xbai new england biolabs  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    XbaI
    Description:
    XbaI 15 000 units
    Catalog Number:
    r0145l
    Price:
    290
    Size:
    15 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs xbai new england biolabs
    XbaI
    XbaI 15 000 units
    https://www.bioz.com/result/xbai new england biolabs/product/New England Biolabs
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai new england biolabs - by Bioz Stars, 2020-02
    95/100 stars

    Related Products / Commonly Used Together

    expression plasmids
    vika coding sequence
    pevo vectors
    bsrgi

    Images

    Related Articles

    Clone Assay:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: .. To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. For TEAR1 truncation assay, DAR1 was amplified using the primer pair DAR1-F/DAR1-R. Then, the fragment was first cloned into pENTR/D TOPO to generate pENTR-DAR1.

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA). .. The pal gene with in frame cloning in the plasmid construct was identified by sequence analysis.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: .. Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: .. Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter. .. The PsCDF1 entry clones were also transferred by LR reaction into a version of the pB2GW7 vector where the CaMV 35S promoter was replaced with the SUC2 promoter ( ).

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ). .. The EFR gene constructs (with EFR native promoter, without stop codon) were made by PCR in pENTR/D vector (for primer sequences, see online), then recombined into pGWB13 (no promoter, HA tag) using LR clonase II mix.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: A cDNA for the full of SOG1 was generated by PCR with PfuTurbo Taq DNA polymerase (Agilent Technologies), cloned into pGEM-T EZ (Promega), and sequenced. .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside.

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: .. The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia). .. The resulting construct was designated pCTMurC.

    Centrifugation:

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: Samples were then concentrated by centrifugation at 8000 × g for 5 min in Microcon Ultracel YM-50 columns (no. 42416; Millipore, Billerica, MA). .. The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA).

    Amplification:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: .. To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. For TEAR1 truncation assay, DAR1 was amplified using the primer pair DAR1-F/DAR1-R. Then, the fragment was first cloned into pENTR/D TOPO to generate pENTR-DAR1.

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: .. The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA). .. The plasmid construct was used to transform Escherichia coli BL21(DE3) pLysS (Novagen, Madison, WI) for the production of the recombinant PAL protein fused to a 43 kDa maltose-binding protein (MBP).

    Article Title: Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp. 1 spp. 1 [OPEN]
    Article Snippet: For transient assay, the binary vector pCAMBIA1304 was digested with Xba I and Nhe I, filled in with the Klenow fragment (New England Biolabs), and then ligated to produce the p1304NhXb vector with a reduced vector size. .. GUS , PebHLH1 , PeMYB2 , PeMYB11 , and PeMYB12 were amplified, digested with Xho I, and ligated to p1304NhXb to replace the gene hygromycin phosphotransferase to produce the overexpression vectors of these genes driven by the duplicated cauliflower mosaic virus 35S promoter.

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: The murC domain from the murC-ddl open reading frame of C. trachomatis L2 was amplified with introduced restriction sites by using the PCR primers MurCF1 (5′-CTCTAT GAGCTC ATGATG-3′ [ Sac I site underlined]) and MurCR1 (5′-CGGAAA TCTAGA GTTCGC-3′ [ Xba I site underlined]). .. The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia).

    Nucleic Acid Electrophoresis:

    Article Title: High-Efficiency Stable Transformation of the Model Fern Species Ceratopteris richardii via Microparticle Bombardment 1 via Microparticle Bombardment 1 [W] via Microparticle Bombardment 1 [W] [OPEN]
    Article Snippet: .. C. richardii (10 µg per sample) was prepared for DNA blotting by digestion with Hin dIII and Xba I (New England Biolabs) and separated by gel electrophoresis (25 V, 16 h). ..

    Synthesized:

    Article Title: High-Efficiency Stable Transformation of the Model Fern Species Ceratopteris richardii via Microparticle Bombardment 1 via Microparticle Bombardment 1 [W] via Microparticle Bombardment 1 [W] [OPEN]
    Article Snippet: Complementary DNA was synthesized from 250 ng of RNA template using Superscript III Reverse Transcriptase (Life Technologies). .. C. richardii (10 µg per sample) was prepared for DNA blotting by digestion with Hin dIII and Xba I (New England Biolabs) and separated by gel electrophoresis (25 V, 16 h).

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: .. Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Neutralization:

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA). .. The gel was washed for 30 min in denaturation solution (1.5 M NaCl, 0.5 M NaOH), rinsed with dH2 O, and then washed for 30 min in neutralization solution (1.5 M NaCl, 0.5 M Tris-HCl, pH 7.5) with gentle shaking.

    Construct:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. The pMAL-TEAR1△C1, pMAL-mTEAR1△N1, and pMAL-DAR1 constructs were generated by LR reactions with pMAL-GW and pENTR-TEAR1△C1, pENTR-mTEAR1△N1, and pENTR-DAR1, respectively.

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA). .. The plasmid construct was used to transform Escherichia coli BL21(DE3) pLysS (Novagen, Madison, WI) for the production of the recombinant PAL protein fused to a 43 kDa maltose-binding protein (MBP).

    Article Title: Identification of the first eubacterial endonuclease coded by an intein allele in the pps1 gene of mycobacteria
    Article Snippet: The annealed oligonucleotides were then inserted into pUC19 overdigested with Hin dIII and Xba I (New England Biolabs). .. The resulting construct, p Mga Site, was sequenced.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. A mutant variant of Vika in which Tyr343 was replaced by phenylalanine was constructed by site-directed mutagenesis.

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: Paragraph title: Construct Preparation and Plant Transformation ... Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter.

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ). .. The EFR gene constructs (with EFR native promoter, without stop codon) were made by PCR in pENTR/D vector (for primer sequences, see online), then recombined into pGWB13 (no promoter, HA tag) using LR clonase II mix.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia). .. The resulting construct was designated pCTMurC.

