xbai new england biolabs  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    XbaI
    Description:
    XbaI 15 000 units
    Catalog Number:
    r0145l
    Price:
    290
    Size:
    15 000 units
    Category:
    Restriction Enzymes
    Buy from Supplier


    Structured Review

    New England Biolabs xbai new england biolabs
    XbaI
    XbaI 15 000 units
    https://www.bioz.com/result/xbai new england biolabs/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai new england biolabs - by Bioz Stars, 2020-04
    99/100 stars

    Related Products / Commonly Used Together

    expression plasmids
    vika coding sequence
    pevo vectors
    bsrgi

    Images

    Related Articles

    Clone Assay:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: Paragraph title: Cloning and mutagenesis of msbB gene. ... The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: PCR product was digested with SalI restriction endonuclease (New England Biolabs, Hitchin, UK) and inserted into pUC19 cloning vector digested with the same restriction enzyme. .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector.

    Luciferase:

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector. .. The cloned pFI2576 rep was digested with SalI enzyme and subcloned into recombinant pTG262 (luc+ ) digested with the same enzyme.

    Lambda DNA Preparation:

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Southern blot hybridization was performed at 65°C in Church buffer (1% BSA, 0.25 M Na2 HPO4 pH 7.3, 7% SDS, 1 mM EDTA) with a 1,104‐bp‐long radiolabeled probe corresponding to the rightmost region common to both the native and the Syn‐HiC restriction fragments (obtained from SK1 genomic DNA with primers 5′‐TGGTGAAGAACTCAGGATTC‐3′ and 5′‐CAGTTACAATGAAGTCCAGG‐3′) and radiolabeled phage lambda DNA (molecular ladder).

    TA Cloning:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The 1,443-bp PCR product was cloned using the TA cloning vector pCR2.1 (Invitrogen), and this construct was designated pNMBA11. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Construct:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The 1,443-bp PCR product was cloned using the TA cloning vector pCR2.1 (Invitrogen), and this construct was designated pNMBA11. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Electrophoresis:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis ... The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Electrophoresis was performed on the CHEF-DRII (Bio-Rad Laboratories, Richmond, Calif.) with the following conditions: 0.5× Tris-borate-EDTA, 1% agarose, 13°C, 6 V/cm for 23 h (with switch times ranging from 5 to 60 s).

    Incubation:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: The plugs were treated with 5 ml cell lysis buffer (50 mM Tris, 50 mM EDTA, pH 8.0, 1% Sarcosyl) and 25 µl proteinase K (20 mg/ml) and incubated at 54°C for 2 h in a shaking water bath. .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: PCR was performed using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) with the following cycling parameters: 30 s of initial incubation at 98°C, 35 cycles at 98°C for 10 s and at 72°C for 2 min, and a final elongation step of 2 min at 72°C. .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector.

    Amplification:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: PCR amplification of this region was performed with N. meningitidis strain NMB genomic DNA and the primers gchtrB3 5"-CAACAGGCGGCGGTGGAACAG-3" and gchtrB4 5"-TTCGGCATCCACTCCCCTTTG-3". .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Transformation Assay:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs). .. This construct was ligated using T4 DNA ligase and subsequently transformed into E. coli DH5α cells (Invitrogen).

    Hybridization:

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. Hybridization was conducted under high stringency conditions (20% dextran sulfate, 2×SSC, 0.5% fat free milk powder, and 1% SDS) in the presence of 750 µg/mL of heat-denatured salmon sperm DNA.

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Southern blot hybridization was performed at 65°C in Church buffer (1% BSA, 0.25 M Na2 HPO4 pH 7.3, 7% SDS, 1 mM EDTA) with a 1,104‐bp‐long radiolabeled probe corresponding to the rightmost region common to both the native and the Syn‐HiC restriction fragments (obtained from SK1 genomic DNA with primers 5′‐TGGTGAAGAACTCAGGATTC‐3′ and 5′‐CAGTTACAATGAAGTCCAGG‐3′) and radiolabeled phage lambda DNA (molecular ladder).

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. Hybridization and detection were performed using the North2South chemiluminescent hybridization and detection kit (Thermo Scientific, Rockport, IL) per manufacturer’s instructions.

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. The membrane was UV cross-linked and hybridized for 16 hr at 42 ° C with a [α-32 P] dATP labeled 16D10i-2 probe ( ) in hybridization buffer (50% deionized formamide, 0.1 mg/ml salmon sperm DNA, 1% sodium dodecyl sulfate (SDS), 1 M NaCl, 10% dextran sulfate).

    Southern Blot:

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: A Southern blot analysis was performed to confirm the transgene. .. The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion.

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: Paragraph title: Southern blot analysis of crossing‐over formation at the CCT6 hotspot ... The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions.

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genetic manipulation was confirmed by Southern blot analysis. .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion.

    Northern Blot:

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: Paragraph title: Southern and northern blotting: ... For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Generated:

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. The specific sequences recognized by the restriction enzymes and DNA termini generated are shown in .

