xba1  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    New England Biolabs xba1
    Xba1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba1/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xba1 - by Bioz Stars, 2020-05
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Discovery of a novel T. gondii conoid-associated protein important for parasite resistance to reactive nitrogen intermediates
    Article Snippet: .. Flank 1 PCR product was digested with Not1 and Xba1 and cloned into pMini-GFP.ht digested with the same enzymes using T4 ligase (New England Biolabs). .. The resulting plasmid was digested with Acc651 and XhoI and Flank 2 was cloned in using In-Fusion® PCR cloning system (Clontech) according to the manufacturer’s instructions.

    Transfection:

    Article Title: Mammalian production of an isotopically enriched outer domain of the HIV-1 gp120 glycoprotein for NMR spectroscopy
    Article Snippet: .. Restriction enzymes and transfection system BamH1, Xba1, Sac1, Cla1 were obtained from New England Biolabs. .. Cre recombinase was obtained from Novagen (Madison, WI).

    Amplification:

    Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4
    Article Snippet: .. PCR amplified individual insert fragments were sub-cloned into a SacI and Xba1 or SacI and DraI (New England Bio Labs, Ipswich, MA, USA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI, USA). .. The PAK4 constructs containing mutations at the sequence of binding region of potential binding sites were generated using a site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

    In Vitro:

    Article Title: Regulation of Vascular Endothelial Growth Factor (VEGF) Splicing from Pro-angiogenic to Anti-angiogenic Isoforms
    Article Snippet: .. Assembly of the MS2-MBP System 1 μg of the VEGF-MS2 plasmid was linearized with Xba1 and in vitro transcribed with T7 RNA polymerase (NEB) in 0.5 mm rNTP (Ambion), 40 mm Tris-HCl, 6 mm MgCl2 , 10 mm dithiothreitol, 2 mm spermidine at 40 °C for 1 h to make VEGF-MS2 RNA. .. A 100-fold molar excess of MS2-MBP fusion protein and VEGF-MS2 RNA were incubated in a buffer containing 20 mm HEPES, pH 7.9 and 60 mm NaCl on ice for 30 min. 75 mg of HEK293 nuclear extract were added to the MS2-MBP fusion protein/VEGF-RNA mix in 0.5 mm ATP, 6.4 mm MgCl2 , 20 mm creatine phosphate for 1 h at 30 °C.

    Nucleic Acid Electrophoresis:

    Article Title: Cortical parvalbumin and somatostatin GABA neurons express distinct endogenous modulators of nicotinic acetylcholine receptors
    Article Snippet: .. All miniprep DNA was subjected to restriction digest using xba1 and xho1 enzymes (New England Biolabs) and examined for insert by gel electrophoresis. .. Properly inserted colonies were then amplified by 50 ml culture and subsequent midiprep using a Hispeed plasmid Midi kit (Qiagen).

    Polymerase Chain Reaction:

    Article Title: Discovery of a novel T. gondii conoid-associated protein important for parasite resistance to reactive nitrogen intermediates
    Article Snippet: .. Flank 1 PCR product was digested with Not1 and Xba1 and cloned into pMini-GFP.ht digested with the same enzymes using T4 ligase (New England Biolabs). .. The resulting plasmid was digested with Acc651 and XhoI and Flank 2 was cloned in using In-Fusion® PCR cloning system (Clontech) according to the manufacturer’s instructions.

    Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4
    Article Snippet: .. PCR amplified individual insert fragments were sub-cloned into a SacI and Xba1 or SacI and DraI (New England Bio Labs, Ipswich, MA, USA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI, USA). .. The PAK4 constructs containing mutations at the sequence of binding region of potential binding sites were generated using a site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

    Expressing:

    Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4
    Article Snippet: .. PCR amplified individual insert fragments were sub-cloned into a SacI and Xba1 or SacI and DraI (New England Bio Labs, Ipswich, MA, USA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI, USA). .. The PAK4 constructs containing mutations at the sequence of binding region of potential binding sites were generated using a site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

    Modification:

    Article Title: Indolamine 2,3-dioxygenase expression by monocytes and dendritic cell populations in hepatitis C patients
    Article Snippet: .. A plasmid containing the cell culture-adapted HCV cDNA, JFH-1T (pJFH-1T ), modified with coding mutations in E2, p7 and NS2 , was kindly provided by Dr Rodney Russell (University of Newfoundland). pJFH-1T was linearized with Xba1, and the end was blunted using Mung Bean DNA nuclease (New England Biolabs, Pickering, ON, Canada). pJFH-1 was treated with Xba1 twice, followed by a single digestion with mung bean DNA nuclease (New England Biolabs). .. The linearized DNA was used for in-vitro transcription with the MEGAscript T7 kit (Ambion), according to the manufacturer's instructions.

    Plasmid Preparation:

    Article Title: Regulation of dynein-driven microtubule sliding by the axonemal protein kinase CK1 in Chlamydomonas flagella
    Article Snippet: .. The insert was excised with Xba1 and HindIII and subcloned into the pMAL-c (New England Biolabs, Inc.) to obtain plasmid pAGCK1-MBP. .. The expression construct was transformed into strain BL21 (DE3) pLysS cells (Agilent Technologies), and protein expression was induced as described above.

    Article Title: Indolamine 2,3-dioxygenase expression by monocytes and dendritic cell populations in hepatitis C patients
    Article Snippet: .. A plasmid containing the cell culture-adapted HCV cDNA, JFH-1T (pJFH-1T ), modified with coding mutations in E2, p7 and NS2 , was kindly provided by Dr Rodney Russell (University of Newfoundland). pJFH-1T was linearized with Xba1, and the end was blunted using Mung Bean DNA nuclease (New England Biolabs, Pickering, ON, Canada). pJFH-1 was treated with Xba1 twice, followed by a single digestion with mung bean DNA nuclease (New England Biolabs). .. The linearized DNA was used for in-vitro transcription with the MEGAscript T7 kit (Ambion), according to the manufacturer's instructions.

    Article Title: Regulation of Vascular Endothelial Growth Factor (VEGF) Splicing from Pro-angiogenic to Anti-angiogenic Isoforms
    Article Snippet: .. Assembly of the MS2-MBP System 1 μg of the VEGF-MS2 plasmid was linearized with Xba1 and in vitro transcribed with T7 RNA polymerase (NEB) in 0.5 mm rNTP (Ambion), 40 mm Tris-HCl, 6 mm MgCl2 , 10 mm dithiothreitol, 2 mm spermidine at 40 °C for 1 h to make VEGF-MS2 RNA. .. A 100-fold molar excess of MS2-MBP fusion protein and VEGF-MS2 RNA were incubated in a buffer containing 20 mm HEPES, pH 7.9 and 60 mm NaCl on ice for 30 min. 75 mg of HEK293 nuclear extract were added to the MS2-MBP fusion protein/VEGF-RNA mix in 0.5 mm ATP, 6.4 mm MgCl2 , 20 mm creatine phosphate for 1 h at 30 °C.

    Article Title: MiR-199a-3p decreases esophageal cancer cell proliferation by targeting p21 activated kinase 4
    Article Snippet: .. PCR amplified individual insert fragments were sub-cloned into a SacI and Xba1 or SacI and DraI (New England Bio Labs, Ipswich, MA, USA) digested pmirGLO Dual-Luciferase miRNA target expression vector (Promega, Madison, WI, USA). .. The PAK4 constructs containing mutations at the sequence of binding region of potential binding sites were generated using a site directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs xba1
    A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark <t>Xba1</t> restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.
    Xba1, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba1/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xba1 - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    85
    New England Biolabs kb xba1 fragment
    A) Schematic representation of the hprt genomic locus and targeting vector with α-MHC-LacZ insert. The position of a Southern blot probe (probe b) containing LacZ specific sequences relative to <t>Xba1</t> (x) and EcoRV (e) restriction enzyme cut sites is shown. B) Resistance to growth in HAT and sensitivity to G418 and 6-TG was restored in correctly targeted α MHC-LacZ ES cell lines. C) Southern blot analysis of genomic DNA from non-targeted F3 ES cells as well as from six targeted HAT-resistant ES cell lines generated from F3 cells is shown. The targeted allele is identified using probe b as a 7.0 kb EcoRV fragment. α MHC-LacZ ES cell line #4 was used to generate embryos shown in D. D) E8.5 embryos derived from α-MHC-LacZ targeted ES cells by tetraploid aggregation. β-galactosidase expression was identified by x-gal staining (blue). Expression was restricted to the developing heart (h).
    Kb Xba1 Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kb xba1 fragment/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kb xba1 fragment - by Bioz Stars, 2020-05
    85/100 stars
      Buy from Supplier

