Structured Review

Thermo Fisher xba i
Restriction map of markers RFLP-PCR ( a ) Me15-16 <t>Aci</t> I, ( b ) ITS Hha I, ( c ) CO I <t>Xba</t> I and ( d ) 16S rRNA EcoR V, Nhe I and Spe I. *Is used to identify the new haplotypes found in this work. For clarity, we will conserve the name M. galloprovincialis to refer the former Northern Hemisphere haplotype and use M. chilensis for the former Southern Hemisphere haplotype.
Xba I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 195 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/xba i/product/Thermo Fisher
Average 96 stars, based on 195 article reviews
Price from $9.99 to $1999.99
xba i - by Bioz Stars, 2020-04
96/100 stars

Images

1) Product Images from "Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels"

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels

Journal: Scientific Reports

doi: 10.1038/s41598-019-55855-8

Restriction map of markers RFLP-PCR ( a ) Me15-16 Aci I, ( b ) ITS Hha I, ( c ) CO I Xba I and ( d ) 16S rRNA EcoR V, Nhe I and Spe I. *Is used to identify the new haplotypes found in this work. For clarity, we will conserve the name M. galloprovincialis to refer the former Northern Hemisphere haplotype and use M. chilensis for the former Southern Hemisphere haplotype.
Figure Legend Snippet: Restriction map of markers RFLP-PCR ( a ) Me15-16 Aci I, ( b ) ITS Hha I, ( c ) CO I Xba I and ( d ) 16S rRNA EcoR V, Nhe I and Spe I. *Is used to identify the new haplotypes found in this work. For clarity, we will conserve the name M. galloprovincialis to refer the former Northern Hemisphere haplotype and use M. chilensis for the former Southern Hemisphere haplotype.

Techniques Used: Polymerase Chain Reaction, Northern Blot

Related Articles

Clone Assay:

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: .. The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen). .. All cloned gene sequences were again confirmed using the ABI Prism system.

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: .. The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The obtained constructs were sequenced and used to transfect S2 cells.

Article Title: Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1 [OA]
Article Snippet: .. The cDNA fragment released from pQE-FBR12 by Sac I and Spe I was cloned into the Sac I and Xba I of a pYES2 vector (Invitrogen) under the control of a GAL1 promoter. .. Therefore, FBR12 expression in yeast ( Saccharomyces cerevisiae ) cells is inducible by Gal and repressible by Glc ( ; ).

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA). .. Human APLP1 , corresponding to amino acids 34–650, was amplified by PCR with the primers AAG CTT ACG TAC AGC CCG CCA TCG GGA GCC TG and GGC AGC GGA AGG GCA CAA C. The PCR fragment was digested with Sna B I and Sca I and cloned into pIC9.

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ). .. All inserted fragments in the expression vector were verified by sequencing using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, Calif., USA).

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For rps9 mRNA synthesis, coding sequence was amplified using cDNA and cloned into pCSDest2 using gateway technology (Thermo Fisher), then mRNA was transcribed after plasmid linearization using SP6 mMESSAGE Kit (Ambion).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: For all zebrafish connexins, a DNA fragment containing the entire coding sequence was excised from pBluescript-SKII clones by digestion with appropriate restriction enzymes (zfCx27.5: Bgl II- Sca I, 1.1 kb; zfCx44.1: Hin dIII- Pst I, 1.5 kb; zfCx55.5 Dra I- Xba I, 1.7 kb), blunted, and subcloned into the Bgl II site of the expression vector pSP64T ( ). .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions.

Amplification:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: The EC1 promoter fragments were amplified with terminal Xba I restriction sites via PCR using Taq polymerase (Fermentas), resulting in fragments for EC1.1 (108 bp), EC1.2 (115 bp), EC1.3 (167 bp), EC1.4 ( 199 bp), and EC1.5 ). .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: APLP2 was amplified by the PCR as a 1998 base pair DNA fragment corresponding to residues 28–693 of human APLP2 . .. The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA).

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ). .. All inserted fragments in the expression vector were verified by sequencing using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, Calif., USA).

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For rps9 mRNA synthesis, coding sequence was amplified using cDNA and cloned into pCSDest2 using gateway technology (Thermo Fisher), then mRNA was transcribed after plasmid linearization using SP6 mMESSAGE Kit (Ambion).

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: All experiments included a negative control (with no template DNA added) and a positive control consisting of template DNA that was previously extracted and successfully amplified by conventional PCR with Me15-16 . .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively.

Positive Control:

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The production of the recombinant protein was verified by western blot analysis using the H. virescens P102 antibody for P102Tni with P102 as a positive control.

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: All experiments included a negative control (with no template DNA added) and a positive control consisting of template DNA that was previously extracted and successfully amplified by conventional PCR with Me15-16 . .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively.

