Structured Review

Promega wizard pcr clean up system
<t>PCR</t> and <t>DNA</t> sequencing
Wizard Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wizard pcr clean up system/product/Promega
Average 99 stars, based on 30 article reviews
Price from $9.99 to $1999.99
wizard pcr clean up system - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Production of a unique pneumococcal capsule serotype belonging to serogroup 6"

Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

Journal:

doi: 10.1099/mic.0.024521-0

PCR and DNA sequencing
Figure Legend Snippet: PCR and DNA sequencing

Techniques Used: Polymerase Chain Reaction, DNA Sequencing

2) Product Images from "An Invariant T Cell Receptor ? Chain Defines a Novel TAP-independent Major Histocompatibility Complex Class Ib-restricted ?/? T Cell Subpopulation in Mammals "

Article Title: An Invariant T Cell Receptor ? Chain Defines a Novel TAP-independent Major Histocompatibility Complex Class Ib-restricted ?/? T Cell Subpopulation in Mammals

Journal: The Journal of Experimental Medicine

doi:

Direct enumeration of AV7S2/AV19-AJ33–bearing cells by PCR–limiting dilution analysis and single cell PCR. (A) DN cells obtained from three human subjects were seeded into microtiter plates using a FACS ® single cell deposition unit. After cell lysis, PCR was carried out with AV7S2 and AJ33 primers, and the amount of amplicons was quantified by ELISA. (B and C) α/β CD8α + or CD4 + cells were obtained by FACS ® sorting, serially diluted, distributed in a microtiter plate at the indicated cell concentration, and processed as above. In C (CD4 + cells), the amplicons of the six wells indicated (which had a high probability of clonality) were sequenced. The sequences were as follows:1-GCT GTG ATG TCG AT2-GCT GTG AGA GAG ATC GGA3- GCT GTG AGA GAT 4-GCT GNN ACT CGA5-GCT GTG AGA GAG GAT AAC-AJ34-intron-AJ336-GCT GTG AGG GGG GGG GAA AAC-AJ34-intron-AJ33Only one (sequence 3) corresponds to the canonical AV7S2-AJ33 rearrangement (see text for details). In B and C, frequencies were calculated by maximum likelihood analysis.
Figure Legend Snippet: Direct enumeration of AV7S2/AV19-AJ33–bearing cells by PCR–limiting dilution analysis and single cell PCR. (A) DN cells obtained from three human subjects were seeded into microtiter plates using a FACS ® single cell deposition unit. After cell lysis, PCR was carried out with AV7S2 and AJ33 primers, and the amount of amplicons was quantified by ELISA. (B and C) α/β CD8α + or CD4 + cells were obtained by FACS ® sorting, serially diluted, distributed in a microtiter plate at the indicated cell concentration, and processed as above. In C (CD4 + cells), the amplicons of the six wells indicated (which had a high probability of clonality) were sequenced. The sequences were as follows:1-GCT GTG ATG TCG AT2-GCT GTG AGA GAG ATC GGA3- GCT GTG AGA GAT 4-GCT GNN ACT CGA5-GCT GTG AGA GAG GAT AAC-AJ34-intron-AJ336-GCT GTG AGG GGG GGG GAA AAC-AJ34-intron-AJ33Only one (sequence 3) corresponds to the canonical AV7S2-AJ33 rearrangement (see text for details). In B and C, frequencies were calculated by maximum likelihood analysis.

Techniques Used: Polymerase Chain Reaction, FACS, Lysis, Enzyme-linked Immunosorbent Assay, Concentration Assay, Activated Clotting Time Assay, Sequencing

