Structured Review

New England Biolabs xba1
A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark <t>Xba1</t> restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.
Xba1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xba1/product/New England Biolabs
Average 94 stars, based on 6 article reviews
Price from $9.99 to $1999.99
xba1 - by Bioz Stars, 2019-10
94/100 stars

Images

1) Product Images from "A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers"

Article Title: A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers

Journal:

doi: 10.1073/pnas.0912294107

A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.
Figure Legend Snippet: A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.

Techniques Used: Labeling, Polymerase Chain Reaction, Generated, Liquid Chromatography, Purification, Amplification

2) Product Images from "A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers"

Article Title: A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers

Journal:

doi: 10.1073/pnas.0912294107

A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.
Figure Legend Snippet: A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.

Techniques Used: Labeling, Polymerase Chain Reaction, Generated, Liquid Chromatography, Purification, Amplification

Related Articles

Transduction:

Article Title:
Article Snippet: Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively.

Clone Assay:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: Complementation plasmids were constructed by cloning PCR fragments amplified with primers TDP166/167 (csiV ), TDP168/169 (mrcA ) or TDP172/173 (lpoA ) digested with Xma1/BamH1 (NEB) into likewise digested and Calf intestinal phosphatase (CIP,NEB)-treated pHL100. pHL100shyA was constructed using isothermal assembly of the product of primers TDP529/530 with Sma1 (NEB)-digested and CIP-treated pHL100. pHL100csiV-mCherry was constructed using isothermal assembly of Sma1-digested/CIP-treated pHL100 and the products of TPD310/311 and TDP238/239. .. The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Article Title: Longitudinal monitoring of Gaussia and Nano luciferase activities to concurrently assess ER calcium homeostasis and ER stress in vivo
Article Snippet: A three-piece In-Fusion HD Cloning reaction was performed using secNLuc (amplified from pNL1.3, adding a Kozak sequence upstream of AUG), a Gblock encoding the SSGG-spacer followed by a 2A cleavage site (IDT DNA Technologies), and GLuc-SERCaMP (amplified from pdsAAV-CMV-GLuc-SERCaMP)[ ]. .. GLuc-SERCaMP and secNLuc coding regions were removed from respective plasmids using restriction enzymes, Kpn1 and Xba1 (New England BioLabs). secNLuc was ligated within the linearized pdsAAV-CMV-GLuc-SERCaMP backbone.

Article Title:
Article Snippet: See for primer sequences. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. PCR primers were forward-5′-GGAATTCGCCACCATGTCCAATTTACTGACCGTAC-3′ (adding an EcoR1 site) and reverse-5′-ATAAGAATGCGGCCGCATCGCCATCTTCCAGCAGGC-3′ (adding a Not1 site) for Cre , and forward-5′-GCTCTAGAGCCACCATGAAGTTATGGGATGTC-3′ (adding an Xba1 site) and reverse-5′-CGGGATCCGATACATCCACACCGTTTAG-3′ (adding a BamH1 site) for GDNF .

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: In detail, the 3'-UTR portion of GFAP (1402-2600 of NM_001131020) was amplified from WT NSCs (at differentiation day 5) using AccuPrime Pfx DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and the following primer pair: 5'-GCC GTG TAA TTC TAG (Infusion sequence)-ATA GAT GCG TGC TCC AGC TC-3' (sense) and 5'-CCG CCC CGA CTC TAG (Infusion sequence)-AAA TGA AGA GCA GGG AGC ATA AAG C-3' (antisense). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA). .. Mutagenesis of the 3'-UTR of GFAP (two seed sequences of miR-326 and miR-330) was performed using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Palo Alto, CA, USA).

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: Cloning for developing other RNA probes for in situ hybridization was performed in a PBluescript II SK (−) vector using a PCR based isothermal DNA assembly method. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis.

Luciferase:

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: Paragraph title: Luciferase Reporter Assay ... The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: Paragraph title: Luciferase activity ... The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA).

Reporter Assay:

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: Paragraph title: Luciferase Reporter Assay ... The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: The effects of miRNAs were examined by measuring luciferase activity using a pGL3 control vector containing the 3'-UTR of GFAP, a pRL-Renilla reporter vector, and a Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA).

Synthesized:

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis. .. Plasmid DNA was then linearized using xho1 restriction digest and purified via phenol-chloroform and ethanol precipitation.

TA Cloning:

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: Purified PCR reactions products were cloned into the pCR4® expression vector (Life Technologies), using a TOPO® TA cloning kit (Life Technologies). .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs).

