virion dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    New England Biolabs virion dna
    Electron microscopy of RecA filaments in the presence of UvrD. ( A ) An ATPase reaction from which samples were taken at the early RecA stage, during the lag and after the later UvrD stage was achieved. Samples were taken at ∼10 min, 22 min and 35 min, times that correspond to the various stages. Reaction conditions were identical to those utilized in the reaction of Figure 2 , except that 40 nM UvrD helicase was utilized. The RecA stage (10 min), lag (22 min) and UvrD stage (35 min) of the UvrD-mediated displacement reaction are illustrated in panels B , C and D , respectively. A field showing <t>SSB–ssDNA</t> complexes by themselves can be found in Supplementary Figure S1. ( E ) Statistical analysis of the RecA filament distribution in the samples illustrated in panels B–D. Filament categories are explained in Materials and Methods. In general, full, medium, small and very small filaments reflect declining filament lengths. Linear molecules are the subset of filaments present on broken <t>DNA</t> circles. Circular ssDNA molecules coated with SSB (pointed out in panel D) do not contain visible RecA protein. The error bars are representative of a standard deviation of three independent experiments. Molecules counted ( n ) = 580, 675 and 870 for the RecA stage (panel B), the lag (panel C) and the UvrD stage (panel D), respectively.
    Virion Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/virion dna/product/New England Biolabs
    Average 91 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    virion dna - by Bioz Stars, 2020-11
    91/100 stars

    Images

    1) Product Images from "Active displacement of RecA filaments by UvrD translocase activity"

    Article Title: Active displacement of RecA filaments by UvrD translocase activity

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv186

    Electron microscopy of RecA filaments in the presence of UvrD. ( A ) An ATPase reaction from which samples were taken at the early RecA stage, during the lag and after the later UvrD stage was achieved. Samples were taken at ∼10 min, 22 min and 35 min, times that correspond to the various stages. Reaction conditions were identical to those utilized in the reaction of Figure 2 , except that 40 nM UvrD helicase was utilized. The RecA stage (10 min), lag (22 min) and UvrD stage (35 min) of the UvrD-mediated displacement reaction are illustrated in panels B , C and D , respectively. A field showing SSB–ssDNA complexes by themselves can be found in Supplementary Figure S1. ( E ) Statistical analysis of the RecA filament distribution in the samples illustrated in panels B–D. Filament categories are explained in Materials and Methods. In general, full, medium, small and very small filaments reflect declining filament lengths. Linear molecules are the subset of filaments present on broken DNA circles. Circular ssDNA molecules coated with SSB (pointed out in panel D) do not contain visible RecA protein. The error bars are representative of a standard deviation of three independent experiments. Molecules counted ( n ) = 580, 675 and 870 for the RecA stage (panel B), the lag (panel C) and the UvrD stage (panel D), respectively.
    Figure Legend Snippet: Electron microscopy of RecA filaments in the presence of UvrD. ( A ) An ATPase reaction from which samples were taken at the early RecA stage, during the lag and after the later UvrD stage was achieved. Samples were taken at ∼10 min, 22 min and 35 min, times that correspond to the various stages. Reaction conditions were identical to those utilized in the reaction of Figure 2 , except that 40 nM UvrD helicase was utilized. The RecA stage (10 min), lag (22 min) and UvrD stage (35 min) of the UvrD-mediated displacement reaction are illustrated in panels B , C and D , respectively. A field showing SSB–ssDNA complexes by themselves can be found in Supplementary Figure S1. ( E ) Statistical analysis of the RecA filament distribution in the samples illustrated in panels B–D. Filament categories are explained in Materials and Methods. In general, full, medium, small and very small filaments reflect declining filament lengths. Linear molecules are the subset of filaments present on broken DNA circles. Circular ssDNA molecules coated with SSB (pointed out in panel D) do not contain visible RecA protein. The error bars are representative of a standard deviation of three independent experiments. Molecules counted ( n ) = 580, 675 and 870 for the RecA stage (panel B), the lag (panel C) and the UvrD stage (panel D), respectively.