Related Articles

Clone Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Paragraph title: Rescue cloning of two nonmucoid mutants. ... The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Centrifugation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Nuclei were enriched by centrifugation and lysed in ChIP-buffer (50 mM Tris-Cl, pH 8.0; 10 mM ethylenediaminetetraacetic acid (EDTA); 1% sodium dodecyl sulphate (SDS); protease inhibitors) before chromatin was sheared by sonification. .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Amplification:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: Approximately 340 bp of the 16S rRNA gene of Escherichia coli No. 341–534 were amplified by PCR using the Lac1 and Lac2GC primer sets [ ]. .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Synthesized:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: The selected amiRNA (TTAATGCGTATCTGTACCATG) was synthesized by fusion PCR ( Supplementary Table S1 ) using Expand Taq (Roche) and osa -mir528 ( ) endogenous miRNA precursor as stem–loop backbone ( ). .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Construct:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Real-time Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Incubation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: For ChIP, 25 μg of sheared chromatin was incubated with control (anti-IgG, Abcam ab171870) or anti-SRF (NEB 5147) antibodies overnight in dilution buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl; 1 mM EDTA; 0.1% SDS; 1% Triton X-100; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: The following day, the samples were incubated with 10 µg of RNase A at 37°C for 1 hour, and then with 10 µg of Proteinase K at 45°C for 2 hours. .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA extraction After elution of the chromatin from the beads, 100 µg/ml proteinase K was added and samples were incubated for 2 h at 55°C. .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Expressing:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: Paragraph title: Construction of RNA silencing expression vectors ... After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Transformation Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Derivative Assay:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Hybridization:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Ligation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Protease Inhibitor:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sequencing:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: PIP2;2 was digested with Bmg BI/ Acl I and Nhe I/ Bfr BI, to give two fragments: one of 760 bp and one of 638 bp (corresponding to 577 bp of the genomic sequence). .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sonication:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Binding Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: An amiRNA was selected from the list of potential amiRNAs based on its binding energy and specificity with the target gene. .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

DNA Extraction:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: Paragraph title: DNA extraction ... DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Fluorescence:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Mutagenesis:

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Two nonmucoid mutants, D12 and F6 (Table ), were chosen from the mutant library for further analysis based on their nonpathogenic phenotypes in pathogenicity assays. .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Isolation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Purification:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Dot Blot:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Quantitative RT-PCR:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Lysis:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: In brief, ∼2.5 × 107 ES-2 cells were treated with formaldehyde, quenched and harvested in lysis buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.9; 7.2 mM KOH; 150 mM KCl; 5 mM MgCl2 ; 0.5% NP-40; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Beads were washed three times in lysis buffer, once in lysis buffer containing 500 mM NaCl, once in wash buffer (10 mM Tris–HCl pH 7.5, 0.25 M LiCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate) and once in lysis buffer. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Chromatin Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: Paragraph title: Chromatin immunoprecipitation analysis (ChIP) ... DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Plasmid Preparation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

SYBR Green Assay:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Denaturing Gradient Gel Electrophoresis:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Agarose Gel Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Knock-Out:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Produced:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: For PIP2;3 two fragments (679 and 568 bp) were produced by digestion with Cla I/ Pml I and Spe I/ Xba I. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Concentration Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

DNA Purification:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Staining:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Promega wizard pcr clean up system
    <t>PCR</t> and <t>DNA</t> sequencing
    Wizard Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 30 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr clean up system/product/Promega
    Average 94 stars, based on 30 article reviews
    Price from $9.99 to $1999.99
    wizard pcr clean up system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Promega wizard pcr preps dna purification system
    Restriction endonuclease digestion patterns for the A3′ amplicon of the CROP region of the toxin A gene for HSC98. The <t>PCR</t> amplicon product A3′ (lane 2) obtained from HSC98 using the A3 primer set (product was 1,250 bp) was exposed to Spe I (lane 3) and Eco I (lane 4) restriction endonucleases to determine restriction fragment length patterns. The A3′ amplicon (lane 2) had no restriction site for Eco RI (lane 4) and had one restriction site for Spe I (lane 3). A 500-bp <t>DNA</t> ladder is shown in lanes 1 and 6, and a 100-bp ladder is shown in lane 5.
    Wizard Pcr Preps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 204 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr preps dna purification system/product/Promega
    Average 99 stars, based on 204 article reviews
    Price from $9.99 to $1999.99
    wizard pcr preps dna purification system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    PCR and DNA sequencing

    Journal:

    Article Title: Production of a unique pneumococcal capsule serotype belonging to serogroup 6

    doi: 10.1099/mic.0.024521-0

    Figure Lengend Snippet: PCR and DNA sequencing

    Article Snippet: PCR products were purified using Wizard PCR Clean-up System (Promega), and the DNA sequencing was performed by the genomics core facility at the University of Alabama at Birmingham (UAB).