Construct:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: Complementation plasmids were constructed by cloning PCR fragments amplified with primers TDP166/167 (csiV ), TDP168/169 (mrcA ) or TDP172/173 (lpoA ) digested with Xma1/BamH1 (NEB) into likewise digested and Calf intestinal phosphatase (CIP,NEB)-treated pHL100. pHL100shyA was constructed using isothermal assembly of the product of primers TDP529/530 with Sma1 (NEB)-digested and CIP-treated pHL100. pHL100csiV-mCherry was constructed using isothermal assembly of Sma1-digested/CIP-treated pHL100 and the products of TPD310/311 and TDP238/239. .. The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For CUG-BP1 (Variant 5 NM_ 001172640), the constructs contained either one of 2 CR fragments or one of 3 separate 3’ UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: All constructs were designed, based upon clone sequence homology, so as to insert: 1) HA peptide coding sequence between the 24th and 25th base pairs (bp) of rat Mesothelin consensus coding sequence (NCBI Nucleotide ID: NM_031658.1 [ – ]), resulting in a 9-amino acid insertion between the 8th and 9th amino acids of rat Mesothelin protein sequence (NCBI Protein ID: NP_113846 [ – ]); and 2) Xba1 and Age1 restriction sites at both 5’- (before ATG start codon, NM_031658.1 [ ]) and 3’-ends (after TGA stop codon, NM_031658.1 [625]) of rat Mesothelin coding sequence. .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs).

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: To construct rRABV expressing ICAM-1, the Icam1 gene of Mus musculus encoded in pBlueScript SK+ (ATCC) was amplified by polymerase chain reaction (PCR) with VENT polymerase [New England Biolabs (NEB)] using forward primer JPM24 (5′ – TTT CGTACG ATTATGGCTTCAACCCGTGCCAAG – 3′) (BsiWi underlined) and reverse primer JPM25 (5′ – AAA TCTAGA TCAGGGAGGTGGGGCTTG – 3′) (XbaI underlined). .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1.

Amplification:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: 300–500 bp long upstream and downstream homologies were amplified using primers TDP138 /139+TDP140/ 141 (lpoA ), TDP205 /206+TDP207/ 208 (mrcA ) or TDP282 /283+TDP284/ 285 (lpoB ), purified (Qiagen PCR purification kit) and fused using SOE PCR with the respective outside primers (in bold). .. The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For CUG-BP1 (Variant 5 NM_ 001172640), the constructs contained either one of 2 CR fragments or one of 3 separate 3’ UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The constructs containing mutations at the seed sequence binding region of potential binding sites were generated using site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA).

Article Title: Longitudinal monitoring of Gaussia and Nano luciferase activities to concurrently assess ER calcium homeostasis and ER stress in vivo
Article Snippet: A three-piece In-Fusion HD Cloning reaction was performed using secNLuc (amplified from pNL1.3, adding a Kozak sequence upstream of AUG), a Gblock encoding the SSGG-spacer followed by a 2A cleavage site (IDT DNA Technologies), and GLuc-SERCaMP (amplified from pdsAAV-CMV-GLuc-SERCaMP)[ ]. .. GLuc-SERCaMP and secNLuc coding regions were removed from respective plasmids using restriction enzymes, Kpn1 and Xba1 (New England BioLabs). secNLuc was ligated within the linearized pdsAAV-CMV-GLuc-SERCaMP backbone.

Article Title:
Article Snippet: See for primer sequences. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. PCR primers were forward-5′-GGAATTCGCCACCATGTCCAATTTACTGACCGTAC-3′ (adding an EcoR1 site) and reverse-5′-ATAAGAATGCGGCCGCATCGCCATCTTCCAGCAGGC-3′ (adding a Not1 site) for Cre , and forward-5′-GCTCTAGAGCCACCATGAAGTTATGGGATGTC-3′ (adding an Xba1 site) and reverse-5′-CGGGATCCGATACATCCACACCGTTTAG-3′ (adding a BamH1 site) for GDNF .

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The fusion gene was amplified via PCR with the following sense and antisense primers: Fusion gene sense primer: 5′-CGC T|CT AGA ATG GCT ACC CCA CAC ATT AAT GCA G-3 ′ Fusion gene antisense primer: 5′-CGC C|TCGAG CGG ACC CTG GAA CAG AAC TTC CAG GTC ATC TTC TCC ACA GAG CAG C -3′ The bold regions indicate the complementary sequences for the start of the PNP gene for the sense primer and the end of the AV gene on the antisense primer. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: In detail, the 3'-UTR portion of GFAP (1402-2600 of NM_001131020) was amplified from WT NSCs (at differentiation day 5) using AccuPrime Pfx DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and the following primer pair: 5'-GCC GTG TAA TTC TAG (Infusion sequence)-ATA GAT GCG TGC TCC AGC TC-3' (sense) and 5'-CCG CCC CGA CTC TAG (Infusion sequence)-AAA TGA AGA GCA GGG AGC ATA AAG C-3' (antisense). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA). .. Mutagenesis of the 3'-UTR of GFAP (two seed sequences of miR-326 and miR-330) was performed using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Palo Alto, CA, USA).

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: To construct rRABV expressing ICAM-1, the Icam1 gene of Mus musculus encoded in pBlueScript SK+ (ATCC) was amplified by polymerase chain reaction (PCR) with VENT polymerase [New England Biolabs (NEB)] using forward primer JPM24 (5′ – TTT CGTACG ATTATGGCTTCAACCCGTGCCAAG – 3′) (BsiWi underlined) and reverse primer JPM25 (5′ – AAA TCTAGA TCAGGGAGGTGGGGCTTG – 3′) (XbaI underlined). .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1.

Activity Assay:

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: Paragraph title: Luciferase activity ... The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA).

