XbaI and HindIII (New England Biolabs), ligated, and used to transform E. coli DH10B by electroporation. .. The PCR product and pBC-SK(−) (Stratagene) were double digested with XbaI and HindIII (New England Biolabs), ligated, and used to transform E. coli DH10B by electroporation.

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: This fragment was subsequently cloned into the pCR-Blunt II-TOPO vector (Invitrogen) according to the manufacturer's recommendations in order to construct an intermediate plasmid. .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Selection:

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. The 3′ UTR of dihydrofolate synthase (dhfs ) was cloned from another vector [ ] into the downstream region of the actin ORF using BamHI and EcoRV restriction enzymes.

    Agarose Gel Electrophoresis:

    Article Title: Phylogenetic and Functional Characterization of the hAT Transposon Superfamily
    Article Snippet: Following amplification the DNA was purified using the QIAquick PCR Purification Kit (Qiagen), quantified on an agarose gel, digested with Kpn I and Xho I (NEB), repurified, and ligated into pBluescript SK+ (Stratagene), which had been digested with Kpn I and Xho I and gel purified (Zymoclean Gel DNA Recovery Kit, Zymo Research). .. Inserts were sequenced, and then clones were digested with Sac I and Xba I (NEB).

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: The probe was purified through a cellulose acetate syringe filter (Whatman). .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. DNA was transferred onto Nytran Supercharge membranes (Whatman) using a TurboBlotter (Whatman).

    In Vitro:

    Article Title: Highly Efficient Targeted Mutagenesis in Mice Using TALENs
    Article Snippet: The injection of TALEN mRNA and targeting molecules (ODNs) was performed as described in , ), except that injections were done only into pronuclei. .. Briefly, capped TALEN mRNA was prepared in a single step by in vitro transcription from pT7-TALEN-95A plasmid DNA linearized with Xba I and Ale I (New England Biolabs, Frankfurt, Germany), using the mMessage mMachine T7 Ultra kit (omitting the polyadenylation step) and the MEGAclear kit (Life Technologies, Carlsbad, CA). .. The quality of synthesized mRNAs was controlled by agarose gel electrophoresis under denaturing conditions, using the NorthernMax-Gly system and the RNA Millenium size marker (Life Technologies).

    Article Title: Hepatitis C virus resistance to broadly neutralizing antibodies measured using replication-competent virus and pseudoparticles
    Article Snippet: After digestion of this HCVcc backbone with enzyme Afe I (New England Biolabs), E1E2 inserts amplified from library plasmids were inserted in frame using In-Fusion cloning. .. To make HCVcc RNA, 2 µg plasmid DNA was linearized using XbaI (New England Biolabs) then used for in vitro RNA transcription using the T7 MEGAscript kit (Ambion). .. RNA clean-up was performed using RNeasy mini kit (Qiagen), quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific) and stored at −80 °C.

    Ethanol Precipitation:

    Article Title: Inter-subunit interactions drive divergent dynamics in mammalian and Plasmodium actin filaments
    Article Snippet: The actin 5′ untranslated region (UTR) was amplified using primers 1 and 2 and cloned into the vector using restriction enzymes SalI and XbaI (all enzymes purchased from New England Biolabs). .. Finally the positive-negative selection cassette hdhfr-yfcu (standing for human dihydrofolate reductase, yeast cytosine deaminase and uridyl phosphoribosyl transferase fusion enzyme) [ ] replaced the original selection cassette using primers 5 and 6 and restriction enzymes EcoRV and AvrII.

    Concentration Assay:

    Article Title: Highly Efficient Targeted Mutagenesis in Mice Using TALENs
    Article Snippet: Briefly, capped TALEN mRNA was prepared in a single step by in vitro transcription from pT7-TALEN-95A plasmid DNA linearized with Xba I and Ale I (New England Biolabs, Frankfurt, Germany), using the mMessage mMachine T7 Ultra kit (omitting the polyadenylation step) and the MEGAclear kit (Life Technologies, Carlsbad, CA). .. Briefly, capped TALEN mRNA was prepared in a single step by in vitro transcription from pT7-TALEN-95A plasmid DNA linearized with Xba I and Ale I (New England Biolabs, Frankfurt, Germany), using the mMessage mMachine T7 Ultra kit (omitting the polyadenylation step) and the MEGAclear kit (Life Technologies, Carlsbad, CA).

    Molecular Weight:

    Article Title: Extended-Spectrum Beta-lactamase Producers: Detection for the Diagnostic Laboratory
    Article Snippet: Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.). .. Genomic DNA was isolated and digested with XbaI (New England Biolabs, Beverly, Mass.).