Synthesized:

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions. .. Aliquots (200 ng) of in vitro synthesized connexin cRNAs were translated (1 hr at 30°C) using a rabbit reticulocyte lysate system (Promega).

TA Cloning:

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: .. The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen). .. All cloned gene sequences were again confirmed using the ABI Prism system.

Construct:

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: Paragraph title: Constructs ... The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen).

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The obtained constructs were sequenced and used to transfect S2 cells.

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ). .. All inserted fragments in the expression vector were verified by sequencing using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, Calif., USA).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions. ..

Electrophoresis:

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions. .. Radioactive products (1/10–1/20 of the reaction volume) were diluted with gel sample buffer (25 m m Tris-HCl, pH 6.8, 0.5% SDS, 0.1% β-mercaptoethanol, 17% glycerol, 0.01% bromophenol blue), separated by electrophoresis on an 11% SDS-polyacrylamide gel, and visualized by fluorography.

Incubation:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP. .. For the s, the radioactively labeled promoter fragments (10 or 18 ng) were incubated with different amounts of SUF4 (10 to 400 ng) in 1× buffer (10 m m Tris-HCl, pH 7.5, 100 m m KCl, 1 m m EDTA, 0.1 mg mL−1 bovine serum albumin, 100 μ m ZnCl2 , 6% glycerol, and 1 m m dithiothreitol) in 20-μL reaction volumes for 1 h at 4°C.

Article Title: Molecular differentiation between Salmonella enterica subsp enterica serovar Pullorum and Salmonella enterica subsp enterica serovar Gallinarum
Article Snippet: .. Restriction enzyme -Eco RI, Xba I and Sal I Five microliters of PCR product was added to 1 μL of 10X reaction buffer, 1 μL of enzyme [Eco R I (Invitrogen 15202-013) or Sal I (Invitrogen 15217-011) or Xba I (Invitrogen 15226-012)] and 3 μL of DW and incubated at 37ºC for 1:30h. .. Amplification of the spe c and spe F genes In this study, fragments of both genes was successfully amplified from all 21 strains of S .

Expressing:

Article Title: State-dependent trapping of flecainide in the cardiac sodium channel
Article Snippet: Paragraph title: Expression of Nav1.5 in oocytes ... The cDNA encoding the human cardiac (Nav1.5) Na+ channel inserted into pcDNA plasmid (Invitrogen) was linearized with Xba I and full length capped mRNA transcribed using the T7 promoter (mMessage mMachine, Ambion, Austin TX, USA).

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: After expressing 6xHis-SUF4-StrepII in E. coli RosettaTM(DE3) (Novagen), the soluble fraction of the crude cell extract was purified by immobilized metal ion affinity chromatography under native conditions using nickel-nitrilotriacetic acid agarose (Qiagen) and gravity flow columns, following the manufacturer´s instructions. .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: .. The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen). .. All cloned gene sequences were again confirmed using the ABI Prism system.

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: .. The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The obtained constructs were sequenced and used to transfect S2 cells.

Article Title: Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1 [OA]
Article Snippet: The cDNA fragment released from pQE-FBR12 by Sac I and Spe I was cloned into the Sac I and Xba I of a pYES2 vector (Invitrogen) under the control of a GAL1 promoter. .. Therefore, FBR12 expression in yeast ( Saccharomyces cerevisiae ) cells is inducible by Gal and repressible by Glc ( ; ).

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: Paragraph title: Construction of Expression Plasmids ... For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: For all zebrafish connexins, a DNA fragment containing the entire coding sequence was excised from pBluescript-SKII clones by digestion with appropriate restriction enzymes (zfCx27.5: Bgl II- Sca I, 1.1 kb; zfCx44.1: Hin dIII- Pst I, 1.5 kb; zfCx55.5 Dra I- Xba I, 1.7 kb), blunted, and subcloned into the Bgl II site of the expression vector pSP64T ( ). .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions.

Western Blot:

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The production of the recombinant protein was verified by western blot analysis using the H. virescens P102 antibody for P102Tni with P102 as a positive control.

Transformation Assay:

Article Title: Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1 [OA]
Article Snippet: The cDNA fragment released from pQE-FBR12 by Sac I and Spe I was cloned into the Sac I and Xba I of a pYES2 vector (Invitrogen) under the control of a GAL1 promoter. .. Culture and transformation of yeast cells were carried out according to standard protocols ( ).

Countercurrent Chromatography:

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: .. The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA). .. Human APLP1 , corresponding to amino acids 34–650, was amplified by PCR with the primers AAG CTT ACG TAC AGC CCG CCA TCG GGA GCC TG and GGC AGC GGA AGG GCA CAA C. The PCR fragment was digested with Sna B I and Sca I and cloned into pIC9.