    Random Primed:

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. The blots were probed with the 232-bp PCR fragment of DsRed (forward, 5′- CGACATCCCCGACTACATGA-3′ , and reverse, 5′- TCCTGGGGGTACAGCTTCTC-3′ ), which was [p32 ]dCTP-labeled by using the random primed labeling method.

    Sequencing:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The sequence that showed the highest homology to the E. coli gene ( N. gonorrhoeae sequence bp 160985 to 162427) was used for the design of PCR primers. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: Paragraph title: Cloning and sequencing of the Ig heavy chain gene ... The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector.

    Binding Assay:

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. We and others have previously reported that the C-terminus of Ku80 is dispensable for Ku/DNA binding [ , ].

    Pulsed-Field Gel:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: Paragraph title: Pulsed Field Gel Electrophoresis ... The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Paragraph title: Pulsed field gel electrophoresis, Southern blotting and hybridization ... Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA).

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: .. Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Salmonella enterica serovar Braenderup H9812 (ATCC BAA-664) was used as the reference strain for the molecular size standard.

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Paragraph title: Pulsed-field gel electrophoresis. ... Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ).

    Radioactivity:

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Radiolabeling was performed with 32 P‐αdCTP with the High Prime labeling kit (Roche) following the manufacturer's instructions.

    Mutagenesis:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: Paragraph title: Cloning and mutagenesis of msbB gene. ... The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Isolation:

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: .. Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Electrophoresis was performed on the CHEF-DRII (Bio-Rad Laboratories, Richmond, Calif.) with the following conditions: 0.5× Tris-borate-EDTA, 1% agarose, 13°C, 6 V/cm for 23 h (with switch times ranging from 5 to 60 s).

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. For northern blots, total RNA enriched for small RNA was extracted from 1 g potato leaves using the mirVana miRNA isolation kit (Ambion, Austin, TX) according to the manufacturer’s instructions.

    Size-exclusion Chromatography:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad). ..

    Labeling:

    Article Title: Characterizing meiotic chromosomes' structure and pairing using a designer sequence optimized for Hi‐C
    Article Snippet: The DNA was digested with NdeI and XbaI (New England Biolabs), migrated on a 1% UltraPure Agarose (Invitrogen) 1× TAE for 15 h at 70 V, and capillary transferred onto a Hybond‐XL membrane (GE Healthcare) following the manufacturer's instructions. .. Radiolabeling was performed with 32 P‐αdCTP with the High Prime labeling kit (Roche) following the manufacturer's instructions.

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. The membrane was UV cross-linked and hybridized for 16 hr at 42 ° C with a [α-32 P] dATP labeled 16D10i-2 probe ( ) in hybridization buffer (50% deionized formamide, 0.1 mg/ml salmon sperm DNA, 1% sodium dodecyl sulfate (SDS), 1 M NaCl, 10% dextran sulfate).

    Purification:

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: DNA was extracted from potato leaves ground in liquid nitrogen with TPS buffer (100 mM Tris-HCl pH 8, 100 mM EDTA pH 8, 1 M KCl), precipitated with isopropanol, treated with RNase, and purified with chloroform/isopropanol precipitation. .. For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Polymerase Chain Reaction:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs). .. This construct was ligated using T4 DNA ligase and subsequently transformed into E. coli DH5α cells (Invitrogen).

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: PCR product was digested with SalI restriction endonuclease (New England Biolabs, Hitchin, UK) and inserted into pUC19 cloning vector digested with the same restriction enzyme. .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector.

    Staining:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad). ..

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Gels were stained in a 1-μg/ml solution of ethidium bromide and visualized under UV light transillumination with Gel Doc (Bio-Rad, Munich, Germany).

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Gels were stained with ethidium bromide and photographed using a Gel Doc 1000 system (Bio-Rad Laboratories).

    IA:

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs).

    Plasmid Preparation:

    Article Title: Intracellular Survival of Neisseria gonorrhoeae in Male Urethral Epithelial Cells: Importance of a Hexaacyl Lipid A
    Article Snippet: The 1,443-bp PCR product was cloned using the TA cloning vector pCR2.1 (Invitrogen), and this construct was designated pNMBA11. .. The Xba I and Hin dIII sites flanking the PCR product were used to clone the PCR fragment into Xba I- and Hin dIII-restricted pUC19 (New England Biolabs).

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: .. Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. The specific sequences recognized by the restriction enzymes and DNA termini generated are shown in .

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector. .. The cloned pFI2576 rep was digested with SalI enzyme and subcloned into recombinant pTG262 (luc+ ) digested with the same enzyme.

    Software:

    Article Title: Evidence of Metabolic Switching and Implications for Food Safety from the Phenome(s) of Salmonella enterica Serovar Typhimurium DT104 Cultured at Selected Points across the Pork Production Food Chain
    Article Snippet: Pulsed-field gel electrophoresis (PFGE) was performed using the restriction endonucleases XbaI and AvrII (New England BioLabs) by following the CDC PulseNet protocol ( ). .. Macrorestriction patterns were compared using the BioNumerics fingerprinting software (version 6.5; Applied Math, Austin, TX).

