pjet1 2 blunt vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pJET1 2 Forward Sequencing Primer
    Description:
    Thermo Scientific sequencing primers are single stranded oligonucleotides with 5 hydroxyl and 3 hydroxyl ends pJET1 2pJET1 2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1 2 All primers are supplied as 10 µM aqueous solutions Applications• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1 2p sequence• Colony screening by PCRCatalog number and Primer sequence • SO501 pJET1 2 forward sequencing primer 23 mer 5 d CGACTCACTATAGGGAGAGCGGC 3 • SO511 pJET1 2 reverse sequencing primer 24 mer 5 d AAGAACATCGATTTTCCATGGCAG 3 Related ProductspJET1 2 Reverse Sequencing Primer 24 mer
    Catalog Number:
    SO501
    Price:
    None
    Category:
    Oligos Primers Probes Nucleotides
    Applications:
    DNA Sequencing|Targeted Sequencing|Sequencing
    Buy from Supplier


    Structured Review

    Thermo Fisher pjet1 2 blunt vector
    Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer <t>pJET1.2/forward</t> was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.
    Thermo Scientific sequencing primers are single stranded oligonucleotides with 5 hydroxyl and 3 hydroxyl ends pJET1 2pJET1 2 sequence sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1 2 All primers are supplied as 10 µM aqueous solutions Applications• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1 2p sequence• Colony screening by PCRCatalog number and Primer sequence • SO501 pJET1 2 forward sequencing primer 23 mer 5 d CGACTCACTATAGGGAGAGCGGC 3 • SO511 pJET1 2 reverse sequencing primer 24 mer 5 d AAGAACATCGATTTTCCATGGCAG 3 Related ProductspJET1 2 Reverse Sequencing Primer 24 mer
    https://www.bioz.com/result/pjet1 2 blunt vector/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pjet1 2 blunt vector - by Bioz Stars, 2021-05
    99/100 stars

    Images

    1) Product Images from "Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi"

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1000680

    Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer pJET1.2/forward was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.
    Figure Legend Snippet: Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer pJET1.2/forward was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.

    Techniques Used: Clone Assay, Mouse Assay, Sequencing, Polymerase Chain Reaction, Mutagenesis

    2) Product Images from "A Closer Look on the Polyhydroxybutyrate- (PHB-) Negative Phenotype of Ralstonia eutropha PHB-4"

    Article Title: A Closer Look on the Polyhydroxybutyrate- (PHB-) Negative Phenotype of Ralstonia eutropha PHB-4

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0095907

    Schematic presentation of the phaCAB operon of R. eutropha PHB - 4. Primers phaCAB_fw and phaCAB_rv were applied to generate the 4,860-bp DNA fragment comprising the phaCAB operon. The PCR fragment was subcloned into vector pJET1.2/blunt, and subsequently fragments of three independent hybrid plasmids were sequenced. The arrow marks the observed G320A mutation in phaC causing a stop codon obviously leading to a truncated and non functional PHA synthase (PhaC) in strain PHB - 4.
    Figure Legend Snippet: Schematic presentation of the phaCAB operon of R. eutropha PHB - 4. Primers phaCAB_fw and phaCAB_rv were applied to generate the 4,860-bp DNA fragment comprising the phaCAB operon. The PCR fragment was subcloned into vector pJET1.2/blunt, and subsequently fragments of three independent hybrid plasmids were sequenced. The arrow marks the observed G320A mutation in phaC causing a stop codon obviously leading to a truncated and non functional PHA synthase (PhaC) in strain PHB - 4.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Mutagenesis, Functional Assay

    3) Product Images from "Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi"

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1000680

    Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer pJET1.2/forward was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.
    Figure Legend Snippet: Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer pJET1.2/forward was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.

    Techniques Used: Clone Assay, Mouse Assay, Sequencing, Polymerase Chain Reaction, Mutagenesis

    4) Product Images from "Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete"

    Article Title: Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0057792

    Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.
    Figure Legend Snippet: Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.

