Structured Review

Promega wizard pcr clean up kit
Human PRNP octarepeat sequences and cloned octarepeats for instability analysis. (A) Wild type and mutant human octarepeat sequences. In the mutant octarepeats, the mutated bases are in bold case and underlined. R14 could be a chimera repeat between R1 and R4; R1a could be a chimera repeat between R1 and R3; R2a could be a chimera between R2 and R3. The repeats in pOct5, pOct11a and pOct11b are listed. (B) Diagram of cloned wild type human PRNP octarepeats used for instability analysis. PrP-Oct5: a region encompassing the wild type PrP ORF (762 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into <t>pGEM-T</t> after <t>PCR</t> amplification (template: wt human genomic DNA, primers: 42F and 45R). pOct5: the wild type octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct5, primers: HP20 and HP306r). Arrows denote the primers. (C) Diagram of cloned insertion mutant human PRNP octarepeats used for instability analysis. PrP-Oct11a or PrP-Oct11b: a region encompassing an 11-repeat mutant PrP ORF (906 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: one of two human genomic DNA samples containing different 11-repeat octarepeats, primers: 42F and 45R). pOct11a or pOct11b: the 11-repeat octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct11a or PrP-11b, primers: HP20 and HP306r). Arrows denote the primers.
Wizard Pcr Clean Up Kit, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/wizard pcr clean up kit/product/Promega
Average 99 stars, based on 3 article reviews
Price from $9.99 to $1999.99
wizard pcr clean up kit - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026635

Human PRNP octarepeat sequences and cloned octarepeats for instability analysis. (A) Wild type and mutant human octarepeat sequences. In the mutant octarepeats, the mutated bases are in bold case and underlined. R14 could be a chimera repeat between R1 and R4; R1a could be a chimera repeat between R1 and R3; R2a could be a chimera between R2 and R3. The repeats in pOct5, pOct11a and pOct11b are listed. (B) Diagram of cloned wild type human PRNP octarepeats used for instability analysis. PrP-Oct5: a region encompassing the wild type PrP ORF (762 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: wt human genomic DNA, primers: 42F and 45R). pOct5: the wild type octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct5, primers: HP20 and HP306r). Arrows denote the primers. (C) Diagram of cloned insertion mutant human PRNP octarepeats used for instability analysis. PrP-Oct11a or PrP-Oct11b: a region encompassing an 11-repeat mutant PrP ORF (906 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: one of two human genomic DNA samples containing different 11-repeat octarepeats, primers: 42F and 45R). pOct11a or pOct11b: the 11-repeat octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct11a or PrP-11b, primers: HP20 and HP306r). Arrows denote the primers.
Figure Legend Snippet: Human PRNP octarepeat sequences and cloned octarepeats for instability analysis. (A) Wild type and mutant human octarepeat sequences. In the mutant octarepeats, the mutated bases are in bold case and underlined. R14 could be a chimera repeat between R1 and R4; R1a could be a chimera repeat between R1 and R3; R2a could be a chimera between R2 and R3. The repeats in pOct5, pOct11a and pOct11b are listed. (B) Diagram of cloned wild type human PRNP octarepeats used for instability analysis. PrP-Oct5: a region encompassing the wild type PrP ORF (762 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: wt human genomic DNA, primers: 42F and 45R). pOct5: the wild type octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct5, primers: HP20 and HP306r). Arrows denote the primers. (C) Diagram of cloned insertion mutant human PRNP octarepeats used for instability analysis. PrP-Oct11a or PrP-Oct11b: a region encompassing an 11-repeat mutant PrP ORF (906 bp), 232 bp upstream non-coding sequence and 271 bp downstream non-coding sequence subcloned into pGEM-T after PCR amplification (template: one of two human genomic DNA samples containing different 11-repeat octarepeats, primers: 42F and 45R). pOct11a or pOct11b: the 11-repeat octarepeat region subcloned into pGEM-T after PCR amplification (template: PrP-Oct11a or PrP-11b, primers: HP20 and HP306r). Arrows denote the primers.