    Recombinant:

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector. .. The cloned pFI2576 rep was digested with SalI enzyme and subcloned into recombinant pTG262 (luc+ ) digested with the same enzyme.

    Agarose Gel Electrophoresis:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad). ..

    Article Title: Characterization of DXZ4 conservation in primates implies important functional roles for CTCF binding, array expression and tandem repeat organization on the X chromosome
    Article Snippet: Agarose embedded DNA was digested with Xba I (NEB, Ipswich, MA, USA). .. Plugs were loaded onto a 1.0% agarose gel prepared using pulsed field certified agarose (Biorad, Hercules, CA, USA) in 0.5 × TBE.

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: .. The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. The blots were probed with the 232-bp PCR fragment of DsRed (forward, 5′- CGACATCCCCGACTACATGA-3′ , and reverse, 5′- TCCTGGGGGTACAGCTTCTC-3′ ), which was [p32 ]dCTP-labeled by using the random primed labeling method.

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Article Title: Recognition of DNA Termini by the C-Terminal Region of the Ku80 and the DNA-Dependent Protein Kinase Catalytic Subunit
    Article Snippet: Kinase assays using plasmid DNA substrates were performed with pcDNA3.1 digested with either XhoI, BamHI, EcoRV, and KpnI or pCAG-GFP digested with XbaI or EcoRI (New England Biolabs). .. Complete digestion of the plasmid DNA was analyzed by native agarose gel electrophoresis of the reaction products.

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10
    Article Snippet: .. For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7). .. The membrane was UV cross-linked and hybridized for 16 hr at 42 ° C with a [α-32 P] dATP labeled 16D10i-2 probe ( ) in hybridization buffer (50% deionized formamide, 0.1 mg/ml salmon sperm DNA, 1% sodium dodecyl sulfate (SDS), 1 M NaCl, 10% dextran sulfate).

    Produced:

    Article Title: Construction of a Bioluminescent Labelling Plasmid Vector for Bifidobacteria
    Article Snippet: Construction of recombinant DNAs Plasmids and primers used in this study are listed in . pFI2576 rep (~2.0 kb) PCR product was produced with pFI2576 rep F-1 and R-1 primer set under the following PCR conditions: initial denaturation at 98°C for 30 s; 30 cycles of 98°C for 10 s and 72°C for 1 min; final extension at 72°C for 5 min. Phusion-HF DNA polymerase (Thermo Scientific, UK) was used for PCR. .. A luciferase gene (luc+ ) was liberated with XbaI and EcoRI restriction endonucleases (New England Biolabs) from pLuc2 recombinant plasmid and inserted into pTG262 vector.

    Diffusion-based Assay:

    Article Title: Generation and Characterization of a Transgenic Pig Carrying a DsRed-Monomer Reporter Gene
    Article Snippet: .. The DNA were digested using XbaI and DraI (New England Biolabs, Beverly, MA, USA), separated in 1% agarose gel, and then transferred to a Hybond-N+ membrane (Amersham Biosciences) by using capillary diffusion. .. The blots were probed with the 232-bp PCR fragment of DsRed (forward, 5′- CGACATCCCCGACTACATGA-3′ , and reverse, 5′- TCCTGGGGGTACAGCTTCTC-3′ ), which was [p32 ]dCTP-labeled by using the random primed labeling method.

    Molecular Weight:

    Article Title: Animal and Human Multidrug-Resistant, Cephalosporin-Resistant Salmonella Isolates Expressing a Plasmid-Mediated CMY-2 AmpC ?-Lactamase
    Article Snippet: Genomic DNA was isolated and digested with Xba I (New England Biolabs, Beverly, Mass.) as previously described ( ). .. Molecular weight standards were a λ ladder that contained concatamers of the 48.5-kb phage DNA (FMC BioProduct, Rockland, Maine).

    DNA Purification:

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A
    Article Snippet: .. Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion. .. DNA was transferred to a nylon Biodyne B membrane (Thermo Scientific, Rockford, IL) and UV-cross-linked for 5 min. A DNA probe amplified from WT A. baumannii Ci79 genomic DNA using the DN_Fw/DN_Rv primer set was biotin labeled using the North2South biotin random prime labeling kit (Thermo Scientific, Rockport, IL).

    Lysis:

    Article Title: Antimicrobial Resistance, Virulence Profiles and Molecular Subtypes of Salmonella enterica Serovars Typhi and Paratyphi A Blood Isolates from Kolkata, India during 2009-2013
    Article Snippet: The plugs were treated with 5 ml cell lysis buffer (50 mM Tris, 50 mM EDTA, pH 8.0, 1% Sarcosyl) and 25 µl proteinase K (20 mg/ml) and incubated at 54°C for 2 h in a shaking water bath. .. The DNA plugs were digested with 40 U of Xba I (New England Biolabs, MA) at 37°C for 18 h. The digested DNA was run on 1% pulsed field certified agarose gel (Bio-Rad, Hercules, Calif.) prepared in 0.5x TBE buffer (Sigma) using CHEF DRIII (Bio-Rad) apparatus with an initial switch time of 2.2 sec and a final switch time of 63.8 sec at 6 V/cm for 24 h. The gel was stained with ethidium bromide (1 µg/ml, Sigma), destained with deionized water and PFGE profiles were observed with the UV trans-illuminator using GelDoc (Bio-Rad).