    Electrophoresis:

    Article Title: Four Strains of Escherichia coli O157:H7 Isolated from Patients during an Outbreak of Disease Associated with Ground Beef: Importance of Evaluating Multiple Colonies from an Outbreak-Associated Product
    Article Snippet: Separate 2-mm-thick slices of each plug were then restricted with Xba I (New England Biolabs, Inc., Beverly, Mass.) and Bln I (Roche Molecular Biochemicals, Indianapolis, Ind.) at 35°C for 2 h. Although the standard PulseNet method specifies using 50 U of Xba I and 25 U of Bln I per 200 μl of reaction buffer, 70 U of Xba I and 40 U of Bln I per 200 μl were used to avoid the occurrence of partial restriction products (ghost bands). .. Electrophoresis of the samples was performed with a contour-clamped homogeneous electric field mapper (Bio-Rad).

    Activity Assay:

    Article Title: Identification of the first eubacterial endonuclease coded by an intein allele in the pps1 gene of mycobacteria
    Article Snippet: To assay Mga Pps1 endonuclease activity, the 40 bp DNA sequence spanning its homing site was inserted between the Xba I and Hin dIII restriction sites of plasmid pUC19. .. The annealed oligonucleotides were then inserted into pUC19 overdigested with Hin dIII and Xba I (New England Biolabs).

    Expressing:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. The constructs were transformed into Escherichia coli BL21 (DE3) competent cells for protein expression.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: .. Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: For the Arabidopsis expression studies ( ; ), pCR8/GW/TOPO entry clones were generated for the wild-type (NGB5839) and R450W ( late2-1D ) alleles of PsCDF1. .. Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter.

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: The resulting pGWB14-derived plasmids contain the 35S promoter to drive FLS2 expression and a HA tag at the C terminus. .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Transformation Assay:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. The constructs were transformed into Escherichia coli BL21 (DE3) competent cells for protein expression.

    Article Title: Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp. 1 spp. 1 [OPEN]
    Article Snippet: For transient assay, the binary vector pCAMBIA1304 was digested with Xba I and Nhe I, filled in with the Klenow fragment (New England Biolabs), and then ligated to produce the p1304NhXb vector with a reduced vector size. .. The recombinant vectors were transformed into A. tumefaciens EHA105 by electroproration.

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: Paragraph title: Construct Preparation and Plant Transformation ... Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter.

    Article Title: Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo
    Article Snippet: DNA was then digested with Nhe I, Spe I, and Xba I (New England BioLabs), which create compatible cohesive ends and do not cut inside the transposon. .. The DNA was then self-ligated using T4 DNA ligase and transformed into DH10B cells by electroporation.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Over Expression:

    Article Title: Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp. 1 spp. 1 [OPEN]
    Article Snippet: Paragraph title: Transient Assay of Overexpression of PeMYB s by Agrobacterium tumefaciens Infiltration ... For transient assay, the binary vector pCAMBIA1304 was digested with Xba I and Nhe I, filled in with the Klenow fragment (New England Biolabs), and then ligated to produce the p1304NhXb vector with a reduced vector size.

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia). .. For overexpression studies, primers MurCF2 (5′-ATGAAAAGCTTGTTTTACC-3′) and MurCR2 (5′-TTTCCCTCCACAAATAATTCC-3′) were used to amplify the murC domain from the same template.

    Derivative Assay:

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: The full protein-coding region of the pal gene of 19 kDa lipoprotein ( ) was PCR-amplified from a DNA template derived from L. pneumophila serogroup 1 strain with a pair of primers: the Xba I containing sense primer 5'-TCTAGATTGTGGAATGAAAGCCGGATCGT-3' and Sal I containing anti-sense primer 5'-GTCCACCCATGAGGCGAAAGGAAGCATC-3'. .. The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA).

    Electroporation:

    Article Title: Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo
    Article Snippet: DNA was then digested with Nhe I, Spe I, and Xba I (New England BioLabs), which create compatible cohesive ends and do not cut inside the transposon. .. The DNA was then self-ligated using T4 DNA ligase and transformed into DH10B cells by electroporation.

    Transfection:

    Article Title: Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo
    Article Snippet: Two days post transfection, the cells were split into G418 selection medium and grown to confluence. .. DNA was then digested with Nhe I, Spe I, and Xba I (New England BioLabs), which create compatible cohesive ends and do not cut inside the transposon.

    Southern Blot:

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: Paragraph title: Southern blotting ... The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA).

    Transferring:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Cell Culture:

    Article Title: Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp. 1 spp. 1 [OPEN]
    Article Snippet: For transient assay, the binary vector pCAMBIA1304 was digested with Xba I and Nhe I, filled in with the Klenow fragment (New England Biolabs), and then ligated to produce the p1304NhXb vector with a reduced vector size. .. Vector-containing A. tumefaciens was cultured overnight at 28°C.

    Generated:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. The pMAL-TEAR1△C1, pMAL-mTEAR1△N1, and pMAL-DAR1 constructs were generated by LR reactions with pMAL-GW and pENTR-TEAR1△C1, pENTR-mTEAR1△N1, and pENTR-DAR1, respectively.

    Article Title: Synthetic Zinc Finger Nuclease Design and Rapid Assembly
    Article Snippet: .. One generated the “vector backbone” and the second created a large quantity of the “middle fragment.” For the pMJO-6 vector 1 μg of the vector was digested with Bgl II and Xba I (NEB) to create the backbone and 10 μg was digested with Bam HI and Nhe I to generate the middle fragment. .. For pMJO-7 the vector backbone was generated by a Pst I and Xba I digest whereas the middle fragment was created by an Nhe I/ Rs rII digest (NEB).

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: For the Arabidopsis expression studies ( ; ), pCR8/GW/TOPO entry clones were generated for the wild-type (NGB5839) and R450W ( late2-1D ) alleles of PsCDF1. .. Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter.

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: For point mutations on PGSs and on conserved LRR regions, mutant LRRs were generated from pTOPO: FLS2 LRR template ( ) using site-directed mutagenesis. .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: A cDNA for the full of SOG1 was generated by PCR with PfuTurbo Taq DNA polymerase (Agilent Technologies), cloned into pGEM-T EZ (Promega), and sequenced. .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside.

    DNA Labeling:

    Article Title: High-Efficiency Stable Transformation of the Model Fern Species Ceratopteris richardii via Microparticle Bombardment 1 via Microparticle Bombardment 1 [W] via Microparticle Bombardment 1 [W] [OPEN]
    Article Snippet: C. richardii (10 µg per sample) was prepared for DNA blotting by digestion with Hin dIII and Xba I (New England Biolabs) and separated by gel electrophoresis (25 V, 16 h). .. Probes against the HygR and 35S :: GUS cassettes were synthesized from 810- and 761-bp fragments , using the Redprime II DNA labeling kit (G.E.