Flow Cytometry:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: After expressing 6xHis-SUF4-StrepII in E. coli RosettaTM(DE3) (Novagen), the soluble fraction of the crude cell extract was purified by immobilized metal ion affinity chromatography under native conditions using nickel-nitrilotriacetic acid agarose (Qiagen) and gravity flow columns, following the manufacturer´s instructions. .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Gas Chromatography:

Article Title: Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1 [OA]
Article Snippet: The cDNA fragment released from pQE-FBR12 by Sac I and Spe I was cloned into the Sac I and Xba I of a pYES2 vector (Invitrogen) under the control of a GAL1 promoter. .. Therefore, FBR12 expression in yeast ( Saccharomyces cerevisiae ) cells is inducible by Gal and repressible by Glc ( ; ).

Chromatography:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP. .. Unincorporated [α-32 P]dATP was removed by spin-column chromatography (Illustra ProbeQuant G-50 Micro columns; GE Healthcare).

Northern Blot:

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: For clarity, we will conserve the name M. galloprovincialis to refer the former Northern Hemisphere haplotype and use M. chilensis for the former Southern Hemisphere haplotype (Fig. ). .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively.

Infection:

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: The chMAVS ORFs were amplified by PCR with primer pairs chMAVS-F/chMAVS-R using total RNA extracted from HD-11 cells infected with HP/Yamaguchi and the obtained PCR products were then cloned using the Zero Blunt TOPO PCR cloning kit. chMAVS comprises a 1,926-bp ORF encoding 641 amino acid residues. .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ).

Generated:

Article Title: Molecular Epidemiological Insights into Colistin-Resistant and Carbapenemases-Producing Clinical Klebsiella pneumoniae Isolates
Article Snippet: Molecular Typing by PFGE and MLST For PFGE, bacterial DNA was digested with Xba I (Fermentas, Milan, Italy) according to PulseNet protocol using conditions of pulse times from 5 to 40 sec over 24 hrs at 6.0V/cm and at 14°C. .. Pulsotypes were analyzed through BioNumerics software (Applied Maths, Sint-Martens-Latem, Belgium), and dendrograms were generated using Dice coefficient and unweighted pair group method with arithmetic mean (UPGMA).

DNA Sequencing:

Article Title: Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1 [OA]
Article Snippet: This cDNA fragment, containing the entire ORF of FBR12 and 32 bp of the 3′-UTR, was verified by DNA sequencing. .. The cDNA fragment released from pQE-FBR12 by Sac I and Spe I was cloned into the Sac I and Xba I of a pYES2 vector (Invitrogen) under the control of a GAL1 promoter.

Sequencing:

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: The identity and integrity of the inserts was confirmed by sequence analysis (ABI Prism System, Applied Biosystems, Foster City, CA). .. The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen).

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: Expression of P102, P102Tni and XendoU in insect cells The PCR products were both cloned into the pCR2.1 TOPO vector (Life Technologies, Carlsbad, California, USA) following the manufacturer's protocol and the sequence identity was verified by sequencing. .. The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA).

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: Since bases at position 1,247 (A), 1,317 (C) and 1,318 (A) of the chMAVS sequence differed from that of chMAVS (1,247 G, 1,317 T and 1,318 G), which was previously identified by Liniger et al. [ ], the determined sequence was deposited into GenBank (accession No. ). .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ).

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For rps9 mRNA synthesis, coding sequence was amplified using cDNA and cloned into pCSDest2 using gateway technology (Thermo Fisher), then mRNA was transcribed after plasmid linearization using SP6 mMESSAGE Kit (Ambion).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: For all zebrafish connexins, a DNA fragment containing the entire coding sequence was excised from pBluescript-SKII clones by digestion with appropriate restriction enzymes (zfCx27.5: Bgl II- Sca I, 1.1 kb; zfCx44.1: Hin dIII- Pst I, 1.5 kb; zfCx55.5 Dra I- Xba I, 1.7 kb), blunted, and subcloned into the Bgl II site of the expression vector pSP64T ( ). .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions.

Article Title: Molecular Epidemiological Insights into Colistin-Resistant and Carbapenemases-Producing Clinical Klebsiella pneumoniae Isolates
Article Snippet: Molecular Typing by PFGE and MLST For PFGE, bacterial DNA was digested with Xba I (Fermentas, Milan, Italy) according to PulseNet protocol using conditions of pulse times from 5 to 40 sec over 24 hrs at 6.0V/cm and at 14°C. .. A validated MLST scheme was used, and PCR products were sequenced by Sanger method (Eurofins Genomics) to identify allelic profiles and assign the Sequence Type (ST).

Binding Assay:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP. .. Afterward, the reactions were separated on a 5% polyacrylamide gel in TAE buffer (40 m m Tris and 2.5 m m EDTA, pH 7.8) at 10 V cm−1 gel length for 1 h. For the competitor assays, the respective unlabeled probe was added in excess (50× and 100×) to the binding mixture.