Expressing:

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For CUG-BP1 (Variant 5 NM_ 001172640), the constructs contained either one of 2 CR fragments or one of 3 separate 3’ UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The constructs containing mutations at the seed sequence binding region of potential binding sites were generated using site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA).

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: Paragraph title: Construction of Recombinant Expression Plasmid ... A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: Purified PCR reactions products were cloned into the pCR4® expression vector (Life Technologies), using a TOPO® TA cloning kit (Life Technologies). .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs).

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: To construct rRABV expressing ICAM-1, the Icam1 gene of Mus musculus encoded in pBlueScript SK+ (ATCC) was amplified by polymerase chain reaction (PCR) with VENT polymerase [New England Biolabs (NEB)] using forward primer JPM24 (5′ – TTT CGTACG ATTATGGCTTCAACCCGTGCCAAG – 3′) (BsiWi underlined) and reverse primer JPM25 (5′ – AAA TCTAGA TCAGGGAGGTGGGGCTTG – 3′) (XbaI underlined). .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1.

Modification:

Article Title: A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers
Article Snippet: Crosslinked chromatin was digested with either 20 μL (200 U) of BstY1 or 10 μL (200 U) Xba1 (New England Biolabs) overnight at 37°C. .. Crosslinked chromatin was digested with either 20 μL (200 U) of BstY1 or 10 μL (200 U) Xba1 (New England Biolabs) overnight at 37°C.

Transformation Assay:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs). .. Ligation was performed with T4 DNA ligase.

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: Chemically-competent OneShot® TOP10 bacteria cells (Life Technologies) were used for superior transformation efficiency. .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs).

Over Expression:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442. .. The csiV deletion plasmid was constructed using isothermal assembly of the products of TDP360/361+TDP362/362 into Sma1-digested pCVD442.

Derivative Assay:

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: A second set of primers was utilized to amplify the gene of interest from cDNA derived from mouse cortex and create overhangs that were antisense to the vector overhang sequences. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis.

Hybridization:

Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
Article Snippet: Paragraph title: In Situ Hybridization ... Slit2 plasmid was linearized with Xba1 (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega).

Countercurrent Chromatography:

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: In detail, the 3'-UTR portion of GFAP (1402-2600 of NM_001131020) was amplified from WT NSCs (at differentiation day 5) using AccuPrime Pfx DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and the following primer pair: 5'-GCC GTG TAA TTC TAG (Infusion sequence)-ATA GAT GCG TGC TCC AGC TC-3' (sense) and 5'-CCG CCC CGA CTC TAG (Infusion sequence)-AAA TGA AGA GCA GGG AGC ATA AAG C-3' (antisense). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA).

Transfection:

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: Paragraph title: Generation of human SLC26A6 glycosylation mutants and transfections. ... The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech).

Article Title:
Article Snippet: Paragraph title: Lentivirus Transfection ... Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively.

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA).

Article Title: Mammalian production of an isotopically enriched outer domain of the HIV-1 gp120 glycoprotein for NMR spectroscopy
Article Snippet: Paragraph title: Restriction enzymes and transfection system ... BamH1, Xba1, Sac1, Cla1 were obtained from New England Biolabs.

Chromatography:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The antisense strand also includes a cleavage site for the protease HRV-3C, shown in italics, to allow for separation of the protein from the C-terminal His-tag using immobilized metal affinity column chromatography (IMAC). .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Ligation:

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Cell Culture:

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title:
Article Snippet: Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. Plasmids (pCDH-CRE or pCDH-GDNF) and packaging plasmids pmd-REV and pmd-1G/pmd-L were cotransfected into HEK293T cells using Lipofectamine 2000 (Cat#11668030, Invitrogen) according to manufacturer's instructions, and supernatant containing virus was harvested 48 h post-transfection.

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs). .. Plasmids were sent to Oklahoma Medical Research Foundation (Oklahoma City, OK) for sequence verification following transformation and culture of NovaBlue Gigasingles competent cells (EMD Chemicals, Gibbstown, NJ).

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: Positive (white) colonies were picked and cultured for miniprep. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis.

Hemagglutination Assay:

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: All constructs were designed, based upon clone sequence homology, so as to insert: 1) HA peptide coding sequence between the 24th and 25th base pairs (bp) of rat Mesothelin consensus coding sequence (NCBI Nucleotide ID: NM_031658.1 [ – ]), resulting in a 9-amino acid insertion between the 8th and 9th amino acids of rat Mesothelin protein sequence (NCBI Protein ID: NP_113846 [ – ]); and 2) Xba1 and Age1 restriction sites at both 5’- (before ATG start codon, NM_031658.1 [ ]) and 3’-ends (after TGA stop codon, NM_031658.1 [625]) of rat Mesothelin coding sequence. .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs).