    Sequencing:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: The coding sequence of TIE1 was cloned into the Eco RI and Sal I site of pET-28a(+) (Novagen) to generate pET28-TIE1-His. .. To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB).

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA). .. The pal gene with in frame cloning in the plasmid construct was identified by sequence analysis.

    Article Title: Identification of the first eubacterial endonuclease coded by an intein allele in the pps1 gene of mycobacteria
    Article Snippet: To assay Mga Pps1 endonuclease activity, the 40 bp DNA sequence spanning its homing site was inserted between the Xba I and Hin dIII restriction sites of plasmid pUC19. .. The annealed oligonucleotides were then inserted into pUC19 overdigested with Hin dIII and Xba I (New England Biolabs).

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: .. Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo
    Article Snippet: DNA was then digested with Nhe I, Spe I, and Xba I (New England BioLabs), which create compatible cohesive ends and do not cut inside the transposon. .. Colonies were screened for sensitivity to kanamycin and ampicillin (pTpB contains a β-lactamase cassette on the plasmid backbone), and kanamycin-resistant, ampicillin-sensitive colonies were sent for colony sequencing (GeneWiz, South Plainfield, NJ) with a primer that reads through the 5′ inverted repeat (5′IR) of the piggyBac transposon (5′-TTCCACACCCTAACTGACAC-3′).

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: All FLS2 mutated/truncated constructs were verified by DNA sequence determination. .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ).

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: MurCF1 binds at position 894943 and MurCR1 binds at position 896347, based on the GenBank nucleotide sequence . .. The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia).

    Sonication:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Recombinant:

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: Paragraph title: Production and purification of a recombinant lipoprotein ... The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA).

    Article Title: Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp. 1 spp. 1 [OPEN]
    Article Snippet: For transient assay, the binary vector pCAMBIA1304 was digested with Xba I and Nhe I, filled in with the Klenow fragment (New England Biolabs), and then ligated to produce the p1304NhXb vector with a reduced vector size. .. The recombinant vectors were transformed into A. tumefaciens EHA105 by electroproration.

    Molecular Cloning:

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA). .. The DNA was transferred overnight to a Hybond-N+ membrane (no. RPN203B; GE Healthcare) via capillary action, according to the protocol in Molecular Cloning: A Laboratory Manual ( ).

    Pull Down Assay:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: Paragraph title: Pull-Down Assay ... To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB).

    Mutagenesis:

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. A mutant variant of Vika in which Tyr343 was replaced by phenylalanine was constructed by site-directed mutagenesis.

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: The pENTR/D TOPO- FLS2 wild-type and mutant constructs were then recombined into the pGWB14 binary destination vector (courtesy of T. Nakagawa, Shimane University, Matsue, Japan) using LR clonase II mix (Invitrogen). .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. In order to generate the mutant forms of MBP-SOG1, SOG1 in the pMAL-C2 vector was mutagenized using the QuikChange II mutagenesis kit (Agilent Technologies) after which candidates were sequenced.

    Isolation:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Purification:

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: Paragraph title: Production and purification of a recombinant lipoprotein ... The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA).

    Article Title: Foot-and-mouth disease virus genome replication is unaffected by inhibition of type III phosphatidylinositol-4-kinases
    Article Snippet: RNA was purified using a Zymogen RNA clean and concentrate kit according to the manufacturer’s instructions. .. CVB3 replicon DNA was linearized with Mlu I (NEB) and HCV replicon DNA was first linearized with Xba I (NEB), prior to transcription.

    Article Title: Synthetic Zinc Finger Nuclease Design and Rapid Assembly
    Article Snippet: One generated the “vector backbone” and the second created a large quantity of the “middle fragment.” For the pMJO-6 vector 1 μg of the vector was digested with Bgl II and Xba I (NEB) to create the backbone and 10 μg was digested with Bam HI and Nhe I to generate the middle fragment. .. The PCR fragments and vector digests were resolved on a 1.5% agarose gel and the top band of the backbone digest, the smaller band of the middle digest, and each PCR product were purified with a QIAquick gel extraction kit (Qiagen, Hilden, Germany) with the plasmid fragments eluted in 10 μl and the PCR products eluted in 50 μl of water.

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ). .. The EFR gene constructs (with EFR native promoter, without stop codon) were made by PCR in pENTR/D vector (for primer sequences, see online), then recombined into pGWB13 (no promoter, HA tag) using LR clonase II mix.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Polymerase Chain Reaction:

    Article Title: High-Efficiency Stable Transformation of the Model Fern Species Ceratopteris richardii via Microparticle Bombardment 1 via Microparticle Bombardment 1 [W] via Microparticle Bombardment 1 [W] [OPEN]
    Article Snippet: Genotyping PCR and -PCR were performed using the following primer pairs: HygF2 (CTTCTACACAGCCATCGGTC) and HygR (CCGATGGTTTCTACAAAGATCG) and GUSF (CTTGCCATCCTTGTCCTCC) and GUSR4 (CGAAGTTCGGCTTGTTACG). .. C. richardii (10 µg per sample) was prepared for DNA blotting by digestion with Hin dIII and Xba I (New England Biolabs) and separated by gel electrophoresis (25 V, 16 h).

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: The full protein-coding region of the pal gene of 19 kDa lipoprotein ( ) was PCR-amplified from a DNA template derived from L. pneumophila serogroup 1 strain with a pair of primers: the Xba I containing sense primer 5'-TCTAGATTGTGGAATGAAAGCCGGATCGT-3' and Sal I containing anti-sense primer 5'-GTCCACCCATGAGGCGAAAGGAAGCATC-3'. .. The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA).

    Article Title: Synthetic Zinc Finger Nuclease Design and Rapid Assembly
    Article Snippet: One generated the “vector backbone” and the second created a large quantity of the “middle fragment.” For the pMJO-6 vector 1 μg of the vector was digested with Bgl II and Xba I (NEB) to create the backbone and 10 μg was digested with Bam HI and Nhe I to generate the middle fragment. .. The PCR fragments and vector digests were resolved on a 1.5% agarose gel and the top band of the backbone digest, the smaller band of the middle digest, and each PCR product were purified with a QIAquick gel extraction kit (Qiagen, Hilden, Germany) with the plasmid fragments eluted in 10 μl and the PCR products eluted in 50 μl of water.