Techniques Used: Clone Assay, Mutagenesis, Sequencing, Polymerase Chain Reaction, Amplification

Schematic diagrams for analysis of octarepeat mutation rate during PCR or replication in E.coli . (A) Measurement of octarepeat mutants resulting from PCR amplification of octarepeats. Cloned PrP ORF sequences (PrP-Oct5 and PrP-Oct11a) were subjected to PCR with primers HP20 and HP306r. The PCR products (depicted in a shaded box), which contained input (green line) and PCR-mutant (red line) octarepeat sequences as well as “paired” molecules (two parallel lines), were cleaned up and ligated to the pGEM-T vector, producing 4 kinds of ligation products: mutant monomer, wild type monomer, wild type dimer, and mutant dimer. The ligation products were transformed into DH5α competent cells, and the resulting colonies were directly examined by PCR with primers HP50f and HP293r. Plasmid DNAs were extracted from colonies containing mutant octarepeats, subjected to restriction analysis with Sac II and Spe I, and sequenced. The number of mutant colonies over the total number of colonies screened was calculated to represent the octarepeat mutation rate during the PCR process. Small oval: individual E.coli cell; big dashed-line oval: E.coli colony. (B) Measurement of octarepeat mutants resulting from DNA replication in E.coli . pOct5 or pOct11b was used to transform competent DH5α or XL-1 Red E.coli cells, and plasmid DNA sample prepared from a single colony (depicted in a shaded box) was used to transform competent DH5α cells. The mutant colonies (containing only mutant plasmid, red dashed-line oval) and new mutant colonies [containing some cells with the NEW replication-mutant octarepeat insert (light purple), light blue dashed-line oval] were screened out as in (A). The number of mutant colonies (excluding the new mutant colonies) over the total number of colonies examined should reflect the octarepeat mutation rate during the 1 st round of plasmid replication and cell division in E.coli (DH5α or XL-1 Red).
Figure Legend Snippet: Schematic diagrams for analysis of octarepeat mutation rate during PCR or replication in E.coli . (A) Measurement of octarepeat mutants resulting from PCR amplification of octarepeats. Cloned PrP ORF sequences (PrP-Oct5 and PrP-Oct11a) were subjected to PCR with primers HP20 and HP306r. The PCR products (depicted in a shaded box), which contained input (green line) and PCR-mutant (red line) octarepeat sequences as well as “paired” molecules (two parallel lines), were cleaned up and ligated to the pGEM-T vector, producing 4 kinds of ligation products: mutant monomer, wild type monomer, wild type dimer, and mutant dimer. The ligation products were transformed into DH5α competent cells, and the resulting colonies were directly examined by PCR with primers HP50f and HP293r. Plasmid DNAs were extracted from colonies containing mutant octarepeats, subjected to restriction analysis with Sac II and Spe I, and sequenced. The number of mutant colonies over the total number of colonies screened was calculated to represent the octarepeat mutation rate during the PCR process. Small oval: individual E.coli cell; big dashed-line oval: E.coli colony. (B) Measurement of octarepeat mutants resulting from DNA replication in E.coli . pOct5 or pOct11b was used to transform competent DH5α or XL-1 Red E.coli cells, and plasmid DNA sample prepared from a single colony (depicted in a shaded box) was used to transform competent DH5α cells. The mutant colonies (containing only mutant plasmid, red dashed-line oval) and new mutant colonies [containing some cells with the NEW replication-mutant octarepeat insert (light purple), light blue dashed-line oval] were screened out as in (A). The number of mutant colonies (excluding the new mutant colonies) over the total number of colonies examined should reflect the octarepeat mutation rate during the 1 st round of plasmid replication and cell division in E.coli (DH5α or XL-1 Red).