Cellular Antioxidant Activity Assay:

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA). .. Human APLP1 , corresponding to amino acids 34–650, was amplified by PCR with the primers AAG CTT ACG TAC AGC CCG CCA TCG GGA GCC TG and GGC AGC GGA AGG GCA CAA C. The PCR fragment was digested with Sna B I and Sca I and cloned into pIC9.

Isolation:

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For gRNA synthesis, DNA template was amplified using gene specific oligo (rps9 guide F: TAATACGACTCACTATAGCGTATTGGAGTGCTGGATGGTTTTAGAGCTAGAAATAGC), then gRNA was transcribed in vitro using MAXIscript T7 kit (Ambion) and purified using MicroRNA Isolation Kit (BioChain USA).

Size-exclusion Chromatography:

Article Title: Molecular Epidemiological Insights into Colistin-Resistant and Carbapenemases-Producing Clinical Klebsiella pneumoniae Isolates
Article Snippet: .. Molecular Typing by PFGE and MLST For PFGE, bacterial DNA was digested with Xba I (Fermentas, Milan, Italy) according to PulseNet protocol using conditions of pulse times from 5 to 40 sec over 24 hrs at 6.0V/cm and at 14°C. .. Pulsotypes were analyzed through BioNumerics software (Applied Maths, Sint-Martens-Latem, Belgium), and dendrograms were generated using Dice coefficient and unweighted pair group method with arithmetic mean (UPGMA).

Labeling:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP. .. Unincorporated [α-32 P]dATP was removed by spin-column chromatography (Illustra ProbeQuant G-50 Micro columns; GE Healthcare).

Purification:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP. .. Unincorporated [α-32 P]dATP was removed by spin-column chromatography (Illustra ProbeQuant G-50 Micro columns; GE Healthcare).

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For gRNA synthesis, DNA template was amplified using gene specific oligo (rps9 guide F: TAATACGACTCACTATAGCGTATTGGAGTGCTGGATGGTTTTAGAGCTAGAAATAGC), then gRNA was transcribed in vitro using MAXIscript T7 kit (Ambion) and purified using MicroRNA Isolation Kit (BioChain USA).

Polymerase Chain Reaction:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: The EC1 promoter fragments were amplified with terminal Xba I restriction sites via PCR using Taq polymerase (Fermentas), resulting in fragments for EC1.1 (108 bp), EC1.2 (115 bp), EC1.3 (167 bp), EC1.4 ( 199 bp), and EC1.5 ). .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: The PCR products were ligated into the TA cloning vector system (TOPO TA cloning system, Invitrogen, Carlsbad, CA). .. The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen).

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: Expression of P102, P102Tni and XendoU in insect cells The PCR products were both cloned into the pCR2.1 TOPO vector (Life Technologies, Carlsbad, California, USA) following the manufacturer's protocol and the sequence identity was verified by sequencing. .. The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA).

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: .. The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA). .. Human APLP1 , corresponding to amino acids 34–650, was amplified by PCR with the primers AAG CTT ACG TAC AGC CCG CCA TCG GGA GCC TG and GGC AGC GGA AGG GCA CAA C. The PCR fragment was digested with Sna B I and Sca I and cloned into pIC9.

Article Title: Molecular differentiation between Salmonella enterica subsp enterica serovar Pullorum and Salmonella enterica subsp enterica serovar Gallinarum
Article Snippet: .. Restriction enzyme -Eco RI, Xba I and Sal I Five microliters of PCR product was added to 1 μL of 10X reaction buffer, 1 μL of enzyme [Eco R I (Invitrogen 15202-013) or Sal I (Invitrogen 15217-011) or Xba I (Invitrogen 15226-012)] and 3 μL of DW and incubated at 37ºC for 1:30h. .. Amplification of the spe c and spe F genes In this study, fragments of both genes was successfully amplified from all 21 strains of S .

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ). .. All inserted fragments in the expression vector were verified by sequencing using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, Calif., USA).

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively. .. Triple digestion with EcoR V, Nhe I and Spe I (New England Biolabs) was performed in the same reaction using 10, 5 and 5 units of each enzyme, respectively, with 1x NEB2 buffer.

Article Title: Molecular Epidemiological Insights into Colistin-Resistant and Carbapenemases-Producing Clinical Klebsiella pneumoniae Isolates
Article Snippet: Molecular Typing by PFGE and MLST For PFGE, bacterial DNA was digested with Xba I (Fermentas, Milan, Italy) according to PulseNet protocol using conditions of pulse times from 5 to 40 sec over 24 hrs at 6.0V/cm and at 14°C. .. A validated MLST scheme was used, and PCR products were sequenced by Sanger method (Eurofins Genomics) to identify allelic profiles and assign the Sequence Type (ST).