    Gel Extraction:

    Article Title: A method to convert mRNA into a gRNA library for CRISPR/Cas9 editing of any organism
    Article Snippet: .. The PCR product was purified using QIAquick Gel Extraction Kit (Qiagen), digested with Hind III (NEB) and Xba I (NEB), and cloned into the pUC119 plasmid vector. .. Approximately 30 plasmid clones for each sorted sIgM (−) population were sequenced using universal forward, reverse, and Ig heavy chain primers 3 and 4.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs xba i
    Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg <t>DNA</t> was digested with 50 U <t>Xba</t> I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;
    Xba I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/New England Biolabs
    Average 99 stars, based on 346 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    New England Biolabs xbai site located
    (GAA•TTC) n constructs used to analyze effect of DSB repair on triplet-repeat instability. pUC19 based constructs are shown containing either uninterrupted (GAA•TTC) 79 or (GAA•TTC) n sequences engineered to contain a <t>XbaI</t> recognition sequence at specific locations within the repeat tract (see Materials and Methods section for details). Repeat tracts were cloned in both orientations relative to the origin of replication (arrow indicates direction of replication). Repeat-containing plasmids are depicted either in the <t>‘GAA</t> orientation’ (e.g. GAA-79) or ‘TTC’ orientation (e.g. TTC-79), based on whether (GAA) n or (TTC) n serves as the lagging strand template, respectively. Numbers within the boxes indicate the length of the uninterrupted (GAA•TTC) n sequence.
    Xbai Site Located, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai site located/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai site located - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    86
    New England Biolabs algr d54e xbai r
    Phosphorylated <t>AlgR</t> and AlgR <t>D54E</t> bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNA fragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its location within the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect of phosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane 1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competed with the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR protein was pretreated either with water only or with AcP (500× molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-protein control (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubated with a no-protein control (lane 11), 2.5 μM AlgR (lane 12), or 2.5 μM AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for binding to fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to 9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.
    Algr D54e Xbai R, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/algr d54e xbai r/product/New England Biolabs
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    algr d54e xbai r - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Journal: Journal of Nematology

    Article Title: Broad Meloidogyne Resistance in Potato Based on RNA Interference of Effector Gene 16D10

    doi:

    Figure Lengend Snippet: Southern blot showing copy numbers of the 16D10i-2 RNAi transgene in transformed potato lines and controls. For each plant line, 15 µg DNA was digested with 50 U Xba I and separated on a 0.8% agarose gel. 82-4, PA99N82-4 advanced breeding line;

    Article Snippet: For each plant line, 15 µg DNA was digested with 50 U Xba I (New England Biolabs, Ipswich, MA) for 16 hr at 37 ° C, then separated on a 0.8% agarose gel at 70 V for 16 hr and transferred to a GeneScreen Plus nylon membrane (PerkinElmer, Boston, MA) in 10× saline sodium citrate (SSC) buffer (1.5 M NaCl, 0.15 M sodium citrate, pH 7).

    Techniques: Southern Blot, Transformation Assay, Agarose Gel Electrophoresis

    Generation of a trxA deletion mutant. A schematic representation of the WT A. baumannii Ci79 and Δ trxA mutant genome surrounding the trxA locus with predicted fragment sizes detected by probe following either HindIII (white arrowhead) or XbaI (black arrowhead) digestion as well as probe target region (dotted box) (A). Southern blot (B) and Western blot (C) analyses of genomic and protein extracts, respectively, from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii were subsequently performed. PCR amplification of the trxA gene locus was performed using DNA from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii isolates. The PCR amplicons were subsequently digested with SalI and subjected to agarose gel electrophoresis (C). Total bacterial proteins were separated by electrophoresis and visualized in a Coomassie blue-stained polyacrylamide gel (D, left panel) or probed with anti-TrxA antibody to detect TrxA expression (D, right panel). Molecular marker sizes for DNA (bp; B and C) and protein (kDa; D) are provided.