Techniques Used: Mutagenesis, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Ligation, Transformation Assay

2) Product Images from "Aberrant Methylation and Down-Regulation of TMS1/ASC in Human Glioblastoma"

Article Title: Aberrant Methylation and Down-Regulation of TMS1/ASC in Human Glioblastoma

Journal: The American Journal of Pathology

doi:

TMS1 methylation and expression in normal brain. A: Normal brain biopsies were obtained from five cancer-free individuals (00-23, 00-06, 99-08, 01-09, 01-08) at autopsy. DNA was isolated from both gray (G) and white (W) matter from each specimen, and was analyzed for methylation of TMS1 by methylation-specific PCR. Parallel amplification reactions were performed using primers specific to the unmethylated (U) or methylated (M) DNA. B: Total RNA isolated from the normal brain tissue (01-86, 99-98) was reverse transcribed (+RT) and amplified using primers specific for TMS1 ( top ) or human β-actin ( bottom ). Control reactions in which reverse transcriptase was omitted (−RT) were amplified under the same conditions.
Figure Legend Snippet: TMS1 methylation and expression in normal brain. A: Normal brain biopsies were obtained from five cancer-free individuals (00-23, 00-06, 99-08, 01-09, 01-08) at autopsy. DNA was isolated from both gray (G) and white (W) matter from each specimen, and was analyzed for methylation of TMS1 by methylation-specific PCR. Parallel amplification reactions were performed using primers specific to the unmethylated (U) or methylated (M) DNA. B: Total RNA isolated from the normal brain tissue (01-86, 99-98) was reverse transcribed (+RT) and amplified using primers specific for TMS1 ( top ) or human β-actin ( bottom ). Control reactions in which reverse transcriptase was omitted (−RT) were amplified under the same conditions.

Techniques Used: Methylation, Expressing, Isolation, Polymerase Chain Reaction, Amplification

Related Articles

Clone Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Paragraph title: Rescue cloning of two nonmucoid mutants. ... The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Centrifugation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Nuclei were enriched by centrifugation and lysed in ChIP-buffer (50 mM Tris-Cl, pH 8.0; 10 mM ethylenediaminetetraacetic acid (EDTA); 1% sodium dodecyl sulphate (SDS); protease inhibitors) before chromatin was sheared by sonification. .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Amplification:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: Approximately 340 bp of the 16S rRNA gene of Escherichia coli No. 341–534 were amplified by PCR using the Lac1 and Lac2GC primer sets [ ]. .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Synthesized:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: The selected amiRNA (TTAATGCGTATCTGTACCATG) was synthesized by fusion PCR ( Supplementary Table S1 ) using Expand Taq (Roche) and osa -mir528 ( ) endogenous miRNA precursor as stem–loop backbone ( ). .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Construct:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Real-time Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Incubation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: For ChIP, 25 μg of sheared chromatin was incubated with control (anti-IgG, Abcam ab171870) or anti-SRF (NEB 5147) antibodies overnight in dilution buffer (10 mM Tris-Cl, pH 8.0; 150 mM NaCl; 1 mM EDTA; 0.1% SDS; 1% Triton X-100; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: The following day, the samples were incubated with 10 µg of RNase A at 37°C for 1 hour, and then with 10 µg of Proteinase K at 45°C for 2 hours. .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA extraction After elution of the chromatin from the beads, 100 µg/ml proteinase K was added and samples were incubated for 2 h at 55°C. .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Expressing:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: Paragraph title: Construction of RNA silencing expression vectors ... After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

Transformation Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: These plasmids were amplified and linearized by Sca I for transformation. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Derivative Assay:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Hybridization:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Ligation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Protease Inhibitor:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Polymerase Chain Reaction:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sequencing:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: PIP2;2 was digested with Bmg BI/ Acl I and Nhe I/ Bfr BI, to give two fragments: one of 760 bp and one of 638 bp (corresponding to 577 bp of the genomic sequence). .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Sonication:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: 150 ml of yeast culture (OD 0.6) was cross-linked in 1% formaldehyde for 30 min and successively quenched in 125 mM glycine for 5 min. Cross-linked material was resuspended in 400 μl lysis buffer (50 mM HEPES-KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, protease inhibitor cocktail (Roche)) and subjected to mechanical lysis with glass beads using the FastPrep FP120 apparatus (Bio101 Thermo Savant, Qbiogene) three times 6 m/s for 30 s. Lysates were centrifuged for 30 min at 16,000 g, and pellets were re-suspended in 500 μl lysis buffer and sonicated in a Bioruptor UCD-200 (Diagenode) three times at high power with 30-s intervals for 15 min. Sonicated material was centrifuged for 15 min at 10,000 g, and supernatant containing fragmented chromatin was recovered. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Binding Assay:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: An amiRNA was selected from the list of potential amiRNAs based on its binding energy and specificity with the target gene. .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α.