    Techniques Used: Electron Microscopy, Standard Deviation

    UvrD effects on RecA filaments are UvrD concentration-dependent. RecA (2 μM) filaments were allowed to form on 3 μM circular M13mp18 ssDNA in the presence of ATP and SSB (0.3 μM) as described in Materials and Methods. After 15 min (arrow), UvrD was added at the concentrations shown (in nM). The data following this addition have been corrected for a small decline in absorption caused by a dilution effect. The effects of UvrD are detected through changes in the consumption of ATP. The average rate of ATP hydrolysis in the early RecA stage (prior to UvrD addition) is 30 μM/min (yielding an apparent k cat (assuming all potential DNA binding sites are occupied by RecA) of 30 min −1 ), reflecting the near saturation of the 1 μM available RecA binding sites on the ssDNA.
    Figure Legend Snippet: UvrD effects on RecA filaments are UvrD concentration-dependent. RecA (2 μM) filaments were allowed to form on 3 μM circular M13mp18 ssDNA in the presence of ATP and SSB (0.3 μM) as described in Materials and Methods. After 15 min (arrow), UvrD was added at the concentrations shown (in nM). The data following this addition have been corrected for a small decline in absorption caused by a dilution effect. The effects of UvrD are detected through changes in the consumption of ATP. The average rate of ATP hydrolysis in the early RecA stage (prior to UvrD addition) is 30 μM/min (yielding an apparent k cat (assuming all potential DNA binding sites are occupied by RecA) of 30 min −1 ), reflecting the near saturation of the 1 μM available RecA binding sites on the ssDNA.

    Techniques Used: Concentration Assay, Binding Assay

    UvrD inhibits RecA-catalyzed ATPase activity. Reactions were carried out as described in Materials and Methods, and contained 3 μM circular M13mp18 ssDNA and 2 μM RecA protein. The reaction was initiated by addition of ATP (3 mM) and SSB (0.3 μM) as a mixture at t = 0. In the reaction shown, 50 nM UvrD (30 nM) was added at the point indicated by the arrow. The data following this addition have been corrected for a slight decline in absorption caused by a dilution effect. The ATP consumption profile can be divided into three stages. The first stage (prior to UvrD addition) reflects the constant rate of ATPase activity by RecA in the presence of ATP and DNA. A lag stage immediately follows the addition of UvrD and is defined by a decline in ATPase rate. The final stage is the UvrD stage, characterized by a large increase of ATP consumption (greater than the highest level of ATPase possible due to the RecA protein present) attributed to UvrD translocation on the DNA after RecA removal. Confirmation of RecA removal is presented in subsequent figures.
    Figure Legend Snippet: UvrD inhibits RecA-catalyzed ATPase activity. Reactions were carried out as described in Materials and Methods, and contained 3 μM circular M13mp18 ssDNA and 2 μM RecA protein. The reaction was initiated by addition of ATP (3 mM) and SSB (0.3 μM) as a mixture at t = 0. In the reaction shown, 50 nM UvrD (30 nM) was added at the point indicated by the arrow. The data following this addition have been corrected for a slight decline in absorption caused by a dilution effect. The ATP consumption profile can be divided into three stages. The first stage (prior to UvrD addition) reflects the constant rate of ATPase activity by RecA in the presence of ATP and DNA. A lag stage immediately follows the addition of UvrD and is defined by a decline in ATPase rate. The final stage is the UvrD stage, characterized by a large increase of ATP consumption (greater than the highest level of ATPase possible due to the RecA protein present) attributed to UvrD translocation on the DNA after RecA removal. Confirmation of RecA removal is presented in subsequent figures.