    88
    New England Biolabs xba1 site
    A) Schematic representation of the hprt genomic locus and targeting vector with α-MHC-LacZ insert. The position of a Southern blot probe (probe b) containing LacZ specific sequences relative to <t>Xba1</t> (x) and EcoRV (e) restriction enzyme cut sites is shown. B) Resistance to growth in HAT and sensitivity to G418 and 6-TG was restored in correctly targeted α MHC-LacZ ES cell lines. C) Southern blot analysis of genomic DNA from non-targeted F3 ES cells as well as from six targeted HAT-resistant ES cell lines generated from F3 cells is shown. The targeted allele is identified using probe b as a 7.0 kb EcoRV fragment. α MHC-LacZ ES cell line #4 was used to generate embryos shown in D. D) E8.5 embryos derived from α-MHC-LacZ targeted ES cells by tetraploid aggregation. β-galactosidase expression was identified by x-gal staining (blue). Expression was restricted to the developing heart (h).
    Xba1 Site, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba1 site/product/New England Biolabs
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xba1 site - by Bioz Stars, 2020-05
    88/100 stars
      Buy from Supplier

    Image Search Results


    A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: A ?-catenin/TCF-coordinated chromatin loop at MYC integrates 5? and 3? Wnt responsive enhancers

    doi: 10.1073/pnas.0912294107

    Figure Lengend Snippet: A chromatin loop containing the 5′ and 3′ Wnt/β-catenin responsive enhancers is present at MYC in HCT116 cells. ( A ) Diagram of the human MYC ). An arrow above E1 marks the major MYC transcription start site. BstY1 restriction endonuclease sites are depicted by triangles and stunted arrows mark the positions of oligonucleotides used in the 3C assays (labeled B1-B8). ( B ) Analysis by 3C of the MYC locus in HCT116 cells. A PCR product was generated with B4 and B8 only (labeled MYC 5′3′). LC is a loading control and S is a DNA standard. ( C ) A diagram of the MYC locus as in A except that triangles mark Xba1 restriction endonuclease sites and stunted arrows mark the position of ×1, ×2, and ×3 oligonucleotides. ( D ) Same as B except that Xba1 was used in 3C reactions and purified DNA was amplified with ×1 and ×3.

    Article Snippet: The primer sequences used in Xba1 experiments were ×1, CTCACCGCATTTCTGACAGC; ×2, AAGAAGTTGGCATTTGGC; and ×3, CCAGGTAGG-TCTCCATCTCC.

    Techniques: Labeling, Polymerase Chain Reaction, Generated, Purification, Amplification

    A) Schematic representation of the hprt genomic locus and targeting vector with α-MHC-LacZ insert. The position of a Southern blot probe (probe b) containing LacZ specific sequences relative to Xba1 (x) and EcoRV (e) restriction enzyme cut sites is shown. B) Resistance to growth in HAT and sensitivity to G418 and 6-TG was restored in correctly targeted α MHC-LacZ ES cell lines. C) Southern blot analysis of genomic DNA from non-targeted F3 ES cells as well as from six targeted HAT-resistant ES cell lines generated from F3 cells is shown. The targeted allele is identified using probe b as a 7.0 kb EcoRV fragment. α MHC-LacZ ES cell line #4 was used to generate embryos shown in D. D) E8.5 embryos derived from α-MHC-LacZ targeted ES cells by tetraploid aggregation. β-galactosidase expression was identified by x-gal staining (blue). Expression was restricted to the developing heart (h).