    Journal: mBio

    Article Title: Acinetobacter baumannii Gastrointestinal Colonization Is Facilitated by Secretory IgA Which Is Reductively Dissociated by Bacterial Thioredoxin A

    doi: 10.1128/mBio.01298-18

    Figure Lengend Snippet: Generation of a trxA deletion mutant. A schematic representation of the WT A. baumannii Ci79 and Δ trxA mutant genome surrounding the trxA locus with predicted fragment sizes detected by probe following either HindIII (white arrowhead) or XbaI (black arrowhead) digestion as well as probe target region (dotted box) (A). Southern blot (B) and Western blot (C) analyses of genomic and protein extracts, respectively, from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii were subsequently performed. PCR amplification of the trxA gene locus was performed using DNA from WT Ci79, ΔtrxA , and ΔtrxA c A. baumannii isolates. The PCR amplicons were subsequently digested with SalI and subjected to agarose gel electrophoresis (C). Total bacterial proteins were separated by electrophoresis and visualized in a Coomassie blue-stained polyacrylamide gel (D, left panel) or probed with anti-TrxA antibody to detect TrxA expression (D, right panel). Molecular marker sizes for DNA (bp; B and C) and protein (kDa; D) are provided.

    Article Snippet: Genomic DNAs from Ci79, Δ trxA , and Δ trxA c strains were isolated using the GeneJET genomic DNA purification kit (Thermo Scientific, Rockford, IL), digested with XbaI or HindIII (New England BioLabs), and run on an 0.8% agarose gel at 16 V until completion.

    Techniques: Mutagenesis, Southern Blot, Western Blot, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Staining, Expressing, Marker

    (GAA•TTC) n constructs used to analyze effect of DSB repair on triplet-repeat instability. pUC19 based constructs are shown containing either uninterrupted (GAA•TTC) 79 or (GAA•TTC) n sequences engineered to contain a XbaI recognition sequence at specific locations within the repeat tract (see Materials and Methods section for details). Repeat tracts were cloned in both orientations relative to the origin of replication (arrow indicates direction of replication). Repeat-containing plasmids are depicted either in the ‘GAA orientation’ (e.g. GAA-79) or ‘TTC’ orientation (e.g. TTC-79), based on whether (GAA) n or (TTC) n serves as the lagging strand template, respectively. Numbers within the boxes indicate the length of the uninterrupted (GAA•TTC) n sequence.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: (GAA•TTC) n constructs used to analyze effect of DSB repair on triplet-repeat instability. pUC19 based constructs are shown containing either uninterrupted (GAA•TTC) 79 or (GAA•TTC) n sequences engineered to contain a XbaI recognition sequence at specific locations within the repeat tract (see Materials and Methods section for details). Repeat tracts were cloned in both orientations relative to the origin of replication (arrow indicates direction of replication). Repeat-containing plasmids are depicted either in the ‘GAA orientation’ (e.g. GAA-79) or ‘TTC’ orientation (e.g. TTC-79), based on whether (GAA) n or (TTC) n serves as the lagging strand template, respectively. Numbers within the boxes indicate the length of the uninterrupted (GAA•TTC) n sequence.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Construct, Sequencing, Clone Assay

    DSB repair mediated instability of the (GAA•TTC) n sequence is independent of RecA. ( A ) Repair of linear templates obtained by XbaI digestion of GAA-70X, TTC-70X, GAA-30X and TTC-30X resulted in similar levels of instability when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. There was no difference in the level of repeat instability between the RecA-proficient and RecA-deficient strains, regardless of repeat length or the orientation with respect to the origin of replication. ( B ) Instability of GAA-30X constructs either uncut or following repair at the PstI, XbaI or KpnI restriction sites in isogenic E. coli strains AB1157 (RecA-proficient) and JC10287 (RecA-deficient) showing that DSB repair-mediated instability is independent of RecA. Note that there is no difference in the level of instability with any of the four constructs in AB1157 versus JC10287. DSB repair, when specifically within the repeat tract, causes significantly increased instability in both strains. All error bars represent +/−2 SEM derived from triplicate experiments.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair mediated instability of the (GAA•TTC) n sequence is independent of RecA. ( A ) Repair of linear templates obtained by XbaI digestion of GAA-70X, TTC-70X, GAA-30X and TTC-30X resulted in similar levels of instability when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. There was no difference in the level of repeat instability between the RecA-proficient and RecA-deficient strains, regardless of repeat length or the orientation with respect to the origin of replication. ( B ) Instability of GAA-30X constructs either uncut or following repair at the PstI, XbaI or KpnI restriction sites in isogenic E. coli strains AB1157 (RecA-proficient) and JC10287 (RecA-deficient) showing that DSB repair-mediated instability is independent of RecA. Note that there is no difference in the level of instability with any of the four constructs in AB1157 versus JC10287. DSB repair, when specifically within the repeat tract, causes significantly increased instability in both strains. All error bars represent +/−2 SEM derived from triplicate experiments.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Transformation Assay, Mutagenesis, Construct, Derivative Assay

    DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half (or less than half) of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation in E. coli MM28 of ( A ) EcoRI and HindIII linearized GAA-79 and TTC-79; ( B ) XbaI linearized GAA-70X and TTC-70X; ( C ) XbaI linearized GAA-30X and TTC-30X, ( D ) XbaI linearized (3′ recessed) and after end filling (blunt-ended) GAA-70X, ( E ) XbaI linearized GAA-30X in MM28 (RecA-proficient) and M152 (RecA-deficient) isogenic strains, and ( F ) XbaI linearized GAA-30X in AB1157 (RecA-proficient) and JC10287 (RecA-deficient) isogenic strains. Note that the size distribution of deletion products is random when DSB repair occurs outside the repeat (EcoRI, HindIII); however, approximately half of the repeat tract, or less, is preferentially deleted when DSB repair occurs at the center of the repeat tract. This is irrespective of the initial length of the repeat tract (70 or 30 triplets), the nature of the termini being repaired (staggered or blunt), or the presence/absence of RecA.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half (or less than half) of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation in E. coli MM28 of ( A ) EcoRI and HindIII linearized GAA-79 and TTC-79; ( B ) XbaI linearized GAA-70X and TTC-70X; ( C ) XbaI linearized GAA-30X and TTC-30X, ( D ) XbaI linearized (3′ recessed) and after end filling (blunt-ended) GAA-70X, ( E ) XbaI linearized GAA-30X in MM28 (RecA-proficient) and M152 (RecA-deficient) isogenic strains, and ( F ) XbaI linearized GAA-30X in AB1157 (RecA-proficient) and JC10287 (RecA-deficient) isogenic strains. Note that the size distribution of deletion products is random when DSB repair occurs outside the repeat (EcoRI, HindIII); however, approximately half of the repeat tract, or less, is preferentially deleted when DSB repair occurs at the center of the repeat tract. This is irrespective of the initial length of the repeat tract (70 or 30 triplets), the nature of the termini being repaired (staggered or blunt), or the presence/absence of RecA.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Transformation Assay

    DSB repair results in dramatically increased instability of the (GAA•TTC) n sequence when the break is located within the repeat tract. ( A ) Representative agarose gels with products of colony PCR showing transformants of GAA-79 [circular (uncut), or linearized with HindIII or EcoRI], and GAA-70X [circular (uncut), or linearized with XbaI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. The first lane in each gel contains the 1 kb Plus ladder (Invitrogen) with bands from the bottom of the gel representing 0.2, 0.3, 0.4, 0.5 and 0.65 kb (note: the full-length products of GAA-79 and GAA-70X are 423 and 312 bp, respectively, due to the presence of some flanking intron 1 sequence from the human FXN gene in the former). ( B ) Representative agarose gels with products of colony PCR showing transformants of GAA-30X [circular (uncut), or linearized with PstI, XbaI or KpnI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. Note that even the (GAA•TTC) 30 sequence, which was otherwise extremely stable, showed a dramatic rise in the frequency of deletions. The first lane of every gel contains a DNA size marker; the markers used in the gels containing repair products of templates GAA-30X PstI and KpnI are different from all other gels. The first lane in each gel contains either the 1 kb Plus ladder (Invitrogen) (GAA-30X; PstI and KpnI with bands from the bottom of the gel representing 0.1, 0.2 and 0.3 kb, or the 50 bp DNA ladder (Invitrogen) (GAA-30X; uncut and XbaI) with bands from the bottom of the gel representing 0.1, 0.15, 0.2, 0.25, 0.3 and 0.35 kb. ( C ) DSB repair within a slightly unstable (GAA•TTC) 70–79 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. ( D ) DSB repair within a highly stable (GAA•TTC) 30 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. All error bars represent +/−2 SEM derived from triplicate experiments.

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair results in dramatically increased instability of the (GAA•TTC) n sequence when the break is located within the repeat tract. ( A ) Representative agarose gels with products of colony PCR showing transformants of GAA-79 [circular (uncut), or linearized with HindIII or EcoRI], and GAA-70X [circular (uncut), or linearized with XbaI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. The first lane in each gel contains the 1 kb Plus ladder (Invitrogen) with bands from the bottom of the gel representing 0.2, 0.3, 0.4, 0.5 and 0.65 kb (note: the full-length products of GAA-79 and GAA-70X are 423 and 312 bp, respectively, due to the presence of some flanking intron 1 sequence from the human FXN gene in the former). ( B ) Representative agarose gels with products of colony PCR showing transformants of GAA-30X [circular (uncut), or linearized with PstI, XbaI or KpnI]. Arrowheads indicate the position of the full-length repeat tract. DSB repair outside the repeat tract showed levels of instability that were similar to the uncut plasmids; however, DSB repair within the repeat tract resulted in a very high frequency of deletions. Note that even the (GAA•TTC) 30 sequence, which was otherwise extremely stable, showed a dramatic rise in the frequency of deletions. The first lane of every gel contains a DNA size marker; the markers used in the gels containing repair products of templates GAA-30X PstI and KpnI are different from all other gels. The first lane in each gel contains either the 1 kb Plus ladder (Invitrogen) (GAA-30X; PstI and KpnI with bands from the bottom of the gel representing 0.1, 0.2 and 0.3 kb, or the 50 bp DNA ladder (Invitrogen) (GAA-30X; uncut and XbaI) with bands from the bottom of the gel representing 0.1, 0.15, 0.2, 0.25, 0.3 and 0.35 kb. ( C ) DSB repair within a slightly unstable (GAA•TTC) 70–79 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. ( D ) DSB repair within a highly stable (GAA•TTC) 30 sequence produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable in the GAA and TTC orientations. All error bars represent +/−2 SEM derived from triplicate experiments.