    Techniques Used: Activity Assay, Translocation Assay

    ATP hydrolysis by UvrD is required for dismantling RecA filaments. ( A ) RecA filaments formed on circular ssDNA after a 10 min incubation with 1 mM ATPγS. Two full filaments and a very small filament, as well as SSB-coated DNA are present in this image. ( B ) RecA filaments formed as in A), after a six-minute incubation with UvrD. ( C ) RecA filaments formed as in (A) after 50 min incubation with UvrD. No decrease in filamentation can be observed. ( D ) If 3 mM ATP is added with the UvrD helicase, significant disassembly of the RecA filaments is seen after 6 min. Molecules are quantified with RecA and ATPγS alone ( n = 1027 molecules counted and scored), after addition of UvrD ( n = 1187 molecules counted and scored) and after further addition of ATP ( n = 1060 molecules counted and scored). ( E ) Experiment as in panel D, but with less ATPγS (30 μM) added to form the RecA filaments, addition of UvrD, and filaments examined 50 min after further addition of 3 mM ATP. Molecules counted and scored ( n ) = 573 prior to and ( n ) = 581 at 50 min after addition of ATP.
    Figure Legend Snippet: ATP hydrolysis by UvrD is required for dismantling RecA filaments. ( A ) RecA filaments formed on circular ssDNA after a 10 min incubation with 1 mM ATPγS. Two full filaments and a very small filament, as well as SSB-coated DNA are present in this image. ( B ) RecA filaments formed as in A), after a six-minute incubation with UvrD. ( C ) RecA filaments formed as in (A) after 50 min incubation with UvrD. No decrease in filamentation can be observed. ( D ) If 3 mM ATP is added with the UvrD helicase, significant disassembly of the RecA filaments is seen after 6 min. Molecules are quantified with RecA and ATPγS alone ( n = 1027 molecules counted and scored), after addition of UvrD ( n = 1187 molecules counted and scored) and after further addition of ATP ( n = 1060 molecules counted and scored). ( E ) Experiment as in panel D, but with less ATPγS (30 μM) added to form the RecA filaments, addition of UvrD, and filaments examined 50 min after further addition of 3 mM ATP. Molecules counted and scored ( n ) = 573 prior to and ( n ) = 581 at 50 min after addition of ATP.

    Techniques Used: Incubation

    UvrD-mediated disassembly of RecA filaments formed on linear ssDNA. ( A ) WT RecA was allowed to form filaments on 3 μM poly(dT) DNA (average length 225 nucleotides) in the presence of ATP. All reactions in this and subsequent panels that utilize poly(dT) do not include SSB. After 15 min UvrD was titrated into the reactions at final concentrations shown on the graphs (in nM). ( B ) Reactions were carried out as in panel A, but UvrD K35 I was substituted for WT UvrD in the indicated reactions. ( C ) RecA E38K resists inhibition by UvrD. The RecA E38K variant was allowed to form filaments on poly(dT) as in panels A and B, and UvrD was titrated into the reaction at final concentrations (in nM) shown in the figure. ( D ) WT RecA protein was incubated in the presence of ATP either with 3 μM circular M13mp18 ssDNA (dashed lines) or linear M13mp18 ssDNA (solid lines). After 15 min UvrD was titrated into the reactions at the indicated concentrations (in nM). The average rate of RecA-mediated ATP hydrolysis on circular M13mp18 ssDNA is 24 μM/min and on lssM13 DNA is 21 μM/min. These reactions, and those in panel E, included SSB added with the ATP during the initial formation of RecA filaments. ( E ) The RecA E38K mutant was used. The experiment was set up as in C, but linear M13mp18 ssDNA was used in place of poly (dT).
    Figure Legend Snippet: UvrD-mediated disassembly of RecA filaments formed on linear ssDNA. ( A ) WT RecA was allowed to form filaments on 3 μM poly(dT) DNA (average length 225 nucleotides) in the presence of ATP. All reactions in this and subsequent panels that utilize poly(dT) do not include SSB. After 15 min UvrD was titrated into the reactions at final concentrations shown on the graphs (in nM). ( B ) Reactions were carried out as in panel A, but UvrD K35 I was substituted for WT UvrD in the indicated reactions. ( C ) RecA E38K resists inhibition by UvrD. The RecA E38K variant was allowed to form filaments on poly(dT) as in panels A and B, and UvrD was titrated into the reaction at final concentrations (in nM) shown in the figure. ( D ) WT RecA protein was incubated in the presence of ATP either with 3 μM circular M13mp18 ssDNA (dashed lines) or linear M13mp18 ssDNA (solid lines). After 15 min UvrD was titrated into the reactions at the indicated concentrations (in nM). The average rate of RecA-mediated ATP hydrolysis on circular M13mp18 ssDNA is 24 μM/min and on lssM13 DNA is 21 μM/min. These reactions, and those in panel E, included SSB added with the ATP during the initial formation of RecA filaments. ( E ) The RecA E38K mutant was used. The experiment was set up as in C, but linear M13mp18 ssDNA was used in place of poly (dT).