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter. .. For the transient assays , the M. truncatula FTb1 (Medtr7g006630.1) promoter:LUC construct was generated by PCR amplifying from genomic DNA a 453-bp promoter fragment (from an upstream Hind III site to the FTb1 ATG translation initiation site, which was converted to a Nco I site; GenBank ID , chr7:777018-776566) and cloning it into the pGreen 0800-5-LUC binary vector ( ).

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ). .. The EFR gene constructs (with EFR native promoter, without stop codon) were made by PCR in pENTR/D vector (for primer sequences, see online), then recombined into pGWB13 (no promoter, HA tag) using LR clonase II mix.

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: A cDNA for the full of SOG1 was generated by PCR with PfuTurbo Taq DNA polymerase (Agilent Technologies), cloned into pGEM-T EZ (Promega), and sequenced. .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside.

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: The resulting 1,404-bp PCR product was ligated into the cloning vector pCR4-TOPO (Invitrogen, Paisley, United Kingdom). .. The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia).

    Positron Emission Tomography:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: The coding sequence of TIE1 was cloned into the Eco RI and Sal I site of pET-28a(+) (Novagen) to generate pET28-TIE1-His. .. To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB).

    Lysis:

    Article Title: Four Strains of Escherichia coli O157:H7 Isolated from Patients during an Outbreak of Disease Associated with Ground Beef: Importance of Evaluating Multiple Colonies from an Outbreak-Associated Product
    Article Snippet: After the plugs solidified, they were transferred to 5 ml of lysis buffer (50 mM Tris:50 mM EDTA, pH 8, and 1% Sarcosine) with 25 μl of Proteinase K. Plugs were lysed at 55°C with shaking at 120 rpm for 2 h. The lysis buffer was then removed, and the plugs were washed two times in 15 ml of distilled water and four more times with TE buffer. .. Separate 2-mm-thick slices of each plug were then restricted with Xba I (New England Biolabs, Inc., Beverly, Mass.) and Bln I (Roche Molecular Biochemicals, Indianapolis, Ind.) at 35°C for 2 h. Although the standard PulseNet method specifies using 50 U of Xba I and 25 U of Bln I per 200 μl of reaction buffer, 70 U of Xba I and 40 U of Bln I per 200 μl were used to avoid the occurrence of partial restriction products (ghost bands).

    Plasmid Preparation:

    Article Title: The Arabidopsis RING-Type E3 Ligase TEAR1 Controls Leaf Development by Targeting the TIE1 Transcriptional Repressor for Degradation [OPEN]
    Article Snippet: .. To generate the vector pMAL-GW, attR1-ccdB-attR2 was amplified from pK2GW7 (Ghent University) using primers attR1 F- Xba I and attB2 R- Hind III and cloned into the Xba I and Hind III site of pMAL-c2x (NEB). .. For TEAR1 truncation assay, DAR1 was amplified using the primer pair DAR1-F/DAR1-R. Then, the fragment was first cloned into pENTR/D TOPO to generate pENTR-DAR1.

    Article Title: Legionella lipoprotein activates toll-like receptor 2 and induces cytokine production and expression of costimulatory molecules in peritoneal macrophages
    Article Snippet: .. The amplified DNA was digested with Xba I and Sal I, and ligated into an Xba I/ Sal I-cut pMAL-c2X vector (New England Biolabs Inc., Ipswich, MA). .. The plasmid construct was used to transform Escherichia coli BL21(DE3) pLysS (Novagen, Madison, WI) for the production of the recombinant PAL protein fused to a 43 kDa maltose-binding protein (MBP).

    Article Title: Identification of the first eubacterial endonuclease coded by an intein allele in the pps1 gene of mycobacteria
    Article Snippet: To assay Mga Pps1 endonuclease activity, the 40 bp DNA sequence spanning its homing site was inserted between the Xba I and Hin dIII restriction sites of plasmid pUC19. .. The annealed oligonucleotides were then inserted into pUC19 overdigested with Hin dIII and Xba I (New England Biolabs).

    Article Title: Three R2R3-MYB Transcription Factors Regulate Distinct Floral Pigmentation Patterning in Phalaenopsis spp. 1 spp. 1 [OPEN]
    Article Snippet: .. For transient assay, the binary vector pCAMBIA1304 was digested with Xba I and Nhe I, filled in with the Klenow fragment (New England Biolabs), and then ligated to produce the p1304NhXb vector with a reduced vector size. .. GUS , PebHLH1 , PeMYB2 , PeMYB11 , and PeMYB12 were amplified, digested with Xho I, and ligated to p1304NhXb to replace the gene hygromycin phosphotransferase to produce the overexpression vectors of these genes driven by the duplicated cauliflower mosaic virus 35S promoter.

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. Two of the recombination sites, loxP , rox , VloxP or vox , were inserted into the pEVO vector, producing pEVO-loxP , pEVO-rox , pEVO-VloxP and pEVO-vox .

    Article Title: Synthetic Zinc Finger Nuclease Design and Rapid Assembly
    Article Snippet: .. One generated the “vector backbone” and the second created a large quantity of the “middle fragment.” For the pMJO-6 vector 1 μg of the vector was digested with Bgl II and Xba I (NEB) to create the backbone and 10 μg was digested with Bam HI and Nhe I to generate the middle fragment. .. For pMJO-7 the vector backbone was generated by a Pst I and Xba I digest whereas the middle fragment was created by an Nhe I/ Rs rII digest (NEB).

    Article Title: Identification of LATE BLOOMER2 as a CYCLING DOF FACTOR Homolog Reveals Conserved and Divergent Features of the Flowering Response to Photoperiod in Pea
    Article Snippet: .. Entry clones were then linearized with either Xba I or Xho I (New England Biolabs) and transferred by LR reaction (Invitrogen) into the pB2GW7 vector, which contains the CaMV 35S promoter. .. The PsCDF1 entry clones were also transferred by LR reaction into a version of the pB2GW7 vector where the CaMV 35S promoter was replaced with the SUC2 promoter ( ).