Generated:

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For survivin (Variant 1 NM_001168.2), individual luciferase reporter constructs were generated that contained either the CR, full-length 3’ UTR, or one of 3 separate 3’UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: Identification of c-MYC SUMOylation by Mass Spectrometry
Article Snippet: Transformation was evaluated by anchorage-independent colony growth as previously described , . .. K326R mutation was generated in pMN-MYC-ires-GFP and pcDNA3-MYC background by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer's protocol using the following primers: 5'-GCCAAGAGGGTCAGGTTGGACAGTGTC-3' and 5-GACACTGTCCAACCTGACCCTCTTGGC -3'. pcDNA3-K326R was excised and inserted into the pF 5xUAS backbone using BamH1 (New England Biolabs) and Xba1 (New England Biolabs) restriction sites. .. MCF10A cells were seeded at a density of 250 000 cells per 10 cm dish and arrested in G1 using starvation media (DMEM/HAMF12 1∶1 mix supplemented with 0.05% horse serum and 10 µg/mL insulin (Sigma)) for 24 hours.

other:

Article Title: A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers
Article Snippet: The primer sequences used in Xba1 experiments were ×1, CTCACCGCATTTCTGACAGC; ×2, AAGAAGTTGGCATTTGGC; and ×3, CCAGGTAGG-TCTCCATCTCC.

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: The resulting product, containing mutated mrcA +upstream and downstream homology regions was then digested with Xba1 and ligated into likewise digested pCVD442.

Overlap Extension Polymerase Chain Reaction:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: 300–500 bp long upstream and downstream homologies were amplified using primers TDP138 /139+TDP140/ 141 (lpoA ), TDP205 /206+TDP207/ 208 (mrcA ) or TDP282 /283+TDP284/ 285 (lpoB ), purified (Qiagen PCR purification kit) and fused using SOE PCR with the respective outside primers (in bold). .. The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

DNA Sequencing:

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The Δ167+172 construct was prepared in a similar manner using the Δ172 expression construct as template (PCR primers: forward, 5′-GCCCCGCAGGCCTTGCAAGACTCCATGATCCAA-3′; and revervse, 5′-TTGGATCATGGAGTCTTGCAAGGCCTGCGGGGC-3′).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: After PCR analysis of approximately 200 obtained transformants, six clones (A, H, S, U, W, Y) were selected based upon PCR amplicon size/abundance (ranging between 300 and 2100 base pairs approximately), and analyzed by automated sequencing to confirm insert size, sequence and orientation (UAMS DNA Sequencing Core Facility). .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs).

Sequencing:

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Article Title: Longitudinal monitoring of Gaussia and Nano luciferase activities to concurrently assess ER calcium homeostasis and ER stress in vivo
Article Snippet: A three-piece In-Fusion HD Cloning reaction was performed using secNLuc (amplified from pNL1.3, adding a Kozak sequence upstream of AUG), a Gblock encoding the SSGG-spacer followed by a 2A cleavage site (IDT DNA Technologies), and GLuc-SERCaMP (amplified from pdsAAV-CMV-GLuc-SERCaMP)[ ]. .. GLuc-SERCaMP and secNLuc coding regions were removed from respective plasmids using restriction enzymes, Kpn1 and Xba1 (New England BioLabs). secNLuc was ligated within the linearized pdsAAV-CMV-GLuc-SERCaMP backbone.

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs). .. Ligation was performed with T4 DNA ligase.

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: In detail, the 3'-UTR portion of GFAP (1402-2600 of NM_001131020) was amplified from WT NSCs (at differentiation day 5) using AccuPrime Pfx DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and the following primer pair: 5'-GCC GTG TAA TTC TAG (Infusion sequence)-ATA GAT GCG TGC TCC AGC TC-3' (sense) and 5'-CCG CCC CGA CTC TAG (Infusion sequence)-AAA TGA AGA GCA GGG AGC ATA AAG C-3' (antisense). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA).

Article Title: DNA Display III. Solid-Phase Organic Synthesis on Unprotected DNADNA Display II. Genetic Manipulation of Combinatorial Chemistry Libraries for Small-Molecule EvolutionDNA Display I. Sequence-Encoded Routing of DNA PopulationsHarnessing DNA-Based Technology for Drug DiscoveryTranslating DNA into Synthetic Molecules
Article Snippet: Xba1 was purchased from New England Biolabs (Beverly, Massachusetts, United States). .. Xba1 was purchased from New England Biolabs (Beverly, Massachusetts, United States).

Recombinant:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: Paragraph title: Construction of Recombinant Expression Plasmid ... A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: Paragraph title: Recombinant RABV-based vaccine construction and recovery ... The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1.

Immunofluorescence:

Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
Article Snippet: Slit2 plasmid was linearized with Xba1 (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega). .. Slit2 plasmid was linearized with Xba1 (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega).

Nucleic Acid Electrophoresis:

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: Positive (white) colonies were picked and cultured for miniprep. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis. .. Properly inserted colonies were then amplified by 50 ml culture and subsequent midiprep using a Hispeed plasmid Midi kit (Qiagen).

Mutagenesis:

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA). .. Mutagenesis of the 3'-UTR of GFAP (two seed sequences of miR-326 and miR-330) was performed using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Palo Alto, CA, USA).