    Journal: BMC Biotechnology

    Article Title: Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    doi: 10.1186/1472-6750-1-12

    Figure Lengend Snippet: A) Schematic representation of the hprt genomic locus and targeting vector with α-MHC-LacZ insert. The position of a Southern blot probe (probe b) containing LacZ specific sequences relative to Xba1 (x) and EcoRV (e) restriction enzyme cut sites is shown. B) Resistance to growth in HAT and sensitivity to G418 and 6-TG was restored in correctly targeted α MHC-LacZ ES cell lines. C) Southern blot analysis of genomic DNA from non-targeted F3 ES cells as well as from six targeted HAT-resistant ES cell lines generated from F3 cells is shown. The targeted allele is identified using probe b as a 7.0 kb EcoRV fragment. α MHC-LacZ ES cell line #4 was used to generate embryos shown in D. D) E8.5 embryos derived from α-MHC-LacZ targeted ES cells by tetraploid aggregation. β-galactosidase expression was identified by x-gal staining (blue). Expression was restricted to the developing heart (h).

    Article Snippet: pMP8NEBΔLacZ The plasmid pMP8NEBΔLacZ was generated by ligating an 8 kb Xba1 fragment from pMP8 into the Xba1 site of pNEB193 (New England Biolabs) from which LacZ sequences had been removed as a NarI/EcoRI fragment [ ].

    Techniques: Plasmid Preparation, Southern Blot, HAT Assay, Generated, Derivative Assay, Expressing, Staining

    A) Schematic representation of the hprt genomic locus and targeting vector with α-MHC-LacZ insert. The position of a Southern blot probe (probe b) containing LacZ specific sequences relative to Xba1 (x) and EcoRV (e) restriction enzyme cut sites is shown. B) Resistance to growth in HAT and sensitivity to G418 and 6-TG was restored in correctly targeted α MHC-LacZ ES cell lines. C) Southern blot analysis of genomic DNA from non-targeted F3 ES cells as well as from six targeted HAT-resistant ES cell lines generated from F3 cells is shown. The targeted allele is identified using probe b as a 7.0 kb EcoRV fragment. α MHC-LacZ ES cell line #4 was used to generate embryos shown in D. D) E8.5 embryos derived from α-MHC-LacZ targeted ES cells by tetraploid aggregation. β-galactosidase expression was identified by x-gal staining (blue). Expression was restricted to the developing heart (h).

    Journal: BMC Biotechnology

    Article Title: Generation of single-copy transgenic mouse embryos directly from ES cells by tetraploid embryo complementation

    doi: 10.1186/1472-6750-1-12

    Figure Lengend Snippet: A) Schematic representation of the hprt genomic locus and targeting vector with α-MHC-LacZ insert. The position of a Southern blot probe (probe b) containing LacZ specific sequences relative to Xba1 (x) and EcoRV (e) restriction enzyme cut sites is shown. B) Resistance to growth in HAT and sensitivity to G418 and 6-TG was restored in correctly targeted α MHC-LacZ ES cell lines. C) Southern blot analysis of genomic DNA from non-targeted F3 ES cells as well as from six targeted HAT-resistant ES cell lines generated from F3 cells is shown. The targeted allele is identified using probe b as a 7.0 kb EcoRV fragment. α MHC-LacZ ES cell line #4 was used to generate embryos shown in D. D) E8.5 embryos derived from α-MHC-LacZ targeted ES cells by tetraploid aggregation. β-galactosidase expression was identified by x-gal staining (blue). Expression was restricted to the developing heart (h).

    Article Snippet: pMP8NEBΔLacZ The plasmid pMP8NEBΔLacZ was generated by ligating an 8 kb Xba1 fragment from pMP8 into the Xba1 site of pNEB193 (New England Biolabs) from which LacZ sequences had been removed as a NarI/EcoRI fragment [ ].

    Techniques: Plasmid Preparation, Southern Blot, HAT Assay, Generated, Derivative Assay, Expressing, Staining