    Techniques Used: Inhibition, Variant Assay, Incubation, Mutagenesis

    Related Articles

    Concentration Assay:

    Article Title: Identification and biosynthesis of thymidine hypermodifications in the genomic DNA of widespread bacterial viruses
    Article Snippet: .. Five micrograms of virion DNA from each of the phages 1.255.O, CBA6, CBA120, and M6 DNA were digested to nucleosides at 0.1–0.2 μg/μL final concentration by treatment overnight at 37 °C with 5 μL of the Nucleoside Digestion Mix in 1× Nucleoside Digestion Mix Reaction Buffer (NEB). .. The resulting DNA nucleoside mixtures were directly analyzed by reversed-phase LC/MS without additional purification.

    Generated:

    Article Title: Active displacement of RecA filaments by UvrD translocase activity
    Article Snippet: .. M13mp18 linear ssDNA was generated by annealing a primer (ACTCTAGAGGATCCCCGGGTAC) to the virion DNA and incubating with BamHI restriction enzyme (New England Biolabs, R0136). .. The DNA was purified by phenol-chloroform extraction and ethanol precipitation.

    Labeling:

    Article Title: Murine Cytomegalovirus CC Chemokine Homolog MCK-2 (m131-129) Is a Determinant of Dissemination That Increases Inflammation at Initial Sites of Infection
    Article Snippet: .. Virion DNA (0.5 to 1.0 μg) was digested with Hin dIII, Bss HII, Afl II, or Spe I (New England Biolabs, Beverly, Mass.) and end labeled in the presence of 2.5 μCi of [α-32 P]dCTP (Amersham), 125 μM each dATP, dGTP, and dTTP, and 0.5 U of Klenow polymerase (Roche, Indianapolis, Ind.) for 15 min at room temperature in 20 μl of restriction enzyme buffer. .. Restriction fragments were separated on a 0.6% agarose gel, which was fixed in 95% ethanol and vacuum dried at 80°C, followed by autoradiography.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    New England Biolabs φx174 am3cs70 single stranded virion dna
    <t>DNA</t> sequencing of φ29 polymerase clones. ( A ) Sequencing of cell-free clones of synthetic <t>φX174</t> molecules. Sequencing was performed after PCR amplification of single-molecule φ29 polymerase reactions. The same region is compared
    φx174 Am3cs70 Single Stranded Virion Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/φx174 am3cs70 single stranded virion dna/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    φx174 am3cs70 single stranded virion dna - by Bioz Stars, 2020-11
    85/100 stars
      Buy from Supplier

    90
    New England Biolabs droplet taqman pcr φx 174 virion dna
    Enrichment of ΦX 174 DNA from a background of Lambda DNA with compound NAC. (a) <t>TaqMan</t> assays detect droplets containing ΦX 174 (green) and Lambda (red) DNA. (b) The microfluidic sorter interrogates the droplets for fluorescence and sorts PCR positives. (i) Scatter plot of fluorescence versus size of drops from first NAC round, with 0.24% positive. (ii) DNA from the first round is recovered, diluted, and processed again. (iii) Scatter plot of fluorescence versus size of drops from the second NAC round, with 0.17% positive. (c) qPCR plots for (i) single and (ii) double-enriched DNA; based on curve shifts, single-round sorting enriches ΦX 174 by ∼150-fold, and double-round sorting by ∼16,000-fold. Inset in (i) shows ΦX 174 and Lambda standard curves.
    Droplet Taqman Pcr φx 174 Virion Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/droplet taqman pcr φx 174 virion dna/product/New England Biolabs
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    droplet taqman pcr φx 174 virion dna - by Bioz Stars, 2020-11
    90/100 stars
      Buy from Supplier