Article Title: Identification of c-MYC SUMOylation by Mass Spectrometry
Article Snippet: Transformation was evaluated by anchorage-independent colony growth as previously described , . .. K326R mutation was generated in pMN-MYC-ires-GFP and pcDNA3-MYC background by site-directed mutagenesis using the QuikChange Site-Directed Mutagenesis Kit (Agilent Technologies) according to manufacturer's protocol using the following primers: 5'-GCCAAGAGGGTCAGGTTGGACAGTGTC-3' and 5-GACACTGTCCAACCTGACCCTCTTGGC -3'. pcDNA3-K326R was excised and inserted into the pF 5xUAS backbone using BamH1 (New England Biolabs) and Xba1 (New England Biolabs) restriction sites. .. MCF10A cells were seeded at a density of 250 000 cells per 10 cm dish and arrested in G1 using starvation media (DMEM/HAMF12 1∶1 mix supplemented with 0.05% horse serum and 10 µg/mL insulin (Sigma)) for 24 hours.

Flow Cytometry:

Article Title: DNA Display III. Solid-Phase Organic Synthesis on Unprotected DNADNA Display II. Genetic Manipulation of Combinatorial Chemistry Libraries for Small-Molecule EvolutionDNA Display I. Sequence-Encoded Routing of DNA PopulationsHarnessing DNA-Based Technology for Drug DiscoveryTranslating DNA into Synthetic Molecules
Article Snippet: Nuclease P1 (#27–0852-01), DEAE Sepharose Fast Flow (#17–0709-01), and Medium Grade G-25 Sephadex (#17–0033-01) were purchased from Pharmacia-LKB Technology (Uppsala, Sweden). .. Xba1 was purchased from New England Biolabs (Beverly, Massachusetts, United States).

Labeling:

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis. .. Plasmid DNA was then linearized using xho1 restriction digest and purified via phenol-chloroform and ethanol precipitation.

Purification:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: 300–500 bp long upstream and downstream homologies were amplified using primers TDP138 /139+TDP140/ 141 (lpoA ), TDP205 /206+TDP207/ 208 (mrcA ) or TDP282 /283+TDP284/ 285 (lpoB ), purified (Qiagen PCR purification kit) and fused using SOE PCR with the respective outside primers (in bold). .. The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

Article Title: Longitudinal monitoring of Gaussia and Nano luciferase activities to concurrently assess ER calcium homeostasis and ER stress in vivo
Article Snippet: PCR products were gel purified and the In-Fusion reaction contained 100 fmol of each fragment and 50 fmol of the backbone. pdsAAV-CMV-secNLuc was created using pdsAAV-CMV-GLuc-SERCaMP plasmid and pNL1.3 (Promega) as templates. .. GLuc-SERCaMP and secNLuc coding regions were removed from respective plasmids using restriction enzymes, Kpn1 and Xba1 (New England BioLabs). secNLuc was ligated within the linearized pdsAAV-CMV-GLuc-SERCaMP backbone.

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The PCR products were again purified using a QIAquick PCR purification kit, run on an agarose gel, and extracted with a QIAquick gel extraction kit from Qiagen. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs). .. Ligation was performed with T4 DNA ligase.

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis. .. Properly inserted colonies were then amplified by 50 ml culture and subsequent midiprep using a Hispeed plasmid Midi kit (Qiagen).

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: All constructs were designed, based upon clone sequence homology, so as to insert: 1) HA peptide coding sequence between the 24th and 25th base pairs (bp) of rat Mesothelin consensus coding sequence (NCBI Nucleotide ID: NM_031658.1 [ – ]), resulting in a 9-amino acid insertion between the 8th and 9th amino acids of rat Mesothelin protein sequence (NCBI Protein ID: NP_113846 [ – ]); and 2) Xba1 and Age1 restriction sites at both 5’- (before ATG start codon, NM_031658.1 [ ]) and 3’-ends (after TGA stop codon, NM_031658.1 [625]) of rat Mesothelin coding sequence. .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs). .. Obtained transformants were analyzed by PCR and automated sequencing.

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1. .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1.

Protein Purification:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442. .. The csiV deletion plasmid was constructed using isothermal assembly of the products of TDP360/361+TDP362/362 into Sma1-digested pCVD442.

Polymerase Chain Reaction:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: 300–500 bp long upstream and downstream homologies were amplified using primers TDP138 /139+TDP140/ 141 (lpoA ), TDP205 /206+TDP207/ 208 (mrcA ) or TDP282 /283+TDP284/ 285 (lpoB ), purified (Qiagen PCR purification kit) and fused using SOE PCR with the respective outside primers (in bold). .. The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For CUG-BP1 (Variant 5 NM_ 001172640), the constructs contained either one of 2 CR fragments or one of 3 separate 3’ UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The constructs containing mutations at the seed sequence binding region of potential binding sites were generated using site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA).

Article Title: Longitudinal monitoring of Gaussia and Nano luciferase activities to concurrently assess ER calcium homeostasis and ER stress in vivo
Article Snippet: PCR products were gel purified and the In-Fusion reaction contained 100 fmol of each fragment and 50 fmol of the backbone. pdsAAV-CMV-secNLuc was created using pdsAAV-CMV-GLuc-SERCaMP plasmid and pNL1.3 (Promega) as templates. .. GLuc-SERCaMP and secNLuc coding regions were removed from respective plasmids using restriction enzymes, Kpn1 and Xba1 (New England BioLabs). secNLuc was ligated within the linearized pdsAAV-CMV-GLuc-SERCaMP backbone.

