Structured Review

Promega wizard pcr clean up system kit
Wizard Pcr Clean Up System Kit, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wizard pcr clean up system kit/product/Promega
Average 94 stars, based on 5 article reviews
Price from $9.99 to $1999.99
wizard pcr clean up system kit - by Bioz Stars, 2020-03
94/100 stars

Images

Related Articles

DNA Extraction:

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. This was followed by plasmid DNA extraction using an UltraClean mini plasmid prep purification kit (MO BIO Laboratories, California, USA).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. Several recombinant clones were grown for plasmid DNA extraction with an UltraClean mini plasmid prep purification kit (MO BIO Laboratories).

Clone Assay:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: Paragraph title: 5. DNA collection, PCR and cloning ... The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega).

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: Construction of the vector pTEX-TcNMNAT and T. cruzi epimastigotetransfection - In order to increase the NMNAT levels in the parasite and get clearer signals, we cloned the TcNMNAT coding sequence in the pTEX vector, a T.cruzi expression construct. .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. Several recombinant clones were grown for plasmid DNA extraction with an UltraClean mini plasmid prep purification kit (MO BIO Laboratories).

Amplification:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: Eukaryotic 18S rRNA genes (≈1800 bp) were amplified using the eukaryotic-specific primer set Euk A/Euk B according to Bazin et al. . .. The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega).

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: Polymerase chain reaction (PCR) amplification was performed using the plasmid TcNMNAT-pET100, which has been previously described previously , as the template. .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: .. A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. The purified products were ligated into pEXP5-CT/TOPO expression vector (Invitrogen) and each recombinant construct was used for transforming E . coli TOP-10 cells (Invitrogen).

Electroporation:

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega). .. For the electroporation, 5x107 parasites were centrifuged at 1000 × g for 10 min at 4ºC, resuspended in sterile electroporation buffer (137 mM NaCl, 5 mM KCl, 5.5 mM Na2 HPO4 , 0.77 mM glucose, 21 mM HEPES, pH 7.2) and mixed with 30 µg of the plasmid.

Subcloning:

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega). .. Both the pTEX vector and the TcNMNAT-pGEM®-T Easy vector were digested with EcoRI and BamHI (Fermentas).

Construct:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega). .. Clone libraries were constructed using the pCR2.1 TOPO-TA cloning kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: Construction of the vector pTEX-TcNMNAT and T. cruzi epimastigotetransfection - In order to increase the NMNAT levels in the parasite and get clearer signals, we cloned the TcNMNAT coding sequence in the pTEX vector, a T.cruzi expression construct. .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. The purified products were ligated into pEXP5-CT/TOPO expression vector (Invitrogen) and each recombinant construct was used for transforming E . coli TOP-10 cells (Invitrogen).

Purification:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega). .. PCR products containing amplicons of the target size were purified and sequenced with an ABI Prism 3100 (Applied Biosystems, Foster City, CA, USA).

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega). .. Both the pTEX vector and the TcNMNAT-pGEM®-T Easy vector were digested with EcoRI and BamHI (Fermentas).

Modification:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: As described in detail in Bazin et al. , total DNA was extracted using the Invisorb Spin Plant mini Kit (Invitek, Berlin, Germany) with modification of the first steps of the manufacturer's protocol, including cutting filters into pieces and cell disruption by thermal shocks (three freeze-thaw cycles: liquid nitrogen/+65°C). .. The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega).

Polymerase Chain Reaction:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: .. The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega). .. Clone libraries were constructed using the pCR2.1 TOPO-TA cloning kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega). .. Both the pTEX vector and the TcNMNAT-pGEM®-T Easy vector were digested with EcoRI and BamHI (Fermentas).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: .. A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. The purified products were ligated into pEXP5-CT/TOPO expression vector (Invitrogen) and each recombinant construct was used for transforming E . coli TOP-10 cells (Invitrogen).

Expressing:

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: Construction of the vector pTEX-TcNMNAT and T. cruzi epimastigotetransfection - In order to increase the NMNAT levels in the parasite and get clearer signals, we cloned the TcNMNAT coding sequence in the pTEX vector, a T.cruzi expression construct. .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. The purified products were ligated into pEXP5-CT/TOPO expression vector (Invitrogen) and each recombinant construct was used for transforming E . coli TOP-10 cells (Invitrogen).