    93
    New England Biolabs virion dna
    ICP8 mediates strand exchange of preresected dsDNA. A, The 1.5 kb 32 P-labeled dsDNA fragment was incubated in strand exchange buffer for 20 minutes in the presence (for lanes 5–8) or absence (for mock, lanes 1–4) of UL12. <t>DNA</t> was deproteinized with proteinase K, extracted with phenol/chloroform, and ethanol-precipitated. This material was resuspended in low TE (10 mM Tris–HCl (pH 7.5), 0.1 mM EDTA) and used in the strand exchange assay. The strand exchange reaction was performed as described in Materials and Methods with 1.6 nM ssM13wins DNA (100 ng) and 1 nM (approximately 20 ng) 1.5 kb 32 P-labeled dsDNA as substrates. Incubation was for 20 minutes at 37 °C. The phosphorimage of the dried gel is presented. B–D, Linear double-stranded <t>ϕX174</t> DNAwas preresected with UL12 and then incubated with circular ϕX174 ssDNA in the presenceofICP8in strand exchange buffer for 10–20 minutes at 37 °C. The samples were deproteinized and complexed with E. coli SSB to extend the single-stranded segments and further prepared for EM as described in Materials and Methods. The expected strand exchange products are seen: alpha (B), sigma (C), and gapped circle (D). The scale bar represents the length of 1000 bp of dsDNA.
    Virion Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/virion dna/product/New England Biolabs
    Average 93 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    virion dna - by Bioz Stars, 2020-11
    93/100 stars
      Buy from Supplier

    Image Search Results


    DNA sequencing of φ29 polymerase clones. ( A ) Sequencing of cell-free clones of synthetic φX174 molecules. Sequencing was performed after PCR amplification of single-molecule φ29 polymerase reactions. The same region is compared

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Cell-free cloning using ?29 DNA polymerase

    doi: 10.1073/pnas.0508809102

    Figure Lengend Snippet: DNA sequencing of φ29 polymerase clones. ( A ) Sequencing of cell-free clones of synthetic φX174 molecules. Sequencing was performed after PCR amplification of single-molecule φ29 polymerase reactions. The same region is compared

    Article Snippet: DNA Preparations. φX174 am3cs70 single-stranded virion DNA and M13mp18 single-stranded virion DNA were obtained from NEB (Beverly, MA).

    Techniques: DNA Sequencing, Clone Assay, Sequencing, Polymerase Chain Reaction, Amplification

    Enrichment of ΦX 174 DNA from a background of Lambda DNA with compound NAC. (a) TaqMan assays detect droplets containing ΦX 174 (green) and Lambda (red) DNA. (b) The microfluidic sorter interrogates the droplets for fluorescence and sorts PCR positives. (i) Scatter plot of fluorescence versus size of drops from first NAC round, with 0.24% positive. (ii) DNA from the first round is recovered, diluted, and processed again. (iii) Scatter plot of fluorescence versus size of drops from the second NAC round, with 0.17% positive. (c) qPCR plots for (i) single and (ii) double-enriched DNA; based on curve shifts, single-round sorting enriches ΦX 174 by ∼150-fold, and double-round sorting by ∼16,000-fold. Inset in (i) shows ΦX 174 and Lambda standard curves.

    Journal: bioRxiv

    Article Title: Sequencing ultra-rare targets with compound nucleic acid cytometry

    doi: 10.1101/2020.09.01.278275

    Figure Lengend Snippet: Enrichment of ΦX 174 DNA from a background of Lambda DNA with compound NAC. (a) TaqMan assays detect droplets containing ΦX 174 (green) and Lambda (red) DNA. (b) The microfluidic sorter interrogates the droplets for fluorescence and sorts PCR positives. (i) Scatter plot of fluorescence versus size of drops from first NAC round, with 0.24% positive. (ii) DNA from the first round is recovered, diluted, and processed again. (iii) Scatter plot of fluorescence versus size of drops from the second NAC round, with 0.17% positive. (c) qPCR plots for (i) single and (ii) double-enriched DNA; based on curve shifts, single-round sorting enriches ΦX 174 by ∼150-fold, and double-round sorting by ∼16,000-fold. Inset in (i) shows ΦX 174 and Lambda standard curves.