DNA Extraction:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: Paragraph title: Sample Collection, DNA Extraction, and mt Genome Amplification ... PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: Paragraph title: DNA extraction ... DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit.

Fluorescence:

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Mutagenesis:

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: Two nonmucoid mutants, D12 and F6 (Table ), were chosen from the mutant library for further analysis based on their nonpathogenic phenotypes in pathogenicity assays. .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C.

Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)
Article Snippet: .. Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282) .. 1 Set up the first PCR (AP-PCR #1) using 1 μl of genomic DNA, 1 μl of primers oPCR1 and Deg3 (10 μM each) using Taq .

Isolation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Purification:

Article Title: Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing
Article Snippet: .. After PCR purification using Wizard SV PCR Clean-up System (Promega), the amiRNA precursor (254 bp) was cloned into pGEM-T Easy (Promega) using E. coli DH5α. .. The resulting amiRNA (ami-BEIIb) was cloned in the forward orientation as described above.

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega). .. Next-Generation Sequencing of the Coding Regions of mt Minichromosomes Purified PCR amplicons generated above with primers PLF1 and PLR from the coding regions of the mt minichromosomes of the domestic pig louse and the wild pig louse were sequenced initially with Roche GS FLX (454) platform at the AGRF and then with Illumina Hiseq 2000 platform at the Beijing Genomics Institute (BGI) for deeper coverages.

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Article Title: Requirement of the galU Gene for Polysaccharide Production by and Pathogenicity and Growth In Planta of Xanthomonas citri subsp. citri ▿
Article Snippet: .. The digested DNA was purified using the Wizard SV gel and PCR clean-up system (Promega, Madison, WI) and allowed to self-ligate in the presence of T4 DNA ligase in a 10-μl mixture for 4 h at 16°C. .. The ligation mixture was electroporated into electrocompetent E. coli TransforMax EC100D pir + (Epicentre, Madison, WI).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Dot Blot:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: .. DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system. .. Protein expression and purification The cold-induced expression of the His-tagged human Ssu72 in E. coli was performed according to the instruction of pCold-II vector (TaKaRa).

Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR). .. RNA immunoprecipitation (RIP) and quantitative RT-PCR analyses were performed essentially as recently described ( ).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Quantitative RT-PCR:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Lysis:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: In brief, ∼2.5 × 107 ES-2 cells were treated with formaldehyde, quenched and harvested in lysis buffer (10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.9; 7.2 mM KOH; 150 mM KCl; 5 mM MgCl2 ; 0.5% NP-40; protease inhibitors). .. DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Beads were washed three times in lysis buffer, once in lysis buffer containing 500 mM NaCl, once in wash buffer (10 mM Tris–HCl pH 7.5, 0.25 M LiCl, 0.5% Nonidet P40, 0.5% sodium deoxycholate) and once in lysis buffer. .. Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Chromatin Immunoprecipitation:

Article Title: IGF2BP1 promotes SRF-dependent transcription in cancer in a m6A- and miRNA-dependent manner
Article Snippet: Paragraph title: ChIP, RIP and RT-qPCR ... DNA was finally eluted using the WIZARD® SV Gel & PCR Clean-Up System (Promega A9281) according to the manufacturer’s protocol and analyzed by quantitative real-time PCR (qPCR).

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega).

Article Title: Vertebrate Ssu72 Regulates and Coordinates 3′-End Formation of RNAs Transcribed by RNA Polymerase II
Article Snippet: Paragraph title: Chromatin immunoprecipitation analysis (ChIP) ... DNA fragments were purified using Wizard SV Gel and the PCR Clean-Up System (Promega), and subjected to RT-PCR using SYBR Premix Ex Taq II (TaKaRa) on an Mx3000P Real-time PCR system.