    Techniques Used: Polymerase Chain Reaction, Amplification, Staining, Agarose Gel Electrophoresis, Plasmid Preparation, Molecular Weight, Marker, Sequencing, Generated, Clone Assay, In Vitro

    Related Articles

    Amplification:

    Article Title: CRISPR-Cas9-Based Mutagenesis of the Mucormycosis-Causing Fungus Lichtheimia corymbifera
    Article Snippet: Construction of Plasmids for the Complementation of Uracil Auxotrophy The pyrG gene with its own promoter and terminator sequences was amplified by PCR using the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific, Waltham, MA, USA) and the primer pair LcpyrG1 (5′-gtaatagcaaggaccaccgagtga-3′) and LcpyrG2 (5′-gaacaattaagagccgttgaatcc-3′). .. The amplified fragment was ligated into the pJet1.2 cloning vector (Thermo Scientific, Waltham, MA, USA), arising the plasmid pLcpyrGcompl ( a), which was used to complement the uracil auxotrophy of the pyrG disrupted mutants. .. The plasmid was transformed into the mutants by PEG-mediated protoplast transformation.

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. This was generated by cloning the 105 bp long ZIKV NS5 PCR amplicon into a pJET1.2 vector (Thermo Scientific, Waltham, MA, USA), and prepared dilutions from 109 to 101. .. Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. Amplified PCR fragments were stitched and ligated into the pJET1.2 vector and sequences of obtained constructs were verified by Sanger-sequencing. .. The variants of prM and E genes were sub-cloned into an infectious clone of the Brazilian ZIKV that contained gene encoding for the Zoanthus sp. green fluorescence protein (ZsGreen), hereafter termed the wild-type (WT) clone, using a XhoI-AvrII restriction enzymes (Thermo Scientific, Waltham, MA, USA); sequences were confirmed by Sanger-sequencing ( b, ).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). .. 2.6. pcDNA3.1-prME Plasmid ConstructionTo construct an expression plasmid for ZIKV prME, the prME gene from the plasmids used in . (capsid-prME genes in the pJET1.2 vector) were PCR amplified using the primer set Forward:5′-CAGCTAGCATGGGCGCCGATACCTCCGTGGGCATT-3′, Reverse:5′- TAGTTTAAACTTAAGCAGAGACGGCTGTGGA-3′. .. The PCR fragments were inserted into the pcDNA3.1 vector (Thermo Scientific, Waltham, MA, USA) under a human cytomegalovirus (CMV) promoter using NheI-PmeI digestion/T4 DNA ligation (Thermo Scientific, Waltham, MA, USA).

    Clone Assay:

    Article Title: CRISPR-Cas9-Based Mutagenesis of the Mucormycosis-Causing Fungus Lichtheimia corymbifera
    Article Snippet: Construction of Plasmids for the Complementation of Uracil Auxotrophy The pyrG gene with its own promoter and terminator sequences was amplified by PCR using the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific, Waltham, MA, USA) and the primer pair LcpyrG1 (5′-gtaatagcaaggaccaccgagtga-3′) and LcpyrG2 (5′-gaacaattaagagccgttgaatcc-3′). .. The amplified fragment was ligated into the pJet1.2 cloning vector (Thermo Scientific, Waltham, MA, USA), arising the plasmid pLcpyrGcompl ( a), which was used to complement the uracil auxotrophy of the pyrG disrupted mutants. .. The plasmid was transformed into the mutants by PEG-mediated protoplast transformation.

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. This was generated by cloning the 105 bp long ZIKV NS5 PCR amplicon into a pJET1.2 vector (Thermo Scientific, Waltham, MA, USA), and prepared dilutions from 109 to 101. .. Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA).

    Article Title: Toxin transcripts in Crotalus atrox venom and in silico structures of toxins
    Article Snippet: .. Identification of the most common venom toxin transcripts To identify the most common toxin transcripts of each toxin family from C. atrox crude venom, we adopted the procedure developed in our lab ( ) with some minor modifications: i) we used pJET1.2 (ThermoFisher Scientific, USA) as the cloning vector; and ii) we divided PCR product (20μl) of each clone into two 10μl, one for running agarose gel to obtain the transcript with correct molecular size and the other 10μl for Alu I restriction enzyme digestion of same molecular size to acquire the most common transcript in terms of the enzyme digestion pattern. .. The recombinant plasmid DNAs isolated from the most common clones were sequenced.