    Article Snippet: Droplet TaqMan PCR ΦX 174 virion DNA and Lambda DNA (New England BioLabs) were added to PCR reagents containing 1X Platinum Multiplex PCR Master Mix (Life Technologies, catalog no. 4464269), 200 nM TaqMan probe (IDT), 1 μM forward primer and 1 μM reverse primer (IDT), 2.5% (w/w) Tween® 20 (Fisher Scientific), 2.5% (w/w) Poly(ethylene glycol) 6000 (Sigma-Aldrich) and 0.8 M 1,2-propanediol (Sigma-Aldrich).

    Techniques: Lambda DNA Preparation, Fluorescence, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    ICP8 mediates strand exchange of preresected dsDNA. A, The 1.5 kb 32 P-labeled dsDNA fragment was incubated in strand exchange buffer for 20 minutes in the presence (for lanes 5–8) or absence (for mock, lanes 1–4) of UL12. DNA was deproteinized with proteinase K, extracted with phenol/chloroform, and ethanol-precipitated. This material was resuspended in low TE (10 mM Tris–HCl (pH 7.5), 0.1 mM EDTA) and used in the strand exchange assay. The strand exchange reaction was performed as described in Materials and Methods with 1.6 nM ssM13wins DNA (100 ng) and 1 nM (approximately 20 ng) 1.5 kb 32 P-labeled dsDNA as substrates. Incubation was for 20 minutes at 37 °C. The phosphorimage of the dried gel is presented. B–D, Linear double-stranded ϕX174 DNAwas preresected with UL12 and then incubated with circular ϕX174 ssDNA in the presenceofICP8in strand exchange buffer for 10–20 minutes at 37 °C. The samples were deproteinized and complexed with E. coli SSB to extend the single-stranded segments and further prepared for EM as described in Materials and Methods. The expected strand exchange products are seen: alpha (B), sigma (C), and gapped circle (D). The scale bar represents the length of 1000 bp of dsDNA.

    Journal: Journal of molecular biology

    Article Title: Catalysis of Strand Exchange by the HSV-1 UL12 and ICP8 Proteins: Potent ICP8 Recombinase Activity is Revealed upon Resection of dsDNA Substrate by Nuclease

    doi: 10.1016/j.jmb.2004.07.012

    Figure Lengend Snippet: ICP8 mediates strand exchange of preresected dsDNA. A, The 1.5 kb 32 P-labeled dsDNA fragment was incubated in strand exchange buffer for 20 minutes in the presence (for lanes 5–8) or absence (for mock, lanes 1–4) of UL12. DNA was deproteinized with proteinase K, extracted with phenol/chloroform, and ethanol-precipitated. This material was resuspended in low TE (10 mM Tris–HCl (pH 7.5), 0.1 mM EDTA) and used in the strand exchange assay. The strand exchange reaction was performed as described in Materials and Methods with 1.6 nM ssM13wins DNA (100 ng) and 1 nM (approximately 20 ng) 1.5 kb 32 P-labeled dsDNA as substrates. Incubation was for 20 minutes at 37 °C. The phosphorimage of the dried gel is presented. B–D, Linear double-stranded ϕX174 DNAwas preresected with UL12 and then incubated with circular ϕX174 ssDNA in the presenceofICP8in strand exchange buffer for 10–20 minutes at 37 °C. The samples were deproteinized and complexed with E. coli SSB to extend the single-stranded segments and further prepared for EM as described in Materials and Methods. The expected strand exchange products are seen: alpha (B), sigma (C), and gapped circle (D). The scale bar represents the length of 1000 bp of dsDNA.

    Article Snippet: Phage ϕX174 RF and virion DNA were from New England Biolabs (NEB).