Article Title:
Article Snippet: See for primer sequences. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. PCR primers were forward-5′-GGAATTCGCCACCATGTCCAATTTACTGACCGTAC-3′ (adding an EcoR1 site) and reverse-5′-ATAAGAATGCGGCCGCATCGCCATCTTCCAGCAGGC-3′ (adding a Not1 site) for Cre , and forward-5′-GCTCTAGAGCCACCATGAAGTTATGGGATGTC-3′ (adding an Xba1 site) and reverse-5′-CGGGATCCGATACATCCACACCGTTTAG-3′ (adding a BamH1 site) for GDNF .

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The PCR products were again purified using a QIAquick PCR purification kit, run on an agarose gel, and extracted with a QIAquick gel extraction kit from Qiagen. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: Cloning for developing other RNA probes for in situ hybridization was performed in a PBluescript II SK (−) vector using a PCR based isothermal DNA assembly method. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis.

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: All constructs were designed, based upon clone sequence homology, so as to insert: 1) HA peptide coding sequence between the 24th and 25th base pairs (bp) of rat Mesothelin consensus coding sequence (NCBI Nucleotide ID: NM_031658.1 [ – ]), resulting in a 9-amino acid insertion between the 8th and 9th amino acids of rat Mesothelin protein sequence (NCBI Protein ID: NP_113846 [ – ]); and 2) Xba1 and Age1 restriction sites at both 5’- (before ATG start codon, NM_031658.1 [ ]) and 3’-ends (after TGA stop codon, NM_031658.1 [625]) of rat Mesothelin coding sequence. .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs). .. Obtained transformants were analyzed by PCR and automated sequencing.

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: To construct rRABV expressing ICAM-1, the Icam1 gene of Mus musculus encoded in pBlueScript SK+ (ATCC) was amplified by polymerase chain reaction (PCR) with VENT polymerase [New England Biolabs (NEB)] using forward primer JPM24 (5′ – TTT CGTACG ATTATGGCTTCAACCCGTGCCAAG – 3′) (BsiWi underlined) and reverse primer JPM25 (5′ – AAA TCTAGA TCAGGGAGGTGGGGCTTG – 3′) (XbaI underlined). .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1. .. Infectious virus was recovered following standard methods to recover infectious RABV-based vaccines from cDNA , .

Affinity Column:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The antisense strand also includes a cleavage site for the protease HRV-3C, shown in italics, to allow for separation of the protein from the C-terminal His-tag using immobilized metal affinity column chromatography (IMAC). .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Chloramphenicol Acetyltransferase Assay:

Article Title:
Article Snippet: See for primer sequences. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; CatR050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. PCR primers were forward-5′-GGAATTCGCCACCATGTCCAATTTACTGACCGTAC-3′ (adding an EcoR1 site) and reverse-5′-ATAAGAATGCGGCCGCATCGCCATCTTCCAGCAGGC-3′ (adding a Not1 site) for Cre , and forward-5′-GCTCTAGAGCCACCATGAAGTTATGGGATGTC-3′ (adding an Xba1 site) and reverse-5′-CGGGATCCGATACATCCACACCGTTTAG-3′ (adding a BamH1 site) for GDNF .

Mouse Assay:

Article Title:
Article Snippet: See for primer sequences. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. PCR primers were forward-5′-GGAATTCGCCACCATGTCCAATTTACTGACCGTAC-3′ (adding an EcoR1 site) and reverse-5′-ATAAGAATGCGGCCGCATCGCCATCTTCCAGCAGGC-3′ (adding a Not1 site) for Cre , and forward-5′-GCTCTAGAGCCACCATGAAGTTATGGGATGTC-3′ (adding an Xba1 site) and reverse-5′-CGGGATCCGATACATCCACACCGTTTAG-3′ (adding a BamH1 site) for GDNF .

In Situ Hybridization:

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: Cloning for developing other RNA probes for in situ hybridization was performed in a PBluescript II SK (−) vector using a PCR based isothermal DNA assembly method. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis.

Plasmid Preparation:

Article Title: A Novel Peptidoglycan Binding Protein Crucial for PBP1A-Mediated Cell Wall Biogenesis in Vibrio cholerae
Article Snippet: Paragraph title: Plasmid construction ... The resulting product was digested with Xba1 (NEB) and ligated into likewise digested pCVD442.

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech). .. The wt-hA6 construct was then used as the template for generation of the Δ167 (PCR primers: forward, 5′-GGCCCCGCAGGCCTTGCAAGACTCCATGATCAATG-3′; and reverse, 5′-CATTGATCATGGAGTCTTGCAAGGCCTGCGGGGCC-3′) and Δ172 (PCR primers: forward, 5′-CTTGAACGACTCCATGATCCAAGAGACAGCCAGAGATGCTG-3′; and reverse, 5′-CAGCATCTCTGGCTGTCTCTTGGATCATGGAGTCGTTCAAG-3′) glycosylation mutants with a Quick Change Lightning Site-Directed Mutagenesis kit (Agilent Technologies).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For CUG-BP1 (Variant 5 NM_ 001172640), the constructs contained either one of 2 CR fragments or one of 3 separate 3’ UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI). .. The constructs containing mutations at the seed sequence binding region of potential binding sites were generated using site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA).