Plasmid Preparation:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: .. Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. Escherichia coli XL-1 blue cells were transformed with the products of the ligation reactions and plated on Luria-Bertani- (LB-) ampicillin plate to select the transformed colonies.

SYBR Green Assay:

Article Title: Fission yeast Cactin restricts telomere transcription and elongation by controlling Rap1 levels
Article Snippet: Immunoprecipitated chromatin was eluted in elution buffer (1% SDS, 100 mM sodium bicarbonate, 40 mg/ml RNase A) and incubated at 37°C for 1 h. Cross-links were reversed at 65°C for 16 h and DNA purified with the Wizard SV Gel and PCR Clean-Up System (Promega). .. Immunoprecipitated DNA was quantified by real-time PCR using the LightCycler SYBR Green I Master mix (Roche) on a Rotor-Gene Q instrument (QIAGEN) or by dot blot hybridization with a radiolabeled telomeric probe.

Denaturing Gradient Gel Electrophoresis:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA). .. The primers used for sequencing were the same as those used for the re-amplification of DNAs from DGGE bands.

Agarose Gel Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Electrophoresis:

Article Title: Substantial Variation in the Extent of Mitochondrial Genome Fragmentation among Blood-Sucking Lice of Mammals
Article Snippet: PCR amplicons were checked by agarose-gel (1%) electrophoresis. .. PCR amplicons used for sequencing were purified with Wizard SV Gel/PCR Clean-up System (Promega).

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Knock-Out:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: Paragraph title: Knockout Constructs for PIP2;1 , PIP2;2 , and PIP2;3 ... Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Produced:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: For PIP2;3 two fragments (679 and 568 bp) were produced by digestion with Cla I/ Pml I and Spe I/ Xba I. .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL.

Concentration Assay:

Article Title: Water Transport by Aquaporins in the Extant Plant Physcomitrella patens 1 1 [W]
Article Snippet: .. Linear DNA was purified by the Wizard SV Gel and PCR Clean-Up System from Promega, and then resuspended in sterile water at a concentration of 0.5 mg/mL. .. Protoplasts were isolated from a 7-d-old protonematal culture by incubation for 30 min in 1% driselase (D8037; Sigma) and dissolved in 0.48 m mannitol as previously described ( ).

DNA Purification:

Article Title: Generation of HIV-1 and Internal Control Transcripts as Standards for an In-House Quantitative Competitive RT-PCR Assay to Determine HIV-1 Viral Load
Article Snippet: Cloning of the Amplified HIV-1 and IC Fragments into the pGEM-T Vector The amplified HIV-1 and IC fragments were gel-purified using the Wizard SV Gel and PCR Clean-Up System (Promega, USA) and cloned into the pGEM-T vector following the manufacturer's instructions (pGEM-T and pGEM-T Easy Vector Systems, Promega, USA). .. The plasmid DNA was isolated and purified from the colonies using the Wizard plus SV Minipreps DNA Purification System (Promega, USA), and PCR amplified to check the orientation of the cloned HIV-1 and IC fragments.

Article Title: Human centromeric CENP-A chromatin is a homotypic, octameric nucleosome at all cell cycle points
Article Snippet: .. DNA was purified from proteinase K–treated samples using a DNA purification kit following the manufacturer instructions (A9282; Promega) and was subsequently analyzed either by running a 2% low melting agarose (APEX) gel or by an Agilent Technologies 2100 Bioanalyzer by using the DNA 1000 kit. .. The Bioanalyzer determines the quantity of DNA on the basis of fluorescence intensity.