Positron Emission Tomography:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: LR-Clonase reactions were performed using the SUF4 entry vector and the destination vectors pET-53-DEST (Novagen) and pDEST-HisMBP ( ). .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Polyacrylamide Gel Electrophoresis:

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively. .. The size of amplified fragments resolved in PAGE was obtained by log-linear interpolation of the 10 bp DNA ladder (Invitrogen® ) or HyperLadder V (Bioline® ) on the gel.

In Situ Hybridization:

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: After cycling, digoxigenin detection and color development were performed as described for the in situ hybridization analysis. .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions.

Plasmid Preparation:

Article Title: State-dependent trapping of flecainide in the cardiac sodium channel
Article Snippet: .. The cDNA encoding the human cardiac (Nav1.5) Na+ channel inserted into pcDNA plasmid (Invitrogen) was linearized with Xba I and full length capped mRNA transcribed using the T7 promoter (mMessage mMachine, Ambion, Austin TX, USA). ..

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: LR-Clonase reactions were performed using the SUF4 entry vector and the destination vectors pET-53-DEST (Novagen) and pDEST-HisMBP ( ). .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Article Title: In vitro Induction of Myeloid Leukemia-Specific CD4 and CD8 T Cells by CD40 Ligand-Activated B Cells Gene Modified to Express Primary Granule Proteins
Article Snippet: .. The inserts were excised from the TA cloning vector with Eco RI and Xba I and cloned into the eukaryotic expression vector pcDNA3.1 (Invitrogen). .. All cloned gene sequences were again confirmed using the ABI Prism system.

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: .. The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The obtained constructs were sequenced and used to transfect S2 cells.

Article Title: Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1Functional Characterization of the Arabidopsis Eukaryotic Translation Initiation Factor 5A-2 That Plays a Crucial Role in Plant Growth and Development by Regulating Cell Division, Cell Growth, and Cell Death 1 [OA]
Article Snippet: .. The cDNA fragment released from pQE-FBR12 by Sac I and Spe I was cloned into the Sac I and Xba I of a pYES2 vector (Invitrogen) under the control of a GAL1 promoter. .. Therefore, FBR12 expression in yeast ( Saccharomyces cerevisiae ) cells is inducible by Gal and repressible by Glc ( ; ).

Article Title: Chicken MDA5 Senses Short Double-Stranded RNA with Implications for Antiviral Response against Avian Influenza Viruses in Chicken
Article Snippet: .. For the generation of chimeric constructs, the Helicase and CTD domains of dRIG-I fused to CARD of chMDA5 (dRIG-I/chMDA5 CARD) and its complimentary constructs (chMDA5/dRIG-I CARD) were amplified by the overlap PCR method, cloned using the Zero Blunt TOPO PCR cloning kit, and then inserted into the Xba I and Not I sites, respectively, of the p3×FLAG CMV-10 vector (Invitrogen). dRIG-I/chMDA5CARD-F1, chMDA5/dRIG-ICARD-F1, chMDA5/dRIG-ICARD-R1 and dRIG-I-R were used for construction of dRIG-I/chMDA5 CARD (table ). dRIG-I-F, dRIG-I/chMDA5CARD-F2, dRIG-I/chMDA5CARD-R1 and chMDA5/dRIG-I CARD-R2 were used for the construction of chMDA5/dRIG-I CARD (table ). .. All inserted fragments in the expression vector were verified by sequencing using an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, Calif., USA).

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: .. mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For rps9 mRNA synthesis, coding sequence was amplified using cDNA and cloned into pCSDest2 using gateway technology (Thermo Fisher), then mRNA was transcribed after plasmid linearization using SP6 mMESSAGE Kit (Ambion).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: For all zebrafish connexins, a DNA fragment containing the entire coding sequence was excised from pBluescript-SKII clones by digestion with appropriate restriction enzymes (zfCx27.5: Bgl II- Sca I, 1.1 kb; zfCx44.1: Hin dIII- Pst I, 1.5 kb; zfCx55.5 Dra I- Xba I, 1.7 kb), blunted, and subcloned into the Bgl II site of the expression vector pSP64T ( ). .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions.

Software:

Article Title: Molecular Epidemiological Insights into Colistin-Resistant and Carbapenemases-Producing Clinical Klebsiella pneumoniae Isolates
Article Snippet: Molecular Typing by PFGE and MLST For PFGE, bacterial DNA was digested with Xba I (Fermentas, Milan, Italy) according to PulseNet protocol using conditions of pulse times from 5 to 40 sec over 24 hrs at 6.0V/cm and at 14°C. .. Pulsotypes were analyzed through BioNumerics software (Applied Maths, Sint-Martens-Latem, Belgium), and dendrograms were generated using Dice coefficient and unweighted pair group method with arithmetic mean (UPGMA).

Negative Control:

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: All experiments included a negative control (with no template DNA added) and a positive control consisting of template DNA that was previously extracted and successfully amplified by conventional PCR with Me15-16 . .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively.

Selection:

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The expression of P102Tni and XendoU in S2 cells and the selection of stable polyclonal cell lines were performed as described previously for P102 .