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Polymerase Chain Reaction, Marker, Produced, Derivative Assay

    DSB repair-mediated instability of the (GAA•TTC) n sequence is independent of the length of the intervening sequence at the center of the repeat tract. ( A ) GAA-70-spacer construct containing a 28 bp spacer in the XbaI site of GAA-70X, such that BamHI would cut in the center of the spacer (indicated by the black box). ( B ) DSB repair at the BamHI site in GAA-70-spacer construct produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. All error bars represent +/−2 SEM derived from triplicate experiments. ( C ) DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation of BamHI-linearized GAA-70-spacer vector in E. coli MM28 (WT) and M152 ( recA ).

    Journal: Nucleic Acids Research

    Article Title: Repair of DNA double-strand breaks within the (GAAoTTC)n sequence results in frequent deletion of the triplet-repeat sequence

    doi: 10.1093/nar/gkm1066

    Figure Lengend Snippet: DSB repair-mediated instability of the (GAA•TTC) n sequence is independent of the length of the intervening sequence at the center of the repeat tract. ( A ) GAA-70-spacer construct containing a 28 bp spacer in the XbaI site of GAA-70X, such that BamHI would cut in the center of the spacer (indicated by the black box). ( B ) DSB repair at the BamHI site in GAA-70-spacer construct produced a dramatic rise in instability. Note that the (GAA•TTC) n sequence was equally unstable when transformed into E. coli MM28 [wild-type (WT)] and its isogenic recA mutant strain, M152. All error bars represent +/−2 SEM derived from triplicate experiments. ( C ) DSB repair at the center of the (GAA•TTC) n sequence results in the preferential deletion of approximately half of the total repeat length. The residual tract lengths of the (GAA•TTC) n sequence are shown (as a percentage of full-length) after transformation of BamHI-linearized GAA-70-spacer vector in E. coli MM28 (WT) and M152 ( recA ).

    Article Snippet: The GAA-70X construct, which contains the (GAA•TTC)70 sequence with an XbaI site located exactly at the center of the repeat tract , was created using four synthetic oligonucleotides, as follows: Oligo #1: 5′-GGCGCTCCGCTGCAGCC(GAA)35 TCTAGACGCATCGCC-3′ and Oligo #2: 5′GGCGATGCGTCTAGA(TTC)35 GGCTGCAGCGGAGCGCC-3′ were annealed together in 10 mM Tris, pH 8.0, and digestion buffer 3 (100 mM NaCl, 10 mM MgCl2 ) (New England Biolabs), followed by incubating with PstI and XbaI restriction enzymes to digest both ends of the annealed oligos.

    Techniques: Sequencing, Construct, Produced, Transformation Assay, Mutagenesis, Derivative Assay, Plasmid Preparation

    Phosphorylated AlgR and AlgR D54E bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNA fragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its location within the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect of phosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane 1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competed with the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR protein was pretreated either with water only or with AcP (500× molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-protein control (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubated with a no-protein control (lane 11), 2.5 μM AlgR (lane 12), or 2.5 μM AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for binding to fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to 9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: Phosphorylated AlgR and AlgR D54E bound to the fimU promoter. The effect of in vitro phosphorylation of AlgR on binding to an 82-bp fimU DNA fragment was compared with the binding of purified AlgR D54N or AlgR D54E using EMSA. (A) Diagram of the 82-bp fragment used in EMSAs and its location within the fimT-fimU intergenic region. (B) Increasing amounts of the phosphate donor, AcP, were added to the AlgR protein in order to determine the effect of phosphorylation on DNA binding. Wild-type AlgR protein was pretreated with AcP for 30 min prior to binding reactions. Lanes 1 to 8, fimU DNA alone (lane 1) or in the presence of AlgR without AcP (lane 2) or with increasing concentrations of AcP (lanes 3 to 8). Lanes 9 to 12, the AlgR-P–DNA complex was competed with the addition of nonradiolabeled fimU DNA. (C) Phosphorylated AlgR protein was compared with untreated AlgR for DNA binding. Purified AlgR protein was pretreated either with water only or with AcP (500× molar excess of protein) prior to binding reactions. Lanes 1 to 10, fimU DNA incubated with a no-protein control (lane 1), increasing concentrations of AlgR (lanes 2 to 5) or AlgR-P (lanes 6 to 9), or 5 mM AcP only (lane 10). Lanes 11 to 13, 5 nM pscEF DNA incubated with a no-protein control (lane 11), 2.5 μM AlgR (lane 12), or 2.5 μM AlgR-P (lane 13). (D) Purified AlgR D54N or AlgR D54E protein was tested for binding to fimU DNA. Lane 1, no-protein control; lanes 2 to 5, increasing concentrations of AlgR D54N; lanes 6 to 9, increasing concentrations of AlgR D54E (lanes 6 to 9). Open arrowheads, unbound DNA; filled arrowheads, AlgR-DNA complexes. All concentrations given in the figure are final binding reaction concentrations.