    Techniques: Polymerase Chain Reaction, DNA Sequencing

    Restriction endonuclease digestion patterns for the A3′ amplicon of the CROP region of the toxin A gene for HSC98. The PCR amplicon product A3′ (lane 2) obtained from HSC98 using the A3 primer set (product was 1,250 bp) was exposed to Spe I (lane 3) and Eco I (lane 4) restriction endonucleases to determine restriction fragment length patterns. The A3′ amplicon (lane 2) had no restriction site for Eco RI (lane 4) and had one restriction site for Spe I (lane 3). A 500-bp DNA ladder is shown in lanes 1 and 6, and a 100-bp ladder is shown in lane 5.

    Journal: Journal of Clinical Microbiology

    Article Title: Characterization of a Toxin A-Negative, Toxin B-Positive Strain of Clostridium difficile Responsible for a Nosocomial Outbreak of Clostridium difficile-Associated Diarrhea

    doi:

    Figure Lengend Snippet: Restriction endonuclease digestion patterns for the A3′ amplicon of the CROP region of the toxin A gene for HSC98. The PCR amplicon product A3′ (lane 2) obtained from HSC98 using the A3 primer set (product was 1,250 bp) was exposed to Spe I (lane 3) and Eco I (lane 4) restriction endonucleases to determine restriction fragment length patterns. The A3′ amplicon (lane 2) had no restriction site for Eco RI (lane 4) and had one restriction site for Spe I (lane 3). A 500-bp DNA ladder is shown in lanes 1 and 6, and a 100-bp ladder is shown in lane 5.

    Article Snippet: The amplified product from this PCR protocol was purified using the Wizard PCR Preps DNA purification system (Promega Corp., Madison, Wis.), and this purified preparation was used for DNA sequencing.

    Techniques: Amplification, Polymerase Chain Reaction

    UP-PCR results of some patients. We have detected all the patients and finally we chose some positive bacteria and carried out the electrophoresis, so every line had PCR products. The deeper the stripe, the more the bacteria. Lines 1–9 represented PCR product of the 16S rRNA gene of Staphylococcus aureus , Staphylococcus epidermidis , Pseudomonas aeruginosa , Escherichia coli , Streptococcus viridans , Staphylococcus saprophyticus, Corynebacterium parvum , Klebsiella pneumoniae , and Enterobacter cloacae ; M for DL2000 DNA Marker; ten for negative control.

    Journal: BioMed Research International

    Article Title: Genetic Identification and Risk Factor Analysis of Asymptomatic Bacterial Colonization on Cardiovascular Implantable Electronic Devices

    doi: 10.1155/2014/725163

    Figure Lengend Snippet: UP-PCR results of some patients. We have detected all the patients and finally we chose some positive bacteria and carried out the electrophoresis, so every line had PCR products. The deeper the stripe, the more the bacteria. Lines 1–9 represented PCR product of the 16S rRNA gene of Staphylococcus aureus , Staphylococcus epidermidis , Pseudomonas aeruginosa , Escherichia coli , Streptococcus viridans , Staphylococcus saprophyticus, Corynebacterium parvum , Klebsiella pneumoniae , and Enterobacter cloacae ; M for DL2000 DNA Marker; ten for negative control.

    Article Snippet: The PCR product was purified using Wizard PCR Preps DNA Purification System (Promega) and then ligated into the pGEM-T Easy Vector (Promega).

    Techniques: Polymerase Chain Reaction, Electrophoresis, Marker, Negative Control

    The MALS mutagenesis procedure . Target DNA is individually amplified with two pairs of oligonucleotides SO1/IR1 and SO2/IF1. IF1 and IR1 are phosphorylated (rose circles), while SO1 and SO2 are dephosphorylated. The desired mutation is incorporated at the 5' end of IR1 oligonucleotide (shown in red). Panel 1 on the right shows the types of mutations available with MALS. PCR-generated DNA fragments are ligated. The resulting DNA population consists of homomeric ligation products (type A), non-ligated DNA fragments (type B), and molecules representing full length target DNA (type C) (panel 2 on the right). The entire DNA population is then amplified with suppression oligonucleotides SO1 and SO2. Intramolecular hybridization of inverted repeat sequences prevents efficient replication of type A molecules, while type B molecules amplify linearly (panel 3 on the right). Only heteromeric ligation products (type C) amplify exponentially. The resulting DNA population predominantly consists of type C molecules. An aliquot of the PCR mixture is used for the next round of mutagenesis employing internal oligonucleotides specific for another region of target DNA. Finally, SO1 and SO2 suppression sequences (green and blue, respectively) are digested with restriction endonucleases and DNA fragments are ligated with linearized vector for subsequent subcloning.