Sequencing:

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: Designing primers and amplifying dbp gene regions by PCR Two sets of specific primers for amplifying P. vivax Pv DBP protein RII (forward: 5′ ATGTCGAATGGTGGCAATCCT 3′; reverse: 5′ GGTGGCCTGAGATTTAGC 3′) and RIII/V (forward: 5′ ATGGCTAAAAATGTTGATCCGCA 3′; reverse 5′ GTTAGTTGTATCATTAGTAGTT 3′) fragments were manually designed (using Gene runner software, version 3.05) on a pvdbp gene sequence from the Salvador-I (Sal-I) reference strain reported in the PlasmoDB database (Gene ID: PVX_110810) [ , ]. .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen).

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: Construction of the vector pTEX-TcNMNAT and T. cruzi epimastigotetransfection - In order to increase the NMNAT levels in the parasite and get clearer signals, we cloned the TcNMNAT coding sequence in the pTEX vector, a T.cruzi expression construct. .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: The proviral DNA was then used as template in PCR reactions for which specific primers were designed for amplifying gp51 fragments from the FLK reference sequence deposited in the NCBI database (accession number M35242). .. A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels.

Recombinant:

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: Paragraph title: Obtaining recombinant protein gp51 ... A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels.

Transformation Assay:

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Countercurrent Chromatography:

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: The primers used contained a restriction site for BamHI in the 5′ end (5′-CGG GAT CCC GAT GAG CGA TGA CAC AT-3′) and a restriction site for EcoRI in the 3′ end (5′-CCG GAA TTC CGG TCA ACA ATT TTG AGT ATT-3′). .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega).

Plasmid Preparation:

Article Title: Phytoplankton Diversity and Community Composition along the Estuarine Gradient of a Temperate Macrotidal Ecosystem: Combined Morphological and Molecular Approaches
Article Snippet: The conditions were as follows: an initial hot-start at 95°C for 10 min, followed by 30 cycles (95°C for 1 min, 1.5 min at 50/55°C, 72°C for 2 min) and a final extension at 72°C for 10 min. Several replicates of PCR products were pooled and cleaned with the Wizard PCR clean-up system kit (Promega). .. The presence of inserts in the putative positive colonies was checked using flanking vector primers (M13).

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen). .. Several recombinant clones were grown for 16 h at 37 °C at 270 rpm in Luria Bertani (LB) medium, supplemented with ampicillin (100 µg/mL), using a Lab-line Incubator Shaker.

Article Title: Nicotinamide mononucleotide adenylyltransferase of Trypanosomacruzi (TcNMNAT): a cytosol protein target for serine kinases
Article Snippet: .. The PCR product of 896 bp was purified using a Wizard® PCR Clean-Up System kit, and the purified product was used to perform subcloning in the pGEM®-T Easy Vector System according to the manufacturer’s instructions (Promega). .. Both the pTEX vector and the TcNMNAT-pGEM®-T Easy vector were digested with EcoRI and BamHI (Fermentas).

Article Title: In silico and in vitro analysis of boAP3d1 protein interaction with bovine leukaemia virus gp51
Article Snippet: A Wizard PCR Clean-Up System kit (Promega) was used for purifying PCR products; amplicon quality was then evaluated on 1.5% agarose gels. .. The purified products were ligated into pEXP5-CT/TOPO expression vector (Invitrogen) and each recombinant construct was used for transforming E . coli TOP-10 cells (Invitrogen).

Software:

Article Title: Easy and fast method for expression and native extraction of Plasmodium vivax Duffy binding protein fragments
Article Snippet: Designing primers and amplifying dbp gene regions by PCR Two sets of specific primers for amplifying P. vivax Pv DBP protein RII (forward: 5′ ATGTCGAATGGTGGCAATCCT 3′; reverse: 5′ GGTGGCCTGAGATTTAGC 3′) and RIII/V (forward: 5′ ATGGCTAAAAATGTTGATCCGCA 3′; reverse 5′ GTTAGTTGTATCATTAGTAGTT 3′) fragments were manually designed (using Gene runner software, version 3.05) on a pvdbp gene sequence from the Salvador-I (Sal-I) reference strain reported in the PlasmoDB database (Gene ID: PVX_110810) [ , ]. .. PCR for amplifying pvdbp fragments began with a denaturing step at 95 °C for 5 min, followed by 35 cycles at 98 °C for 20 s, 56 °C for 15 s and 72 °C for 1 min and a final extension step at 72 °C for 5 min. PCR products were purified using a Wizard PCR Clean-Up System kit (Promega, Madison, USA), ligated into pEXP5-CT/TOPO expression vector (Invitrogen, Carlsbad, USA) and then transformed in TOP-10 E. coli cells (Invitrogen).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega wizard pcr preps dna purification system
    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the <t>LSSP-PCR</t> reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb <t>DNA</t> ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.
    Wizard Pcr Preps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 208 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr preps dna purification system/product/Promega
    Average 99 stars, based on 208 article reviews
    Price from $9.99 to $1999.99
    wizard pcr preps dna purification system - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Promega wizard dna clean up system
    <t>PCR</t> amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 <t>DNA/</t> Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.
    Wizard Dna Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard dna clean up system/product/Promega
    Average 99 stars, based on 289 article reviews
    Price from $9.99 to $1999.99
    wizard dna clean up system - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    99
    Promega wizard sv gel and pcr clean up system
    Identification of osKaR insertion site Arbitrary-primed <t>PCR</t> (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer <t>Deg4.</t> The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.
    Wizard Sv Gel And Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard sv gel and pcr clean up system/product/Promega
    Average 99 stars, based on 101 article reviews
    Price from $9.99 to $1999.99
    wizard sv gel and pcr clean up system - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results


    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Migration

    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Negative Control, Migration

    PCR analysis of A. xylosoxidans and related species. Lanes: M, DNA marker; 1, A. xylosoxidans AU0665; 2, A. xylosoxidans AU1011; 3, A. xylosoxidans ATCC9220; 4, A. piechaudii LMG 1873 T ; 5, A. ruhlandii LMG 1866 T ; 6, A. denitrificans LMG 1231 T ; 7, Alcaligenes faecalis LMG 1229 T ; 8, Bordetella hinzii LMG 13501 T ; 9, Bordetella pertussis LMG 14455 T ; 10, Bordetella parapertussis LMG 14449 T ; 11, Bordetella bronchiseptica LMG 1231 T ; 12, Burkholderia cepacia genomovar III HI2147; 13, Pandoraea apista AU0003; 14, Pseudomonas aeruginosa AU0225.

    Journal: Journal of Clinical Microbiology

    Article Title: Ribosomal DNA-Directed PCR for Identification of Achromobacter (Alcaligenes) xylosoxidans Recovered from Sputum Samples from Cystic Fibrosis Patients

    doi: 10.1128/JCM.40.4.1210-1213.2002

    Figure Lengend Snippet: PCR analysis of A. xylosoxidans and related species. Lanes: M, DNA marker; 1, A. xylosoxidans AU0665; 2, A. xylosoxidans AU1011; 3, A. xylosoxidans ATCC9220; 4, A. piechaudii LMG 1873 T ; 5, A. ruhlandii LMG 1866 T ; 6, A. denitrificans LMG 1231 T ; 7, Alcaligenes faecalis LMG 1229 T ; 8, Bordetella hinzii LMG 13501 T ; 9, Bordetella pertussis LMG 14455 T ; 10, Bordetella parapertussis LMG 14449 T ; 11, Bordetella bronchiseptica LMG 1231 T ; 12, Burkholderia cepacia genomovar III HI2147; 13, Pandoraea apista AU0003; 14, Pseudomonas aeruginosa AU0225.

    Article Snippet: The resultant amplicons were purified by using the Promega Wizard PCR Prep DNA purification kit (Promega, Madison, Wis.) according to the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction, Marker

    PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Polymerase Chain Reaction, Amplification, Marker, Modification

    Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Methylation, Combined Bisulfite Restriction Analysis Assay, Amplification, Polymerase Chain Reaction

    Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Journal: Current protocols in microbiology

    Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

    doi: 10.1002/9780471729259.mc09d03s30

    Figure Lengend Snippet: Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Article Snippet: Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282)

    Techniques: Polymerase Chain Reaction, Mutagenesis, Purification, DNA Sequencing