In Vitro:

Article Title: Loss of rps9 in Zebrafish Leads to p53-Dependent Anemia
Article Snippet: .. mRNA and gRNA synthesis, genotyping pT3TS-nCas9n plasmid (addgene, plasmid #46757) for zebrafish was linearized with Xba I, mRNA was obtained through in vitro transcription using linearized plasmids with T3 mMESSAGE Kit (Ambion). .. For rps9 mRNA synthesis, coding sequence was amplified using cDNA and cloned into pCSDest2 using gateway technology (Thermo Fisher), then mRNA was transcribed after plasmid linearization using SP6 mMESSAGE Kit (Ambion).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions. ..

Affinity Chromatography:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: After expressing 6xHis-SUF4-StrepII in E. coli RosettaTM(DE3) (Novagen), the soluble fraction of the crude cell extract was purified by immobilized metal ion affinity chromatography under native conditions using nickel-nitrilotriacetic acid agarose (Qiagen) and gravity flow columns, following the manufacturer´s instructions. .. The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Produced:

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: Recombinant secreted APP751, APLP2, and APLP1 were produced in the methylotrophic yeast Pichia pastoris . .. The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA).

Article Title: Molecular and Functional Diversity of Neural Connexins in the Retina
Article Snippet: .. These new constructs were linearized with either Eco RI (zfCx27.5) or Xba I (zfCx44.1 and zfCx55.5), and capped cRNAs were produced in vitro with SP6 RNA polymerase, using the mMessage mMachine kit (Ambion Inc., Austin, TX) according to the manufacturer's instructions. ..

Marker:

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: Details regarding the PCR reaction conditions and amplification profiles for each marker are shown in Table . .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively.

Recombinant:

Article Title: SUPPRESSOR OF FRIGIDA (SUF4) Supports Gamete Fusion via Regulating Arabidopsis EC1 Gene Expression 1
Article Snippet: Paragraph title: Purification of Recombinant SUF4 and s ... The purified promoter fragments were digested with Xba I and radioactively labeled using Klenow enzyme (Fermentas) and [α-32 P]dATP.

Article Title: The Lepidopteran endoribonuclease-U domain protein P102 displays dramatically reduced enzymatic activity and forms functional amyloids.
Article Snippet: The inserts were then digested with Xba I and Sac II and cloned into the expression vector pIZT/V5-His (Life Technologies, Carlsbad, California, USA). .. The production of the recombinant protein was verified by western blot analysis using the H. virescens P102 antibody for P102Tni with P102 as a positive control.

Article Title: Survival of Cultured Neurons from Amyloid Precursor Protein Knock-Out Mice against Alzheimer’s Amyloid-β Toxicity and Oxidative Stress
Article Snippet: Recombinant secreted APP751, APLP2, and APLP1 were produced in the methylotrophic yeast Pichia pastoris . .. The oligonucleotides used were CCG AAT TCT TGG CGC TGG CCG GCT ACA and CCC CTC TAG AAC TGC TAC TCA GAC TGA AGT C. The PCR fragment was digested with Eco RI and Xba I and ligated into Eco RI/ Xba I-digested pIC9 (Invitrogen, San Diego, CA).