    Article Title: Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo
    Article Snippet: Paragraph title: Plasmid rescue of genomic integration sites ... DNA was then digested with Nhe I, Spe I, and Xba I (New England BioLabs), which create compatible cohesive ends and do not cut inside the transposon.

    Article Title: Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function [W] [OA]
    Article Snippet: The pENTR/D TOPO- FLS2 wild-type and mutant constructs were then recombined into the pGWB14 binary destination vector (courtesy of T. Nakagawa, Shimane University, Matsue, Japan) using LR clonase II mix (Invitrogen). .. The mutated FLS2 genes in pSTBlue-1 were released using Bam HI and Xba I and religated into pCAMBIA2300 to reconstitute PFLS2 : FLS2 - cMyc-GFP constructs, or the mutated FLS2 LRR DNA fragments in pTOPO: FLS2 LRR were cut out with Asc I and Pac I (NEB), gel purified, and then cloned into pHD3300, in which C-terminally tagged FLS2-HA is driven by the native FLS2 promoter ( ).

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Article Title: Functional and Biochemical Analysis of Chlamydia trachomatis MurC, an Enzyme Displaying UDP-N-Acetylmuramate:Amino Acid Ligase Activity
    Article Snippet: .. The insert was excised by using the restriction enzymes Sac I and Xba I (New England Biolabs, Herefordshire, United Kingdom) and cloned into the compatible sites of the vector p Trc 99A (Pharmacia). .. The resulting construct was designated pCTMurC.

    Software:

    Article Title: Four Strains of Escherichia coli O157:H7 Isolated from Patients during an Outbreak of Disease Associated with Ground Beef: Importance of Evaluating Multiple Colonies from an Outbreak-Associated Product
    Article Snippet: Separate 2-mm-thick slices of each plug were then restricted with Xba I (New England Biolabs, Inc., Beverly, Mass.) and Bln I (Roche Molecular Biochemicals, Indianapolis, Ind.) at 35°C for 2 h. Although the standard PulseNet method specifies using 50 U of Xba I and 25 U of Bln I per 200 μl of reaction buffer, 70 U of Xba I and 40 U of Bln I per 200 μl were used to avoid the occurrence of partial restriction products (ghost bands). .. E. coli G5244 was restricted only with Xba I and was included in lanes 1, 5, 10, and 15 of every gel for normalization to the software reference standard.

    RNA Extraction:

    Article Title: High-Efficiency Stable Transformation of the Model Fern Species Ceratopteris richardii via Microparticle Bombardment 1 via Microparticle Bombardment 1 [W] via Microparticle Bombardment 1 [W] [OPEN]
    Article Snippet: RNA was extracted from ≤100 mg of sporophyte frond tissues using the RNeasy RNA extraction kit (Qiagen). .. C. richardii (10 µg per sample) was prepared for DNA blotting by digestion with Hin dIII and Xba I (New England Biolabs) and separated by gel electrophoresis (25 V, 16 h).

    Selection:

    Article Title: Hyperactive piggyBac Gene Transfer in Human Cells and In Vivo
    Article Snippet: Two days post transfection, the cells were split into G418 selection medium and grown to confluence. .. DNA was then digested with Nhe I, Spe I, and Xba I (New England BioLabs), which create compatible cohesive ends and do not cut inside the transposon.

    Agarose Gel Electrophoresis:

    Article Title: Synthetic Zinc Finger Nuclease Design and Rapid Assembly
    Article Snippet: One generated the “vector backbone” and the second created a large quantity of the “middle fragment.” For the pMJO-6 vector 1 μg of the vector was digested with Bgl II and Xba I (NEB) to create the backbone and 10 μg was digested with Bam HI and Nhe I to generate the middle fragment. .. The PCR fragments and vector digests were resolved on a 1.5% agarose gel and the top band of the backbone digest, the smaller band of the middle digest, and each PCR product were purified with a QIAquick gel extraction kit (Qiagen, Hilden, Germany) with the plasmid fragments eluted in 10 μl and the PCR products eluted in 50 μl of water.

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA). .. Digested samples were run overnight on a 1.5% agarose gel (SeaKem LE Agarose; Lonza, Basel, Switzerland) in 0.5× TBE at 55 mV.

    Transgenic Assay:

    Article Title: High-Efficiency Stable Transformation of the Model Fern Species Ceratopteris richardii via Microparticle Bombardment 1 via Microparticle Bombardment 1 [W] via Microparticle Bombardment 1 [W] [OPEN]
    Article Snippet: Paragraph title: Analysis of Transgenic Lines ... C. richardii (10 µg per sample) was prepared for DNA blotting by digestion with Hin dIII and Xba I (New England Biolabs) and separated by gel electrophoresis (25 V, 16 h).

    Produced:

    Article Title: Aluminum-Dependent Terminal Differentiation of the Arabidopsis Root Tip Is Mediated through an ATR-, ALT2-, and SOG1-Regulated Transcriptional Response [OPEN]
    Article Snippet: .. After transferring into the pMAL-C2 expression vector with Xmn I and Xba I (New England Biolabs), the MBP-SOG1 construct was transformed into BL21(DE3)-competent Escherichia coli (New England Biolabs) after which protein was produced following induction for 3 h with 0.4 mM isopropyl β- d -1-thiogalactopyranoside. .. MBP-SOG1 was isolated by sonication followed by purification with amylose resin (New England Biolabs) and then elution with 50 mM maltose.

    Concentration Assay:

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: .. The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA). .. Digested samples were run overnight on a 1.5% agarose gel (SeaKem LE Agarose; Lonza, Basel, Switzerland) in 0.5× TBE at 55 mV.

    DNA Purification:

    Article Title: Mutations to the piRNA Pathway Component Aubergine Enhance Meiotic Drive of Segregation Distorter in Drosophila melanogaster
    Article Snippet: For Southern analysis genomic DNA was prepared from ∼30 adult flies, using the Maxwell 16 DNA purification system (no. AS1030; Promega, Madison, WI), eluted in 500 μl of DNase-free water (no. 10977-015; GIBCO, Grand Island, NY), and treated with 20 μg RNAse A (no. AB-0548; Fisher Scientific, Pittsburgh). .. The final sample concentration was measured using the dsDNA HS assay kit with the Quibit 2.0 fluorometer (no. ; Life Technologies), and 500 ng of DNA per sample was digested for 1.5 hr at 37° with Xba I, 100 μg/ml bovine serum albumin, and NEB Buffer 4 (20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM dithiothreitol, pH 7.9) (no. R0145L; New England Biolabs, Beverly, MA).