    Marker:

    Article Title: Spatiotemporal Seed Development Analysis Provides Insight into Primary Dormancy Induction and Evolution of the Lepidium DELAY OF GERMINATION1 Genes [OA]
    Article Snippet: The probe was purified through a cellulose acetate syringe filter (Whatman). .. Seven micrograms of L. papillosum genomic DNA extracted from leaves using the Plant DNeasy Maxi Kit (Qiagen) was digested with Eco RI or Xba I (New England Biolabs) overnight and subsequently run on a 0.8% (w/v) agarose gel together with -labeled DNA M r marker VII (Roche). .. DNA was transferred onto Nytran Supercharge membranes (Whatman) using a TurboBlotter (Whatman).

    Recombinant:

    Article Title: In vivo production of RNA nanostructures via programmed folding of single-stranded RNAs
    Article Snippet: Paragraph title: Recombinant plasmid preparation ... Double-stranded DNA template and pET23a plasmid (GenScript Inc.) were double-digested by XbaI and StyI-HF restriction enzymes (New England BioLabs Inc.) by following the manufacturer-recommended protocol.

    Article Title: Arterivirus Minor Envelope Proteins Are a Major Determinant of Viral Tropism in Cell Culture
    Article Snippet: To obtain a convenient DNA-based system in which to launch recombinant EAV and PRRSV, the cytomegalovirus (CMV) promoter was introduced into the respective EAV and PRRSV full-length cDNA clones pEAV030 and pAPRRSasc, into which an AscI restriction enzyme recognition site was inserted immediately upstream of the ORF2a start codon as described previously ( , , ). .. After digestion with the restriction enzymes AscI and XbaI (New England BioLabs, MA), the hybrid fragment EAV2ab34–APRRS56 was transferred to pAPRRSasc to yield the chimeric full-length cDNA clone pAPRRS-EAV2ab34.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • XbaI (/ml) - 1  (New England Biolabs)
    N/A
    		   Buy from Supplier
    xbai  (New England Biolabs)
    99
    New England Biolabs xbai
    Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 ( 29 ) using <t>XbaI/NheI-containing</t> primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid <t>pd27B-MelanA</t> and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).
    Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 190 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai/product/New England Biolabs
    Average 99 stars, based on 190 article reviews
    Price from $9.99 to $1999.99
    xbai - by Bioz Stars, 2020-01
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 ( 29 ) using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).

    Journal: Frontiers in Immunology

    Article Title: Generation of an Oncolytic Herpes Simplex Virus 1 Expressing Human MelanA

    doi: 10.3389/fimmu.2019.00002

    Figure Lengend Snippet: Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 ( 29 ) using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).

    Article Snippet: The PCR product and pd27B were digested using NheI and XbaI (NEB, Frankfurt, Germany), followed by dephosphorylation of pd27B.

    Techniques: Agarose Gel Electrophoresis, Amplification, Expressing, Plasmid Preparation, Infection, Immunofluorescence, Microscopy, Cotransfection, Inverted Microscopy

    Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).

    Journal: Frontiers in Immunology

    Article Title: Generation of an Oncolytic Herpes Simplex Virus 1 Expressing Human MelanA

    doi: 10.3389/fimmu.2019.00002

    Figure Lengend Snippet: Generation of HSV-1 d 106S-MelanA. (A) Agarose gel image of full-length MelanA amplified from expression plasmid pcDNA3(+) MART-1 using XbaI/NheI-containing primers. (B) Light microscopic images of uninfected E11 cells (left) and cytopathic effects induced in these cells 56 h post HSV-1 d 106S infection (right). (C) EcoRI digestion of HSV-1 d 106S DNA obtained from viral nucleocapsids showing distinct bands as evidence of DNA integrity. (D) Overlay of phase contrast and immunofluorescence microscopy of E11 cells harboring fluorescing (upper part) and non-fluorescing (lower part) viral plaques, representing HSV-1 d 106S and HSV-1 d 106S-MelanA, respectively, after cotransfection of the linearized transfer plasmid pd27B-MelanA and HSV-1 d 106S DNA. Light and immunofluorescence microscopy were taken using the DMI 6000B inverted microscope (20 × magnification).

    Article Snippet: The PCR product and pd27B were digested using NheI and XbaI (NEB, Frankfurt, Germany), followed by dephosphorylation of pd27B.

    Techniques: Agarose Gel Electrophoresis, Amplification, Expressing, Plasmid Preparation, Infection, Immunofluorescence, Microscopy, Cotransfection, Inverted Microscopy

    Transgenic founder pigs carrying the DsRed gene were detected by (a) PCR and (b) Southern blot analysis. The presence of transgenes in DsRed2 pigs were confirmed by using a DsRed primer, which produced a 780-bp PCR product. The genomic DNA of these 2 transgenic pigs (Nos. 1 and 3) were digested using XbaI and DraI. The digested DNA was subsequently hybridized using a 1.1-kb probe.