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: In Vitro, Binding Assay, Purification, Incubation

    AlgR phosphorylation was required for maximal rhamnolipid production. (A) Thin-layer chromatography. Strains PAO1 (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAO1 Δ rhlA (Δ rhlA ) were grown for 16 h in TSB plus 1% glycerol. Mono, monorhamnolipid band; Di, dirhamnolipid band. (B) Strains for which results are shown in panel A were tested for rhamnolipid production by use of the orcinol colorimetric assay and comparison with a standard curve (see Materials and Methods). Values were normalized to total-protein values. (C) The extent of hemolysis due to rhamnolipid production was measured. Cultures were grown for 24 h in a phosphate-limiting medium (tryptic soy broth supplemented with 1% glucose), and cell-free supernatants were heat treated to denature polypeptide-based hemolysins. Serial dilutions were applied to 1% horse red blood cells for 1 h at 37°C, and the percentage of hemolysis was calculated based on total and no hemolysis. Statistical analysis was performed by one-way analysis of variance. n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*), 0.01 to 0.001 (**), or

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: AlgR phosphorylation was required for maximal rhamnolipid production. (A) Thin-layer chromatography. Strains PAO1 (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAO1 Δ rhlA (Δ rhlA ) were grown for 16 h in TSB plus 1% glycerol. Mono, monorhamnolipid band; Di, dirhamnolipid band. (B) Strains for which results are shown in panel A were tested for rhamnolipid production by use of the orcinol colorimetric assay and comparison with a standard curve (see Materials and Methods). Values were normalized to total-protein values. (C) The extent of hemolysis due to rhamnolipid production was measured. Cultures were grown for 24 h in a phosphate-limiting medium (tryptic soy broth supplemented with 1% glucose), and cell-free supernatants were heat treated to denature polypeptide-based hemolysins. Serial dilutions were applied to 1% horse red blood cells for 1 h at 37°C, and the percentage of hemolysis was calculated based on total and no hemolysis. Statistical analysis was performed by one-way analysis of variance. n.s., not significant. Asterisks indicate P values of 0.05 to 0.01 (*), 0.01 to 0.001 (**), or

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: Thin Layer Chromatography, Colorimetric Assay

    Effects of different algR alleles on twitching and swarming motility. (A) Subsurface twitching motilities were analyzed at 48 h after inoculation in LB–1% agar, and the average diameters of twitching zones were measured. Strains PAO1 ( algR + ) (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54 E) were analyzed. PAO1A ( pilA :: Tc ) was used as a negative control. Statistical analysis was performed by one-way analysis of variance. n.s., not significant; ***, P

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: Effects of different algR alleles on twitching and swarming motility. (A) Subsurface twitching motilities were analyzed at 48 h after inoculation in LB–1% agar, and the average diameters of twitching zones were measured. Strains PAO1 ( algR + ) (WT), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54 E) were analyzed. PAO1A ( pilA :: Tc ) was used as a negative control. Statistical analysis was performed by one-way analysis of variance. n.s., not significant; ***, P

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: Negative Control

    AlgR D54E increased fimU transcription. (A) Diagram showing the genotypes of the following strains: PAO1 ( algR + ), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54E). The dashed regions represent the deletion of the gene indicated. (B) The strains diagramed in panel A were tested for fimU transcriptional activity. Strains contained a fimU :: lacZ transcriptional reporter in the chromosomal attB locus. β-Galactosidase activities from 21-h LB cultures grown at 37°C were assayed. Significant differences from the wild type by Student t tests are indicated (***, P

    Journal: Journal of Bacteriology

    Article Title: Pseudomonas aeruginosa AlgR Phosphorylation Modulates Rhamnolipid Production and Motility

    doi: 10.1128/JB.00726-13

    Figure Lengend Snippet: AlgR D54E increased fimU transcription. (A) Diagram showing the genotypes of the following strains: PAO1 ( algR + ), PSL317 (Δ algR ), WFPA8 ( algR D54N), PAO1 algR D54E, PAZ (Δ algZ ), and PAZ algR D54E (Δ algZ algR D54E). The dashed regions represent the deletion of the gene indicated. (B) The strains diagramed in panel A were tested for fimU transcriptional activity. Strains contained a fimU :: lacZ transcriptional reporter in the chromosomal attB locus. β-Galactosidase activities from 21-h LB cultures grown at 37°C were assayed. Significant differences from the wild type by Student t tests are indicated (***, P

    Article Snippet: To create pHERD30T- algR D54E, the codon encoding Asp 54 (GAT) in pHERD30T- algR was mutated to Glu (GAA) using primers algR-D54E-XbaI-F and algR-D54E-XbaI-R with a Phusion site-directed mutagenesis kit (New England BioLabs).

    Techniques: Activity Assay