Article Title: Longitudinal monitoring of Gaussia and Nano luciferase activities to concurrently assess ER calcium homeostasis and ER stress in vivo
Article Snippet: Paragraph title: Plasmid construction ... GLuc-SERCaMP and secNLuc coding regions were removed from respective plasmids using restriction enzymes, Kpn1 and Xba1 (New England BioLabs). secNLuc was ligated within the linearized pdsAAV-CMV-GLuc-SERCaMP backbone.

Article Title:
Article Snippet: See for primer sequences. .. Full-length cDNA sequences encoding Cre recombinase and mouse GDNF were amplified by PCR (PrimeSTAR® GXL DNA Polymerase; Cat#R050A, Takara, Dalian, China) using genomic DNA from Vasa-Cre mice (Stock No:006954; Jackson Laboratories) as a template, and were cloned into the lentivirus vector pCDH-EF1-MCS-T2A-Puro (System Biosciences, Cat# CD500) using EcoR1 (Cat#R0101V, NEB, Beverly, MA) and Not1 (Cat#R0189V, NEB) or Xba1 (Cat# R0145V, NEB) and Bamh1 (Cat# R0136V, NEB) restriction sites, respectively. .. PCR primers were forward-5′-GGAATTCGCCACCATGTCCAATTTACTGACCGTAC-3′ (adding an EcoR1 site) and reverse-5′-ATAAGAATGCGGCCGCATCGCCATCTTCCAGCAGGC-3′ (adding a Not1 site) for Cre , and forward-5′-GCTCTAGAGCCACCATGAAGTTATGGGATGTC-3′ (adding an Xba1 site) and reverse-5′-CGGGATCCGATACATCCACACCGTTTAG-3′ (adding a BamH1 site) for GDNF .

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The PCR products were again purified using a QIAquick PCR purification kit, run on an agarose gel, and extracted with a QIAquick gel extraction kit from Qiagen. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs). .. Ligation was performed with T4 DNA ligase.

Article Title: PINK1 Deficiency Decreases Expression Levels of mir-326, mir-330, and mir-3099 during Brain Development and Neural Stem Cell Differentiation
Article Snippet: In detail, the 3'-UTR portion of GFAP (1402-2600 of NM_001131020) was amplified from WT NSCs (at differentiation day 5) using AccuPrime Pfx DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and the following primer pair: 5'-GCC GTG TAA TTC TAG (Infusion sequence)-ATA GAT GCG TGC TCC AGC TC-3' (sense) and 5'-CCG CCC CGA CTC TAG (Infusion sequence)-AAA TGA AGA GCA GGG AGC ATA AAG C-3' (antisense). .. The amplified product, linearized with Xba1 (New England Biolabs, Beverly, MA, USA), was then inserted into the pGL3-control vector using an Infusion cloning kit (Clontech, Palo Alto, CA, USA). .. Mutagenesis of the 3'-UTR of GFAP (two seed sequences of miR-326 and miR-330) was performed using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies, Palo Alto, CA, USA).

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: Assembly was achieved using Gibson Assembly master mix (New England Biolabs) and the resulting vector was used to transform NEB-5 (New England Biolabs) competent cells. .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis.

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: To construct rRABV expressing ICAM-1, the Icam1 gene of Mus musculus encoded in pBlueScript SK+ (ATCC) was amplified by polymerase chain reaction (PCR) with VENT polymerase [New England Biolabs (NEB)] using forward primer JPM24 (5′ – TTT CGTACG ATTATGGCTTCAACCCGTGCCAAG – 3′) (BsiWi underlined) and reverse primer JPM25 (5′ – AAA TCTAGA TCAGGGAGGTGGGGCTTG – 3′) (XbaI underlined). .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1. .. Infectious virus was recovered following standard methods to recover infectious RABV-based vaccines from cDNA , .

Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
Article Snippet: EphA4, Npn-1, EphB1 plasmids were linearized with SacI (New England Biolabs) for antisense RNA synthesis by T3 polymerase (Promega). ephrinB2 plasmid was linearized with BamH1 (New England Biolabs) for antisense RNA synthesis by sp6 polymerase (Promega). .. Slit2 plasmid was linearized with Xba1 (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega). .. For in situ hybridization, brains were dissected and fixed by immersion overnight at 4°C in a solution containing 4% paraformaldehyde (PFA) in PBS.

In Vitro:

Article Title: Liver myofibroblasts of murine origins express mesothelin: Identification of novel rat mesothelin splice variants*
Article Snippet: All constructs were designed, based upon clone sequence homology, so as to insert: 1) HA peptide coding sequence between the 24th and 25th base pairs (bp) of rat Mesothelin consensus coding sequence (NCBI Nucleotide ID: NM_031658.1 [ – ]), resulting in a 9-amino acid insertion between the 8th and 9th amino acids of rat Mesothelin protein sequence (NCBI Protein ID: NP_113846 [ – ]); and 2) Xba1 and Age1 restriction sites at both 5’- (before ATG start codon, NM_031658.1 [ ]) and 3’-ends (after TGA stop codon, NM_031658.1 [625]) of rat Mesothelin coding sequence. .. All PCR amplicons were purified and used for: 1) adaptor sequences addition by PCR amplification, followed by in vitro translation reactions using the cell-free PURExpress® In Vitro Protein Synthesis Kit (New England BioLabs); and 2) directional cloning into the pcDNA™ 3.3 TOPO® TA vector using a Gibson Assembly kit (New England BioLabs), and Xba1 and Age1 restriction enzymes (New England BioLabs). .. Obtained transformants were analyzed by PCR and automated sequencing.