Staining:

Article Title: Anti-inflammatory and Intestinal Barrier-protective Activities of Commensal Lactobacilli and Bifidobacteria in Thoroughbreds: Role of Probiotics in Diarrhea Prevention in Neonatal Thoroughbreds
Article Snippet: After electrophoresis, the gels were stained for 15 min using an ethidium bromide solution (250 ml TAE buffer + 25 µl of 10 mg/ml ethidium bromide solution). .. The PCR products derived from the DGGE bands were purified with the Wizard SV Gel and PCR Clean-up system (Promega Co., Madison, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega wizard pcr preps dna purification system
    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the <t>LSSP-PCR</t> reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb <t>DNA</t> ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.
    Wizard Pcr Preps Dna Purification System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 208 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard pcr preps dna purification system/product/Promega
    Average 99 stars, based on 208 article reviews
    Price from $9.99 to $1999.99
    wizard pcr preps dna purification system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega wizard dna clean up system
    <t>PCR</t> amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 <t>DNA/</t> Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.
    Wizard Dna Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 289 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard dna clean up system/product/Promega
    Average 99 stars, based on 289 article reviews
    Price from $9.99 to $1999.99
    wizard dna clean up system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Promega wizard sv gel and pcr clean up system
    Identification of osKaR insertion site Arbitrary-primed <t>PCR</t> (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer <t>Deg4.</t> The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.
    Wizard Sv Gel And Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 101 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/wizard sv gel and pcr clean up system/product/Promega
    Average 99 stars, based on 101 article reviews
    Price from $9.99 to $1999.99
    wizard sv gel and pcr clean up system - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from the canine reservoir. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 11: genotype I (lanes 2–3: CB2 and CP3); genotype II (lane 4: CP5); genotype III (lanes 5–6: CB7 and CP2); genotype IV (lane 7: CP6); genotype V (lane 8: CB3); genotype VI (lane 9: IPT1); genotype VII (lane 10: CB10); genotype VIII (lane 11: CB4). Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Migration

    KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Journal: PLoS ONE

    Article Title: KDNA Genetic Signatures Obtained by LSSP-PCR Analysis of Leishmania (Leishmania) infantum Isolated from the New and the Old World

    doi: 10.1371/journal.pone.0043363

    Figure Lengend Snippet: KDNA signatures of the 447-bp minicircle fragment of L. infantum ( = L. chagasi ) strains isolated from human patients. Five µ l of the LSSP-PCR reaction products, were loaded in each lane of a 6% polyacrylamide gel and silver stained. Lanes 2 to 17: genotype I (lanes 2–4: HP7, HB5 and HB9); genotype II (lanes 5–6: HP10 and HP1); genotype III (lanes 7–8: HP6 and HB6); genotype VI (lane 9: HP5); genotype VII (lane 10: HB8); genotype VIII (lane 11: HP3); genotype IX (lane 12: HP8); genotype IV (lanes 13–14: HB4 and HB9); genotype V (lanes 15–16: HP4 and PP75); lane 17 the negative control of the LSSP-PCR reaction. Migration of the markers of the 1 Kb DNA ladder (Life Technologies, Inc., Gaithersburg, MD) is shown in lane 1, with the following molecular sizes (from the bottom up): 75, 134, 154, 201, 220, 298, 344, 396, 506, 517, 1018 and 1636 bp. Genotypes are indicated by roman numbers.

    Article Snippet: LSSP-PCR Analysis For the production of kDNA signatures from the 447 bp L. infantum kDNA fragments, PCR products were purified by using the kit Wizard® PCR Preps – DNA purification System (Promega).

    Techniques: Isolation, Polymerase Chain Reaction, Staining, Negative Control, Migration

    PCR analysis of A. xylosoxidans and related species. Lanes: M, DNA marker; 1, A. xylosoxidans AU0665; 2, A. xylosoxidans AU1011; 3, A. xylosoxidans ATCC9220; 4, A. piechaudii LMG 1873 T ; 5, A. ruhlandii LMG 1866 T ; 6, A. denitrificans LMG 1231 T ; 7, Alcaligenes faecalis LMG 1229 T ; 8, Bordetella hinzii LMG 13501 T ; 9, Bordetella pertussis LMG 14455 T ; 10, Bordetella parapertussis LMG 14449 T ; 11, Bordetella bronchiseptica LMG 1231 T ; 12, Burkholderia cepacia genomovar III HI2147; 13, Pandoraea apista AU0003; 14, Pseudomonas aeruginosa AU0225.