Article Title: Comparison between single and multi-locus approaches for specimen identification in Mytilus mussels
Article Snippet: DNA amplifications were performed in a Techne TC-412 (Bibby Scientific Ltd, UK) thermocycler and Palm-CyclerTM (Corbett Life Science, Australia) with recombinant Taq DNA polymerase (RBC Bioscience® and Thermo Fisher® ) using 40 ng of template DNA in a final volume of 25 μL. .. Digestion with Aci I (New England Biolabs), Hha I and Xba I (Thermo Scientific) was performed separately in a final volume of 20 μL, using 15 μL of PCR product and 4, 10 and 10 units of each enzyme with 1x NEB4 and Tango buffers, respectively.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher xba i
    Southern blot of REFs and SRPPs in genomic DNA isolated from rubber tree clone RY 7-33-97. Endonucleases Eco R I, Hind <t>III,</t> Xba I, and Xho I were used for digestion of genomic DNA. DNA molecular mass markers are shown on the left.
    Xba I, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 195 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i/product/Thermo Fisher
    Average 99 stars, based on 195 article reviews
    Price from $9.99 to $1999.99
    xba i - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Thermo Fisher xba i restriction enzyme
    Generation of Spink5 mutant mice. (A) Nucleotide and amino acid sequences of human SPINK5/LEKTI (left). The two-bp deletion 398delTG in exon5 of human SPINK5 gene results in a frame-shift and PTC (red box) as described in Raghunath et al., 2004(23). Comparison of corresponding sequences in murine Spink5/LEKTI (right) where deletion of TG nucleotides at position 402 (black underline) has the same impact as in humans. (B) Position of critical TG nucleotides (black underline) in the exon5 of murine Spink5 gene. TALEN-binding sites are marked with red underline, position of primers for <t>PCR</t> screening (F1, R1, F2, R2) are denoted. As a targeting construct, a single-stranded oligonucleotide having sequences homologous to wt DNA (blue underline) flanked desired mutation. Premature STOP codon (red box) and introduced new <t>Xba</t> I recognition sequence are depicted. (C) RFLP analysis of targeted mice. PCR product amplified from genomic DNA using primers F1 and R1 was digested using Xba I enzyme. Cleavage products of 283 and 220 bp originate from the positively targeted allele, a 503 bp fragment marks the wt allele. (D) Expression of Spink5 mRNA was analysed by semi-qPCR analysis in Sp5 A135X/A135X mice using primers F2 and R2. Expression of GAPDH was used as a control. (E) Phenotype of Sp5 A135X/A135X newborn pups. Areas of peeling skin are marked with black arrowheads.
    Xba I Restriction Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i restriction enzyme/product/Thermo Fisher
    Average 94 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    xba i restriction enzyme - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    94
    Thermo Fisher xba i enzyme
    Phylogenetic analysis of obtained PFGE <t>Xba</t> I profiles of S . maltophilia clinical isolates. Distance showed above the dendrogram represents genetic relatedness between the analyzed strains. MLST analysis represents strains used for this analysis and obtained results. Patient number represents strains obtained from CF and non-CF patients, C and N, respectively. Isolates obtained from the same patients have identical patients number. Source represents site of isolation: R–respiratory tract, B–blood, HM–human milk. Strength of biofilm formed is presented with—–no biofilm, +–weak biofilm, ++–medium biofilm, +++–strong biofilm.
    Xba I Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xba i enzyme/product/Thermo Fisher
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    xba i enzyme - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    Southern blot of REFs and SRPPs in genomic DNA isolated from rubber tree clone RY 7-33-97. Endonucleases Eco R I, Hind III, Xba I, and Xho I were used for digestion of genomic DNA. DNA molecular mass markers are shown on the left.

    Journal: International Journal of Molecular Sciences

    Article Title: Comparative Proteomics of Rubber Latex Revealed Multiple Protein Species of REF/SRPP Family Respond Diversely to Ethylene Stimulation among Different Rubber Tree Clones

    doi: 10.3390/ijms18050958

    Figure Lengend Snippet: Southern blot of REFs and SRPPs in genomic DNA isolated from rubber tree clone RY 7-33-97. Endonucleases Eco R I, Hind III, Xba I, and Xho I were used for digestion of genomic DNA. DNA molecular mass markers are shown on the left.

    Article Snippet: H. brasiliensis genomic DNA was extracted from the leaves of rubber tree and digested with Bam H I, Eco R I, Hind III, and Xba I (Thermo Scientific, Guangzhou, China).

    Techniques: Southern Blot, Isolation

    Dendrograms showing pattern analysis on the basis of Xba I-PFGE of the 75 Salmonella Montevideo isolates obtained from broiler farms, along with related sampling information, and antimicrobial-resistance (AMR) profiles. The Dice coefficient was used to perform similarity analysis. a S, cloacal swabs; L, litter; F, feed. b R, resistance (dark pink); I, intermediate resistance (pink), S, sensitivity (light pink). Dotted lines indicate 90% similarity

    Journal: BMC Veterinary Research

    Article Title: Distribution and dissemination of antimicrobial-resistant Salmonella in broiler farms with or without enrofloxacin use

    doi: 10.1186/s12917-018-1590-1

    Figure Lengend Snippet: Dendrograms showing pattern analysis on the basis of Xba I-PFGE of the 75 Salmonella Montevideo isolates obtained from broiler farms, along with related sampling information, and antimicrobial-resistance (AMR) profiles. The Dice coefficient was used to perform similarity analysis. a S, cloacal swabs; L, litter; F, feed. b R, resistance (dark pink); I, intermediate resistance (pink), S, sensitivity (light pink). Dotted lines indicate 90% similarity

    Article Snippet: Genomic DNA (extraction using 1% SDS and 1 mg/mL proteinase K, Biosesang, Seoul, Korea) samples were digested with 50 U of Xba I (Thermo Fisher Scientific, Inchon, Korea) at 37 °C for 3 h. The digested DNA was separated by electrophoresis in 0.5 x TBE buffer at 14 °C for 18 h using a CHEF-DR@ electrophoresis system (Bio-Rad, Hercules, CA, USA).