Positron Emission Tomography:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The PCR products were again purified using a QIAquick PCR purification kit, run on an agarose gel, and extracted with a QIAquick gel extraction kit from Qiagen. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs). .. Ligation was performed with T4 DNA ligase.

Agarose Gel Electrophoresis:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The PCR products were again purified using a QIAquick PCR purification kit, run on an agarose gel, and extracted with a QIAquick gel extraction kit from Qiagen. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

In Situ:

Article Title: Transient Neuronal Populations Are Required to Guide Callosal Axons: A Role for Semaphorin 3CNeurons Help Bridge the Brain's Communication Gap
Article Snippet: Paragraph title: In Situ Hybridization ... Slit2 plasmid was linearized with Xba1 (New England Biolabs) for antisense RNA synthesis by T7 polymerase (Promega).

Ethanol Precipitation:

Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
Article Snippet: All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis. .. Properly inserted colonies were then amplified by 50 ml culture and subsequent midiprep using a Hispeed plasmid Midi kit (Qiagen).

Produced:

Article Title: ICAM-1-Based Rabies Virus Vaccine Shows Increased Infection and Activation of Primary Murine B Cells In Vitro and Enhanced Antibody Titers In-Vivo
Article Snippet: The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1. .. The PCR product was digested with BsiW1 (NEB) and Xba1 (NEB) and ligated into the plasmid prRABV that had previously been digested with BsiW1 and Nhe1 (NEB), resulting in a plasmid named prRABV-ICAM-1.

CTG Assay:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The fusion gene was amplified via PCR with the following sense and antisense primers: Fusion gene sense primer: 5′-CGC T|CT AGA ATG GCT ACC CCA CAC ATT AAT GCA G-3 ′ Fusion gene antisense primer: 5′-CGC C|TCGAG CGG ACC CTG GAA CAG AAC TTC CAG GTC ATC TTC TCC ACA GAG CAG C -3′ The bold regions indicate the complementary sequences for the start of the PNP gene for the sense primer and the end of the AV gene on the antisense primer. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Gel Extraction:

Article Title: Purine Nucleoside Phosphorylase Targeted by Annexin V to Breast Cancer Vasculature for Enzyme Prodrug Therapy
Article Snippet: The PCR products were again purified using a QIAquick PCR purification kit, run on an agarose gel, and extracted with a QIAquick gel extraction kit from Qiagen. .. A restriction enzyme digest was performed on the purified PNP-AV gene and pET 303/CT-His vector (Invitrogen, Grand Island, NY) with Xho1 and Xba1 (New England Biolabs).

Variant Assay:

Article Title: N-glycosylation critically regulates function of oxalate transporter SLC26A6
Article Snippet: A commercially available cDNA clone (Origene) encoding the entire transcript variant 1 isoform of human SLC26A6 was used as the template for the generation of the glycosylation expression constructs. .. The wild-type expression construct (wt-hA6) was prepared by restriction digest of the SLC26A6 coding sequence from the original cloning vector with BamH1 and Xba1 (New England Biolabs) and subsequent directional ligation of the resultant restriction fragment into the retroviral mammalian expression vector pLNCX 2 (Clontech).

Article Title: Overexpression of miR-214-3p in Esophageal Squamous Cancer Cells Enhances Sensitivity to Cisplatin by Targeting Survivin Directly and Indirectly Through CUG-BP1
Article Snippet: For CUG-BP1 (Variant 5 NM_ 001172640), the constructs contained either one of 2 CR fragments or one of 3 separate 3’ UTR fragments. .. The inserts were amplified by PCR and individual fragments were subcloned into a NheI and SalI or SacI and Xba1 (New England Bio Labs, Ipswich, MA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    New England Biolabs xba1
    A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark <t>Xba1</t> restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.
    Xba1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba1/product/New England Biolabs
    Average 94 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    xba1 - by Bioz Stars, 2019-10
    94/100 stars
      Buy from Supplier

    85
    New England Biolabs xba1 restriction enzyme
    A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark <t>Xba1</t> restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.
    Xba1 Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba1 restriction enzyme/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xba1 restriction enzyme - by Bioz Stars, 2019-10
    85/100 stars
      Buy from Supplier

    Image Search Results


    A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.

    Journal:

    Article Title: A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers

    doi: 10.1073/pnas.0912294107

    Figure Lengend Snippet: A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC locus with gray rectangles as exons, thick horizontal lines as introns, and thin horizontal lines as untranscribed DNA. The open rectangles labeled WRE are the 5′ and 3′ Wnt/β-catenin responsive enhancers ( , ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.

    Article Snippet: Crosslinked chromatin was digested with either 20 μL (200 U) of BstY1 or 10 μL (200 U) Xba1 (New England Biolabs) overnight at 37°C.

    Techniques: Labeling, Polymerase Chain Reaction, Generated, Liquid Chromatography, Purification, Amplification