    Techniques: Labeling, Incubation

    Other exonucleases can perform strand exchange with ICP8. A, Strand exchange with full-length M13mp18 substrates was performed as described in Materials and Methods. Incubations were at 37 °C for 10–40 minutes, as indicated. All of the lanes included 100 ng of ssM13mp18 DNA and 100 ng of dsM13mp18 DNA linearized by EcoRI. Lane 1, no protein control; lane 2, 40 minutes incubation with ICP8 only; lanes 3–5, incubation with ICP8 and 13.9 nM UL12 for 10, 20, and 40 minutes, respectively; lanes 6–8, incubation with ICP8 and five units of lambda exonuclease for 10, 20, and 40 minutes, respectively; lanes 9–11, incubation with ICP8 and 100 units of ExoIII for 10, 20, and 40 minutes, respectively. A photograph of the ethidium bromide-stained gel is presented. Se, strand exchange products; ds, M13mp18 dsDNA linearized by EcoRI; ss, M13mp18 ssDNA. B–E, Visualization of ICP8 catalyzed strand exchange reactions using dsDNA preresected with lambda exonuclease and ExoIII. Linear double-stranded ϕX174 DNA was subjected to digestion by lambda exonuclease (B and C) or ExoIII (D and E) as described in Materials and Methods. The nuclease-treated DNA was then used in strand exchange reactions. The classic strand exchange products are seen: sigma (B), alpha (D), and gapped circles (C and E). The scale bar represents the length of 1000 bp of dsDNA.

    Journal: Journal of molecular biology

    Article Title: Catalysis of Strand Exchange by the HSV-1 UL12 and ICP8 Proteins: Potent ICP8 Recombinase Activity is Revealed upon Resection of dsDNA Substrate by Nuclease

    doi: 10.1016/j.jmb.2004.07.012

    Figure Lengend Snippet: Other exonucleases can perform strand exchange with ICP8. A, Strand exchange with full-length M13mp18 substrates was performed as described in Materials and Methods. Incubations were at 37 °C for 10–40 minutes, as indicated. All of the lanes included 100 ng of ssM13mp18 DNA and 100 ng of dsM13mp18 DNA linearized by EcoRI. Lane 1, no protein control; lane 2, 40 minutes incubation with ICP8 only; lanes 3–5, incubation with ICP8 and 13.9 nM UL12 for 10, 20, and 40 minutes, respectively; lanes 6–8, incubation with ICP8 and five units of lambda exonuclease for 10, 20, and 40 minutes, respectively; lanes 9–11, incubation with ICP8 and 100 units of ExoIII for 10, 20, and 40 minutes, respectively. A photograph of the ethidium bromide-stained gel is presented. Se, strand exchange products; ds, M13mp18 dsDNA linearized by EcoRI; ss, M13mp18 ssDNA. B–E, Visualization of ICP8 catalyzed strand exchange reactions using dsDNA preresected with lambda exonuclease and ExoIII. Linear double-stranded ϕX174 DNA was subjected to digestion by lambda exonuclease (B and C) or ExoIII (D and E) as described in Materials and Methods. The nuclease-treated DNA was then used in strand exchange reactions. The classic strand exchange products are seen: sigma (B), alpha (D), and gapped circles (C and E). The scale bar represents the length of 1000 bp of dsDNA.

    Article Snippet: Phage ϕX174 RF and virion DNA were from New England Biolabs (NEB).

    Techniques: Incubation, Staining

    Strand exchange by UL12 and ICP8. A, A representation of the strand exchange reaction involving UL12, ICP8, and bacteriophage-derived ssDNA circles and linearized dsDNA. The products of the reaction, with structures referred to as sigma, alpha and gapped circle are shown. B, Strand exchange by UL12 and ICP8 using ϕX174 DNA as substrates. Assay conditions were as described in Materials and Methods, using 100 ng of each of the DNA substrates per 20 µl reaction. Incubations were at 37 °C for 1–20 minutes, as indicated. Lane 1, Invitrogen 1 kb ladder marker; lane 2, no protein control; lane 3, incubation of the DNA substrates with ICP8 only; lanes 4–9, incubation of the DNA substrates with ICP8 and UL12 for 1, 2, 5, 7, 10, and 20 minutes, respectively. A photograph of the ethidium bromide-stained gel is presented. Se, strand exchange products; ds, ϕX174 dsDNA linearized by XhoI; ss, ϕX174 ssDNA.