    Journal: Journal of Clinical Microbiology

    Article Title: Ribosomal DNA-Directed PCR for Identification of Achromobacter (Alcaligenes) xylosoxidans Recovered from Sputum Samples from Cystic Fibrosis Patients

    doi: 10.1128/JCM.40.4.1210-1213.2002

    Figure Lengend Snippet: PCR analysis of A. xylosoxidans and related species. Lanes: M, DNA marker; 1, A. xylosoxidans AU0665; 2, A. xylosoxidans AU1011; 3, A. xylosoxidans ATCC9220; 4, A. piechaudii LMG 1873 T ; 5, A. ruhlandii LMG 1866 T ; 6, A. denitrificans LMG 1231 T ; 7, Alcaligenes faecalis LMG 1229 T ; 8, Bordetella hinzii LMG 13501 T ; 9, Bordetella pertussis LMG 14455 T ; 10, Bordetella parapertussis LMG 14449 T ; 11, Bordetella bronchiseptica LMG 1231 T ; 12, Burkholderia cepacia genomovar III HI2147; 13, Pandoraea apista AU0003; 14, Pseudomonas aeruginosa AU0225.

    Article Snippet: The resultant amplicons were purified by using the Promega Wizard PCR Prep DNA purification kit (Promega, Madison, Wis.) according to the manufacturer's instructions.

    Techniques: Polymerase Chain Reaction, Marker

    PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: PCR amplification of CpG islands. ( A ) 294 bp human hMLH1 promoter from colon cancer cell line RKO; ( B ) 605 bp human Cox-2 promoter from gastric cancer cell line MKN45. M1, puC18 DNA/ Hea III marker; M2, 1 kb DNA ladder (Gibco no. 15615-016); lanes 1 and 4, untreated DNA; lanes 2 and 3, bisulfite-modified template.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Polymerase Chain Reaction, Amplification, Marker, Modification

    Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Journal: Nucleic Acids Research

    Article Title: Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography

    doi:

    Figure Lengend Snippet: Detection of methylation in the hMLH1 promoter by Bst UI COBRA assay in the RKO and PACM82 cell lines. DNA without or with bisulfite treatment was amplified by PCR or ssPCR. The amplicon mixture was digested with Bst UI at 60°C for 3 h. M1, PCR and ssPCR as in Figure 1.

    Article Snippet: One microgram of genomic DNA was treated with sodium bisulfite as described ( ) and the Wizard DNA Clean-Up System Kit (A7280; Promega), subsequently used prior to PCR amplification.

    Techniques: Methylation, Combined Bisulfite Restriction Analysis Assay, Amplification, Polymerase Chain Reaction

    Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Journal: Current protocols in microbiology

    Article Title: Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

    doi: 10.1002/9780471729259.mc09d03s30

    Figure Lengend Snippet: Identification of osKaR insertion site Arbitrary-primed PCR (AP-PCR) is a quick method to precisely identify the genomic region where a transposon has inserted. The following is specific for osKaR insertions: genomic DNA of the osKaR mutant is extracted (see Basic Protocol 1) and used for a semi-random PCR using the osKaR -specific primer oPCR1 and the random primer Deg3. The Deg3 primer consists of an 11-nucleotide random primer (in blue) with a 25-nucleotide specific tail (in red). The resulting PCR product is purified and used for a 2 nd PCR using the osKaR -specific primer Anchor1 and the Deg3-tail specific primer Deg4. The resulting PCR product is purified and DNA sequencing is performed using the osKaR -specific primer Anchor2.

    Article Snippet: Genomic DNA of GAS osKaR mutant (see Basic Protocol 1) Primers oPCR1, Deg3, Anchor1, Deg4 and Anchor2 (see recipe) Reagents and equipment for PCR Gel and PCR Clean-Up System kit (Wizard SV, Promega Cat. No. A9282)

    Techniques: Polymerase Chain Reaction, Mutagenesis, Purification, DNA Sequencing