    Journal: PLoS ONE

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene

    doi: 10.1371/journal.pone.0106864

    Figure Lengend Snippet: Transgenic founder pigs carrying the DsRed gene were detected by (a) PCR and (b) Southern blot analysis. The presence of transgenes in DsRed2 pigs were confirmed by using a DsRed primer, which produced a 780-bp PCR product. The genomic DNA of these 2 transgenic pigs (Nos. 1 and 3) were digested using XbaI and DraI. The digested DNA was subsequently hybridized using a 1.1-kb probe.

    Article Snippet: The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion.

    Techniques: Transgenic Assay, Polymerase Chain Reaction, Southern Blot, Produced

    The DsRed-Monomer transgenic construct pCX-DsRed-Monomer. Arrows indicate the positions of the PCR DsRed primers. XbaI and DraI were restriction enzyme digestion sites. The thick black line indicates the position of the Southern blot probe.

    Journal: PLoS ONE

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene

    doi: 10.1371/journal.pone.0106864

    Figure Lengend Snippet: The DsRed-Monomer transgenic construct pCX-DsRed-Monomer. Arrows indicate the positions of the PCR DsRed primers. XbaI and DraI were restriction enzyme digestion sites. The thick black line indicates the position of the Southern blot probe.

    Article Snippet: The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion.

    Techniques: Transgenic Assay, Construct, Polymerase Chain Reaction, Southern Blot

    Physical map comparison between S. gallinarum strains 287/91 and SARB21. The map of SARB21 was reported previously [21] ; here letter designations for the cleavage fragments of SARB21 have been changed according to the homologues in strain 287/91 for the convenience of comparison. Note that all XbaI, I-CeuI and AvrII (maps from top to bottom) cleavage sites are conserved in the two strains except the AvrII site between fragments F and J in 287/91 (open arrow), which is missing from SARB21. Lines with solid arrowheads at both ends indicate the ranges of genomic inversions via rrn -mediated recombination between the two strains and filled arrows indicate recombination sites that have resulted in the translocation of I-CeuI fragment D.

    Journal: PLoS ONE

    Article Title: CTAG-Containing Cleavage Site Profiling to Delineate Salmonella into Natural Clusters

    doi: 10.1371/journal.pone.0103388

    Figure Lengend Snippet: Physical map comparison between S. gallinarum strains 287/91 and SARB21. The map of SARB21 was reported previously [21] ; here letter designations for the cleavage fragments of SARB21 have been changed according to the homologues in strain 287/91 for the convenience of comparison. Note that all XbaI, I-CeuI and AvrII (maps from top to bottom) cleavage sites are conserved in the two strains except the AvrII site between fragments F and J in 287/91 (open arrow), which is missing from SARB21. Lines with solid arrowheads at both ends indicate the ranges of genomic inversions via rrn -mediated recombination between the two strains and filled arrows indicate recombination sites that have resulted in the translocation of I-CeuI fragment D.

    Article Snippet: I-CeuI, XbaI and AvrII were purchased from New England Biolabs, and proteinase K was from Roche.

    Techniques: Translocation Assay

    XbaI and AvrII cleavage patterns of S. gallinarum strains 287/91 and SARB21 after PFGE separation. (A) XbaI cleavage. Lanes: 1, SARB21; 2, 287/91; 3, λDNA as molecular size marker. (B) AvrII cleavage. Lanes: 1, λDNA as molecular size marker; 2, SARB21; 3, 287/91. Letter designations are for strain 287/91; the same letters are used for homologous fragments in strain SARB21. In the designation of fragments in SARB21, C′ means a fragment homologous to C in 287/91 but truncated on the right-hand part by genomic rearrangement, and ‘C means truncation on the left-hand part of the fragment.

    Journal: PLoS ONE

    Article Title: CTAG-Containing Cleavage Site Profiling to Delineate Salmonella into Natural Clusters

    doi: 10.1371/journal.pone.0103388

    Figure Lengend Snippet: XbaI and AvrII cleavage patterns of S. gallinarum strains 287/91 and SARB21 after PFGE separation. (A) XbaI cleavage. Lanes: 1, SARB21; 2, 287/91; 3, λDNA as molecular size marker. (B) AvrII cleavage. Lanes: 1, λDNA as molecular size marker; 2, SARB21; 3, 287/91. Letter designations are for strain 287/91; the same letters are used for homologous fragments in strain SARB21. In the designation of fragments in SARB21, C′ means a fragment homologous to C in 287/91 but truncated on the right-hand part by genomic rearrangement, and ‘C means truncation on the left-hand part of the fragment.

    Article Snippet: I-CeuI, XbaI and AvrII were purchased from New England Biolabs, and proteinase K was from Roche.

    Techniques: Marker