    Journal: Journal of molecular biology

    Article Title: Catalysis of Strand Exchange by the HSV-1 UL12 and ICP8 Proteins: Potent ICP8 Recombinase Activity is Revealed upon Resection of dsDNA Substrate by Nuclease

    doi: 10.1016/j.jmb.2004.07.012

    Figure Lengend Snippet: Strand exchange by UL12 and ICP8. A, A representation of the strand exchange reaction involving UL12, ICP8, and bacteriophage-derived ssDNA circles and linearized dsDNA. The products of the reaction, with structures referred to as sigma, alpha and gapped circle are shown. B, Strand exchange by UL12 and ICP8 using ϕX174 DNA as substrates. Assay conditions were as described in Materials and Methods, using 100 ng of each of the DNA substrates per 20 µl reaction. Incubations were at 37 °C for 1–20 minutes, as indicated. Lane 1, Invitrogen 1 kb ladder marker; lane 2, no protein control; lane 3, incubation of the DNA substrates with ICP8 only; lanes 4–9, incubation of the DNA substrates with ICP8 and UL12 for 1, 2, 5, 7, 10, and 20 minutes, respectively. A photograph of the ethidium bromide-stained gel is presented. Se, strand exchange products; ds, ϕX174 dsDNA linearized by XhoI; ss, ϕX174 ssDNA.

    Article Snippet: Phage ϕX174 RF and virion DNA were from New England Biolabs (NEB).

    Techniques: Derivative Assay, Marker, Incubation, Staining

    ATP hydrolysis stimulation and DNA binding of the SbcCD wt complex. ( A ) The ATP hydrolysis rate of SbcCD wt was measured in dependence to increasing plasmid DNA concentrations. Bacteriophage ΦX174 Plasmid DNA (5386 bp in length) was added as single-stranded, supercoiled, nicked or linear DNA. The data were fit to a Michaelis–Menten equation, error bars indicate the deviation from three replicates. ( B ) DNA stimulation of ATP hydrolysis by the nuclease-deficient SbcCD H84Q complex. The steady-state ATPase rates were measured at 37°C in the presence of 1 mM ATP, 5 mM MgCl 2 and 1 mM MnCl 2 . DNA with 20–60 bp in length was added as an activator. The data was fit to a Michaelis-Menten equation, error bars represent the standard deviation of three measurements. ( C ) DNA binding of SbcCD H84Q to 20–50 bp DNA was assayed in the presence of 1 mM ATP, 5 mM MgCl 2 and 1 mM MnCl 2 . DNA concentration was kept at 5 nM; the SbcCD H84Q concentration ranged from 2 to 1000 nM. Data points represent the change in fluorescence anisotropy and the data were fit to a 1 to 1 binding equation. Error bars represent the deviation from three independent experiments.

    Journal: Nucleic Acids Research

    Article Title: The bacterial Mre11–Rad50 homolog SbcCD cleaves opposing strands of DNA by two chemically distinct nuclease reactions

    doi: 10.1093/nar/gky878

    Figure Lengend Snippet: ATP hydrolysis stimulation and DNA binding of the SbcCD wt complex. ( A ) The ATP hydrolysis rate of SbcCD wt was measured in dependence to increasing plasmid DNA concentrations. Bacteriophage ΦX174 Plasmid DNA (5386 bp in length) was added as single-stranded, supercoiled, nicked or linear DNA. The data were fit to a Michaelis–Menten equation, error bars indicate the deviation from three replicates. ( B ) DNA stimulation of ATP hydrolysis by the nuclease-deficient SbcCD H84Q complex. The steady-state ATPase rates were measured at 37°C in the presence of 1 mM ATP, 5 mM MgCl 2 and 1 mM MnCl 2 . DNA with 20–60 bp in length was added as an activator. The data was fit to a Michaelis-Menten equation, error bars represent the standard deviation of three measurements. ( C ) DNA binding of SbcCD H84Q to 20–50 bp DNA was assayed in the presence of 1 mM ATP, 5 mM MgCl 2 and 1 mM MnCl 2 . DNA concentration was kept at 5 nM; the SbcCD H84Q concentration ranged from 2 to 1000 nM. Data points represent the change in fluorescence anisotropy and the data were fit to a 1 to 1 binding equation. Error bars represent the deviation from three independent experiments.

    Article Snippet: DNA substrates For ATPase activation, ΦX174 RFI, RFII or Virion DNA (New England BioLabs®) was used.

    Techniques: Binding Assay, Plasmid Preparation, Standard Deviation, Concentration Assay, Fluorescence