    Gel Extraction:

    Article Title: Synthetic Zinc Finger Nuclease Design and Rapid Assembly
    Article Snippet: One generated the “vector backbone” and the second created a large quantity of the “middle fragment.” For the pMJO-6 vector 1 μg of the vector was digested with Bgl II and Xba I (NEB) to create the backbone and 10 μg was digested with Bam HI and Nhe I to generate the middle fragment. .. The PCR fragments and vector digests were resolved on a 1.5% agarose gel and the top band of the backbone digest, the smaller band of the middle digest, and each PCR product were purified with a QIAquick gel extraction kit (Qiagen, Hilden, Germany) with the plasmid fragments eluted in 10 μl and the PCR products eluted in 50 μl of water.

    Variant Assay:

    Article Title: Vika/vox, a novel efficient and specific Cre/loxP-like site-specific recombination system
    Article Snippet: Construction of expression plasmids The Vika coding sequence was synthesized (GeneArt, Life Technologies Corporation) and cloned via BsrGI and XbaI New England Biolabs (NEB) into pEVO vectors as described previously ( ). .. A mutant variant of Vika in which Tyr343 was replaced by phenylalanine was constructed by site-directed mutagenesis.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs restriction endonucleases xbai
    (A) <t>PFGE</t> analysis of S . Typhimurium DT104 using <t>XbaI</t> and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,
    Restriction Endonucleases Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction endonucleases xbai/product/New England Biolabs
    Average 95 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    restriction endonucleases xbai - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    80
    New England Biolabs xbai site located
    (GAA•TTC) n constructs used to analyze effect of DSB repair on triplet-repeat instability. pUC19 based constructs are shown containing either uninterrupted (GAA•TTC) 79 or (GAA•TTC) n sequences engineered to contain a <t>XbaI</t> recognition sequence at specific locations within the repeat tract (see Materials and Methods section for details). Repeat tracts were cloned in both orientations relative to the origin of replication (arrow indicates direction of replication). Repeat-containing plasmids are depicted either in the <t>‘GAA</t> orientation’ (e.g. GAA-79) or ‘TTC’ orientation (e.g. TTC-79), based on whether (GAA) n or (TTC) n serves as the lagging strand template, respectively. Numbers within the boxes indicate the length of the uninterrupted (GAA•TTC) n sequence.
    Xbai Site Located, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai site located/product/New England Biolabs
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai site located - by Bioz Stars, 2020-02
    80/100 stars
      Buy from Supplier

    78
    New England Biolabs algr d54e xbai r
    Phosphorylated <t>AlgR</t> and AlgR <t>D54E</t> bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNA fragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its location within the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect of phosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane 1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competed with the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR protein was pretreated either with water only or with AcP (500× molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-protein control (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubated with a no-protein control (lane 11), 2.5 μM AlgR (lane 12), or 2.5 μM AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for binding to fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to 9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.
    Algr D54e Xbai R, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/algr d54e xbai r/product/New England Biolabs
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    algr d54e xbai r - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results


    (A) PFGE analysis of S . Typhimurium DT104 using XbaI and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,

    Journal: Applied and Environmental Microbiology

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain

    doi: 10.1128/AEM.01041-13

    Figure Lengend Snippet: (A) PFGE analysis of S . Typhimurium DT104 using XbaI and AvrII. Isolate groups were color identified for simplicity as follows, and the color codes were maintained in all of the assays: reference strain (white); group A, environmental (green); group B,

    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ).

    Techniques:

    Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Journal: Journal of Nematology

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10

    doi:

    Figure Lengend Snippet: Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Techniques: Southern Blot, Transformation Assay, Agarose Gel Electrophoresis

    (GAA•TTC) n constructs used to analyze effect of DSB repair on triplet-repeat instability. pUC19 based constructs are shown containing either uninterrupted (GAA•TTC) 79 or (GAA•TTC) n sequences engineered to contain a XbaI recognition sequence at specific locations within the repeat tract (see Materials and Methods section for details). Repeat tracts were cloned in both orientations relative to the origin of replication (arrow indicates direction of replication). Repeat-containing plasmids are depicted either in the ‘GAA orientation’ (e.g. GAA-79) or ‘TTC’ orientation (e.g. TTC-79), based on whether (GAA) n or (TTC) n serves as the lagging strand template, respectively. Numbers within the boxes indicate the length of the uninterrupted (GAA•TTC) n sequence.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: (GAA•TTC) n constructs used to analyze effect of DSB repair on triplet-repeat instability. pUC19 based constructs are shown containing either uninterrupted (GAA•TTC) 79 or (GAA•TTC) n sequences engineered to contain a XbaI recognition sequence at specific locations within the repeat tract (see Materials and Methods section for details). Repeat tracts were cloned in both orientations relative to the origin of replication (arrow indicates direction of replication). Repeat-containing plasmids are depicted either in the ‘GAA orientation’ (e.g. GAA-79) or ‘TTC’ orientation (e.g. TTC-79), based on whether (GAA) n or (TTC) n serves as the lagging strand template, respectively. Numbers within the boxes indicate the length of the uninterrupted (GAA•TTC) n sequence.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Construct, Sequencing, Clone Assay