    Journal: BMC Biotechnology

    Article Title: MALS: an efficient strategy for multiple site-directed mutagenesis employing a combination of DNA amplification, ligation and suppression PCR

    doi: 10.1186/1472-6750-9-83

    Figure Lengend Snippet: The MALS mutagenesis procedure . Target DNA is individually amplified with two pairs of oligonucleotides SO1/IR1 and SO2/IF1. IF1 and IR1 are phosphorylated (rose circles), while SO1 and SO2 are dephosphorylated. The desired mutation is incorporated at the 5' end of IR1 oligonucleotide (shown in red). Panel 1 on the right shows the types of mutations available with MALS. PCR-generated DNA fragments are ligated. The resulting DNA population consists of homomeric ligation products (type A), non-ligated DNA fragments (type B), and molecules representing full length target DNA (type C) (panel 2 on the right). The entire DNA population is then amplified with suppression oligonucleotides SO1 and SO2. Intramolecular hybridization of inverted repeat sequences prevents efficient replication of type A molecules, while type B molecules amplify linearly (panel 3 on the right). Only heteromeric ligation products (type C) amplify exponentially. The resulting DNA population predominantly consists of type C molecules. An aliquot of the PCR mixture is used for the next round of mutagenesis employing internal oligonucleotides specific for another region of target DNA. Finally, SO1 and SO2 suppression sequences (green and blue, respectively) are digested with restriction endonucleases and DNA fragments are ligated with linearized vector for subsequent subcloning.

    Article Snippet: After amplification, the resulting DNA fragments were extracted from PCR mixtures using Wizard PCR Preps DNA Purification System (Promega, Madison, USA).

    Techniques: Mutagenesis, Amplification, Polymerase Chain Reaction, Generated, Ligation, Hybridization, Plasmid Preparation, Subcloning

    Agarose gel electrophoregram demonstrating the types of molecules forming during one individual round of mutagenesis . Lanes 1 and 2, PCR of target DNA with SO1/IR1 and SO2/IF1 oligonucleotides; Lane 3, homomeric (type A) and heteromeric (type C) DNA molecules formed during ligation of SO1/IR1 and SO2/IF1 DNA fragments (also, see Figure 1); Lane 4, suppression PCR with SO1 and SO2 oligonucleotides. The scheme on the right shows a graphical representation of type A and type C molecules that are present in lane 3 of the gel. During suppression PCR, intramolecular hybridization of inverted repeat sequences prevents binding of SO1 and SO2 oligonucleotides to the type A molecules that prevent their effective replication. Type C molecules amplify exponentially (see Additional File 1 for further details). Lane M, DNA size ladder with indicated positions of 1, 2, 3, 4, 6, and 10 kb DNA fragments (GeneRuler 1 kb DNA Ladder, Fermentas).

    Journal: BMC Biotechnology

    Article Title: MALS: an efficient strategy for multiple site-directed mutagenesis employing a combination of DNA amplification, ligation and suppression PCR

    doi: 10.1186/1472-6750-9-83

    Figure Lengend Snippet: Agarose gel electrophoregram demonstrating the types of molecules forming during one individual round of mutagenesis . Lanes 1 and 2, PCR of target DNA with SO1/IR1 and SO2/IF1 oligonucleotides; Lane 3, homomeric (type A) and heteromeric (type C) DNA molecules formed during ligation of SO1/IR1 and SO2/IF1 DNA fragments (also, see Figure 1); Lane 4, suppression PCR with SO1 and SO2 oligonucleotides. The scheme on the right shows a graphical representation of type A and type C molecules that are present in lane 3 of the gel. During suppression PCR, intramolecular hybridization of inverted repeat sequences prevents binding of SO1 and SO2 oligonucleotides to the type A molecules that prevent their effective replication. Type C molecules amplify exponentially (see Additional File 1 for further details). Lane M, DNA size ladder with indicated positions of 1, 2, 3, 4, 6, and 10 kb DNA fragments (GeneRuler 1 kb DNA Ladder, Fermentas).

    Article Snippet: After amplification, the resulting DNA fragments were extracted from PCR mixtures using Wizard PCR Preps DNA Purification System (Promega, Madison, USA).

    Techniques: Agarose Gel Electrophoresis, Mutagenesis, Polymerase Chain Reaction, Ligation, Hybridization, Binding Assay