    Techniques: Sampling

    Generation of Spink5 mutant mice. (A) Nucleotide and amino acid sequences of human SPINK5/LEKTI (left). The two-bp deletion 398delTG in exon5 of human SPINK5 gene results in a frame-shift and PTC (red box) as described in Raghunath et al., 2004(23). Comparison of corresponding sequences in murine Spink5/LEKTI (right) where deletion of TG nucleotides at position 402 (black underline) has the same impact as in humans. (B) Position of critical TG nucleotides (black underline) in the exon5 of murine Spink5 gene. TALEN-binding sites are marked with red underline, position of primers for PCR screening (F1, R1, F2, R2) are denoted. As a targeting construct, a single-stranded oligonucleotide having sequences homologous to wt DNA (blue underline) flanked desired mutation. Premature STOP codon (red box) and introduced new Xba I recognition sequence are depicted. (C) RFLP analysis of targeted mice. PCR product amplified from genomic DNA using primers F1 and R1 was digested using Xba I enzyme. Cleavage products of 283 and 220 bp originate from the positively targeted allele, a 503 bp fragment marks the wt allele. (D) Expression of Spink5 mRNA was analysed by semi-qPCR analysis in Sp5 A135X/A135X mice using primers F2 and R2. Expression of GAPDH was used as a control. (E) Phenotype of Sp5 A135X/A135X newborn pups. Areas of peeling skin are marked with black arrowheads.

    Journal: PLoS Genetics

    Article Title: KLK5 and KLK7 Ablation Fully Rescues Lethality of Netherton Syndrome-Like Phenotype

    doi: 10.1371/journal.pgen.1006566

    Figure Lengend Snippet: Generation of Spink5 mutant mice. (A) Nucleotide and amino acid sequences of human SPINK5/LEKTI (left). The two-bp deletion 398delTG in exon5 of human SPINK5 gene results in a frame-shift and PTC (red box) as described in Raghunath et al., 2004(23). Comparison of corresponding sequences in murine Spink5/LEKTI (right) where deletion of TG nucleotides at position 402 (black underline) has the same impact as in humans. (B) Position of critical TG nucleotides (black underline) in the exon5 of murine Spink5 gene. TALEN-binding sites are marked with red underline, position of primers for PCR screening (F1, R1, F2, R2) are denoted. As a targeting construct, a single-stranded oligonucleotide having sequences homologous to wt DNA (blue underline) flanked desired mutation. Premature STOP codon (red box) and introduced new Xba I recognition sequence are depicted. (C) RFLP analysis of targeted mice. PCR product amplified from genomic DNA using primers F1 and R1 was digested using Xba I enzyme. Cleavage products of 283 and 220 bp originate from the positively targeted allele, a 503 bp fragment marks the wt allele. (D) Expression of Spink5 mRNA was analysed by semi-qPCR analysis in Sp5 A135X/A135X mice using primers F2 and R2. Expression of GAPDH was used as a control. (E) Phenotype of Sp5 A135X/A135X newborn pups. Areas of peeling skin are marked with black arrowheads.

    Article Snippet: Genomic DNA isolated from tail biopsies of newborn mice were screened by PCR (primers F1: 5´-CCTGTCTCTGCCTTCAGACC-3´ and R1: 5´-GGCTGTGGTAACTGTCCAAAA-3´) and subsequent RFLP analysis using Xba I restriction enzyme (Thermo-Scientific).

    Techniques: Mutagenesis, Mouse Assay, Binding Assay, Polymerase Chain Reaction, Construct, Sequencing, Amplification, Expressing, Real-time Polymerase Chain Reaction

    Phylogenetic analysis of obtained PFGE Xba I profiles of S . maltophilia clinical isolates. Distance showed above the dendrogram represents genetic relatedness between the analyzed strains. MLST analysis represents strains used for this analysis and obtained results. Patient number represents strains obtained from CF and non-CF patients, C and N, respectively. Isolates obtained from the same patients have identical patients number. Source represents site of isolation: R–respiratory tract, B–blood, HM–human milk. Strength of biofilm formed is presented with—–no biofilm, +–weak biofilm, ++–medium biofilm, +++–strong biofilm.

    Journal: PLoS ONE

    Article Title: Genotypic and Phenotypic Characterization of Stenotrophomonas maltophilia Strains from a Pediatric Tertiary Care Hospital in Serbia

    doi: 10.1371/journal.pone.0165660

    Figure Lengend Snippet: Phylogenetic analysis of obtained PFGE Xba I profiles of S . maltophilia clinical isolates. Distance showed above the dendrogram represents genetic relatedness between the analyzed strains. MLST analysis represents strains used for this analysis and obtained results. Patient number represents strains obtained from CF and non-CF patients, C and N, respectively. Isolates obtained from the same patients have identical patients number. Source represents site of isolation: R–respiratory tract, B–blood, HM–human milk. Strength of biofilm formed is presented with—–no biofilm, +–weak biofilm, ++–medium biofilm, +++–strong biofilm.

    Article Snippet: Genomic DNA was digested with Xba I enzyme (Thermo Scientific, Lithuania), and obtained macrorestriction profiles were subject to statistical analysis.

    Techniques: Isolation