    DSB repair mediated instability of the (GAA•TTC) n sequence is independent of RecA. ( A ) Repair of linear templates obtained by XbaI digestion of GAA-70X, TTC-70X, GAA-30X and TTC-30X resulted in similar levels of instability when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. There was no difference in the level of repeat instability between the RecA-proficient and RecA-deficient strains, regardless of repeat length or the orientation with respect to the origin of replication. ( B ) Instability of GAA-30X constructs either uncut or following repair at the PstI, XbaI or KpnI restriction sites in isogenic E. coli strains AB1157 (RecA-proficient) and JC10287 (RecA-deficient) showing that DSB repair-mediated instability is independent of RecA. Note that there is no difference in the level of instability with any of the four constructs in AB1157 versus JC10287. DSB repair, when specifically within the repeat tract, causes significantly increased instability in both strains. All error bars represent +/−2 SEM derived from triplicate experiments.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair mediated instability of the (GAA•TTC) n sequence is independent of RecA. ( A ) Repair of linear templates obtained by XbaI digestion of GAA-70X, TTC-70X, GAA-30X and TTC-30X resulted in similar levels of instability when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. There was no difference in the level of repeat instability between the RecA-proficient and RecA-deficient strains, regardless of repeat length or the orientation with respect to the origin of replication. ( B ) Instability of GAA-30X constructs either uncut or following repair at the PstI, XbaI or KpnI restriction sites in isogenic E. coli strains AB1157 (RecA-proficient) and JC10287 (RecA-deficient) showing that DSB repair-mediated instability is independent of RecA. Note that there is no difference in the level of instability with any of the four constructs in AB1157 versus JC10287. DSB repair, when specifically within the repeat tract, causes significantly increased instability in both strains. All error bars represent +/−2 SEM derived from triplicate experiments.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Transformation Assay, Mutagenesis, Construct, Derivative Assay

    DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half (or less than half) of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation in E. coli MM28 of ( A ) EcoRI and HindIII linearized GAA-79 and TTC-79; ( B ) XbaI linearized GAA-70X and TTC-70X; ( C ) XbaI linearized GAA-30X and TTC-30X, ( D ) XbaI linearized (3′ recessed) and after end filling (blunt-ended) GAA-70X, ( E ) XbaI linearized GAA-30X in MM28 (RecA-proficient) and M152 (RecA-deficient) isogenic strains, and ( F ) XbaI linearized GAA-30X in AB1157 (RecA-proficient) and JC10287 (RecA-deficient) isogenic strains. Note that the size distribution of deletion products is random when DSB repair occurs outside the repeat (EcoRI, HindIII); however, approximately half of the repeat tract, or less, is preferentially deleted when DSB repair occurs at the center of the repeat tract. This is irrespective of the initial length of the repeat tract (70 or 30 triplets), the nature of the termini being repaired (staggered or blunt), or the presence/absence of RecA.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half (or less than half) of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation in E. coli MM28 of ( A ) EcoRI and HindIII linearized GAA-79 and TTC-79; ( B ) XbaI linearized GAA-70X and TTC-70X; ( C ) XbaI linearized GAA-30X and TTC-30X, ( D ) XbaI linearized (3′ recessed) and after end filling (blunt-ended) GAA-70X, ( E ) XbaI linearized GAA-30X in MM28 (RecA-proficient) and M152 (RecA-deficient) isogenic strains, and ( F ) XbaI linearized GAA-30X in AB1157 (RecA-proficient) and JC10287 (RecA-deficient) isogenic strains. Note that the size distribution of deletion products is random when DSB repair occurs outside the repeat (EcoRI, HindIII); however, approximately half of the repeat tract, or less, is preferentially deleted when DSB repair occurs at the center of the repeat tract. This is irrespective of the initial length of the repeat tract (70 or 30 triplets), the nature of the termini being repaired (staggered or blunt), or the presence/absence of RecA.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Transformation Assay

    DSB repair results in dramatically increased instability of the (GAA•TTC) n sequence when the break is located within the repeat tract. ( A ) Representative agarose gels with products of colony PCR showing transformants of GAA-79 [circular (uncut), or linearized with HindIII or EcoRI], and GAA-70X [circular (uncut), or linearized with XbaI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. The first lane in each gel contains the 1 kb Plus ladder (Invitrogen) with bands from the bottom of the gel representing 0.2, 0.3, 0.4, 0.5 and 0.65 kb (note: the full-length products of GAA-79 and GAA-70X are 423 and 312 bp, respectively, due to the presence of some flanking intron 1 sequence from the human FXN gene in the former). ( B ) Representative agarose gels with products of colony PCR showing transformants of GAA-30X [circular (uncut), or linearized with PstI, XbaI or KpnI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. Note that even the (GAA•TTC) 30 sequence, which was otherwise extremely stable, showed a dramatic rise in the frequency of deletions. The first lane of every gel contains a DNA size marker; the markers used in the gels containing repair products of templates GAA-30X PstI and KpnI are different from all other gels. The first lane in each gel contains either the 1 kb Plus ladder (Invitrogen) (GAA-30X; PstI and KpnI with bands from the bottom of the gel representing 0.1, 0.2 and 0.3 kb, or the 50 bp DNA ladder (Invitrogen) (GAA-30X; uncut and XbaI) with bands from the bottom of the gel representing 0.1, 0.15, 0.2, 0.25, 0.3 and 0.35 kb. ( C ) DSB repair within a slightly unstable (GAA•TTC) 70–79 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. ( D ) DSB repair within a highly stable (GAA•TTC) 30 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. All error bars represent +/−2 SEM derived from triplicate experiments.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair results in dramatically increased instability of the (GAA•TTC) n sequence when the break is located within the repeat tract. ( A ) Representative agarose gels with products of colony PCR showing transformants of GAA-79 [circular (uncut), or linearized with HindIII or EcoRI], and GAA-70X [circular (uncut), or linearized with XbaI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. The first lane in each gel contains the 1 kb Plus ladder (Invitrogen) with bands from the bottom of the gel representing 0.2, 0.3, 0.4, 0.5 and 0.65 kb (note: the full-length products of GAA-79 and GAA-70X are 423 and 312 bp, respectively, due to the presence of some flanking intron 1 sequence from the human FXN gene in the former). ( B ) Representative agarose gels with products of colony PCR showing transformants of GAA-30X [circular (uncut), or linearized with PstI, XbaI or KpnI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. Note that even the (GAA•TTC) 30 sequence, which was otherwise extremely stable, showed a dramatic rise in the frequency of deletions. The first lane of every gel contains a DNA size marker; the markers used in the gels containing repair products of templates GAA-30X PstI and KpnI are different from all other gels. The first lane in each gel contains either the 1 kb Plus ladder (Invitrogen) (GAA-30X; PstI and KpnI with bands from the bottom of the gel representing 0.1, 0.2 and 0.3 kb, or the 50 bp DNA ladder (Invitrogen) (GAA-30X; uncut and XbaI) with bands from the bottom of the gel representing 0.1, 0.15, 0.2, 0.25, 0.3 and 0.35 kb. ( C ) DSB repair within a slightly unstable (GAA•TTC) 70–79 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. ( D ) DSB repair within a highly stable (GAA•TTC) 30 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. All error bars represent +/−2 SEM derived from triplicate experiments.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Polymerase Chain Reaction, Marker, Produced, Derivative Assay

    DSB repair-mediated instability of the (GAA•TTC) n sequence is independent of the length of the intervening sequence at the center of the repeat tract. ( A ) GAA-70-spacer construct containing a 28 bp spacer in the XbaI site of GAA-70X, such that BamHI would cut in the center of the spacer (indicated by the black box). ( B ) DSB repair at the BamHI site in GAA-70-spacer construct produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. All error bars represent +/−2 SEM derived from triplicate experiments. ( C ) DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation of BamHI-linearized GAA-70-spacer vector in E. coli MM28 (WT) and M152 ( recA ).

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair-mediated instability of the (GAA•TTC) n sequence is independent of the length of the intervening sequence at the center of the repeat tract. ( A ) GAA-70-spacer construct containing a 28 bp spacer in the XbaI site of GAA-70X, such that BamHI would cut in the center of the spacer (indicated by the black box). ( B ) DSB repair at the BamHI site in GAA-70-spacer construct produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. All error bars represent +/−2 SEM derived from triplicate experiments. ( C ) DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation of BamHI-linearized GAA-70-spacer vector in E. coli MM28 (WT) and M152 ( recA ).

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Construct, Produced, Transformation Assay, Mutagenesis, Derivative Assay, Plasmid Preparation

    Phosphorylated AlgR and AlgR D54E bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNA fragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its location within the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect of phosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane 1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competed with the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR protein was pretreated either with water only or with AcP (500× molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-protein control (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubated with a no-protein control (lane 11), 2.5 μM AlgR (lane 12), or 2.5 μM AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for binding to fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to 9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: Phosphorylated AlgR and AlgR D54E bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNA fragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its location within the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect of phosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane 1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competed with the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR protein was pretreated either with water only or with AcP (500× molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-protein control (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubated with a no-protein control (lane 11), 2.5 μM AlgR (lane 12), or 2.5 μM AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for binding to fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to 9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: In Vitro, Binding Assay, Purification, Incubation

    AlgR phosphorylation was required for maximal rhamnolipid production. (A) Thin-layer chromatography. Strains PAO1 (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAO1 Δ rhlA (Δ rhlA ) were grown for 16 h in TSB plus 1% glycerol. Mono, monorhamnolipid band; Di, dirhamnolipid band. (B) Strains for which results are shown in panel A were tested for rhamnolipid production by use of the orcinol colorimetric assay and comparison with a standard curve (see Materials and Methods). Values were normalized to total-protein values. (C) The extent of hemolysis due to rhamnolipid production was measured. Cultures were grown for 24 h in a phosphate-limiting medium (tryptic soy broth supplemented with 1% glucose), and cell-free supernatants were heat treated to denature polypeptide-based hemolysins. Serial dilutions were applied to 1% horse red blood cells for 1 h at 37°C, and the percentage of hemolysis was calculated based on total and no hemolysis. Statistical analysis was performed by one-way analysis of variance. n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*), 0.01 to 0.001 (**), or

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: AlgR phosphorylation was required for maximal rhamnolipid production. (A) Thin-layer chromatography. Strains PAO1 (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAO1 Δ rhlA (Δ rhlA ) were grown for 16 h in TSB plus 1% glycerol. Mono, monorhamnolipid band; Di, dirhamnolipid band. (B) Strains for which results are shown in panel A were tested for rhamnolipid production by use of the orcinol colorimetric assay and comparison with a standard curve (see Materials and Methods). Values were normalized to total-protein values. (C) The extent of hemolysis due to rhamnolipid production was measured. Cultures were grown for 24 h in a phosphate-limiting medium (tryptic soy broth supplemented with 1% glucose), and cell-free supernatants were heat treated to denature polypeptide-based hemolysins. Serial dilutions were applied to 1% horse red blood cells for 1 h at 37°C, and the percentage of hemolysis was calculated based on total and no hemolysis. Statistical analysis was performed by one-way analysis of variance. n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*), 0.01 to 0.001 (**), or

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: Thin Layer Chromatography, Colorimetric Assay

    Effects of different algR alleles on twitching and swarming motility. (A) Subsurface twitching motilities were analyzed at 48 h after inoculation in LB–1% agar, and the average diameters of twitching zones were measured. Strains PAO1 ( algR + ) (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54 E) were analyzed. PAO1A ( pilA :: Tc ) was used as a negative control. Statistical analysis was performed by one-way analysis of variance. n.s., not significant; ***, P

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: Effects of different algR alleles on twitching and swarming motility. (A) Subsurface twitching motilities were analyzed at 48 h after inoculation in LB–1% agar, and the average diameters of twitching zones were measured. Strains PAO1 ( algR + ) (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54 E) were analyzed. PAO1A ( pilA :: Tc ) was used as a negative control. Statistical analysis was performed by one-way analysis of variance. n.s., not significant; ***, P

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: Negative Control

    AlgR D54E increased fimU transcription. (A) Diagram showing the genotypes of the following strains: PAO1 ( algR + ), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54E). The dashed regions represent the deletion of the gene indicated. (B) The strains diagramed in panel A were tested for fimU transcriptional activity. Strains contained a fimU :: lacZ transcriptional reporter in the chromosomal attB locus. β-Galactosidase activities from 21-h LB cultures grown at 37°C were assayed. Significant differences from the wild type by Student t tests are indicated (***, P

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: AlgR D54E increased fimU transcription. (A) Diagram showing the genotypes of the following strains: PAO1 ( algR + ), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54E). The dashed regions represent the deletion of the gene indicated. (B) The strains diagramed in panel A were tested for fimU transcriptional activity. Strains contained a fimU :: lacZ transcriptional reporter in the chromosomal attB locus. β-Galactosidase activities from 21-h LB cultures grown at 37°C were assayed. Significant differences from the wild type by Student t tests are indicated (***, P

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: Activity Assay