    Article Title: CMT3 and SUVH4/KYP silence the exonic Evelknievel retroelement to allow for reconstitution of CMT1 mRNA
    Article Snippet: The amplified sequences were separated by agarose gel electrophoresis before purification using the QIAquick PCR Purification Kit (Qiagen). .. The purified fragments were ligated into a pJET1.2 cloning vector using a CloneJET PCR Cloning Kit (Thermo Fisher Scientific) and transformed into competent E. coli (TOP10 cells). .. Positive clones were selected by colony PCR followed by plasmid isolation with the PrestoTM Mini Plasmid Kit (Geneaid).

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi
    Article Snippet: These PCR products were run on a 1% agarose gel and the 775 bp PCR product was excised and gel purified using the Qiagen Gel Extraction Kit (Quiagen). .. The PCR fragments were cloned into the pJET1.2/blunt vector (CloneJet, Fermentas) and used to transform E.coli DH5α. ..

    Plasmid Preparation:

    Article Title: CRISPR-Cas9-Based Mutagenesis of the Mucormycosis-Causing Fungus Lichtheimia corymbifera
    Article Snippet: Construction of Plasmids for the Complementation of Uracil Auxotrophy The pyrG gene with its own promoter and terminator sequences was amplified by PCR using the Phusion Flash High-Fidelity PCR Master Mix (Thermo Scientific, Waltham, MA, USA) and the primer pair LcpyrG1 (5′-gtaatagcaaggaccaccgagtga-3′) and LcpyrG2 (5′-gaacaattaagagccgttgaatcc-3′). .. The amplified fragment was ligated into the pJet1.2 cloning vector (Thermo Scientific, Waltham, MA, USA), arising the plasmid pLcpyrGcompl ( a), which was used to complement the uracil auxotrophy of the pyrG disrupted mutants. .. The plasmid was transformed into the mutants by PEG-mediated protoplast transformation.

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. This was generated by cloning the 105 bp long ZIKV NS5 PCR amplicon into a pJET1.2 vector (Thermo Scientific, Waltham, MA, USA), and prepared dilutions from 109 to 101. .. Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA).

    Article Title: Toxin transcripts in Crotalus atrox venom and in silico structures of toxins
    Article Snippet: .. Identification of the most common venom toxin transcripts To identify the most common toxin transcripts of each toxin family from C. atrox crude venom, we adopted the procedure developed in our lab ( ) with some minor modifications: i) we used pJET1.2 (ThermoFisher Scientific, USA) as the cloning vector; and ii) we divided PCR product (20μl) of each clone into two 10μl, one for running agarose gel to obtain the transcript with correct molecular size and the other 10μl for Alu I restriction enzyme digestion of same molecular size to acquire the most common transcript in terms of the enzyme digestion pattern. .. The recombinant plasmid DNAs isolated from the most common clones were sequenced.

    Article Title: CMT3 and SUVH4/KYP silence the exonic Evelknievel retroelement to allow for reconstitution of CMT1 mRNA
    Article Snippet: The amplified sequences were separated by agarose gel electrophoresis before purification using the QIAquick PCR Purification Kit (Qiagen). .. The purified fragments were ligated into a pJET1.2 cloning vector using a CloneJET PCR Cloning Kit (Thermo Fisher Scientific) and transformed into competent E. coli (TOP10 cells). .. Positive clones were selected by colony PCR followed by plasmid isolation with the PrestoTM Mini Plasmid Kit (Geneaid).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. Amplified PCR fragments were stitched and ligated into the pJET1.2 vector and sequences of obtained constructs were verified by Sanger-sequencing. .. The variants of prM and E genes were sub-cloned into an infectious clone of the Brazilian ZIKV that contained gene encoding for the Zoanthus sp. green fluorescence protein (ZsGreen), hereafter termed the wild-type (WT) clone, using a XhoI-AvrII restriction enzymes (Thermo Scientific, Waltham, MA, USA); sequences were confirmed by Sanger-sequencing ( b, ).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). .. 2.6. pcDNA3.1-prME Plasmid ConstructionTo construct an expression plasmid for ZIKV prME, the prME gene from the plasmids used in . (capsid-prME genes in the pJET1.2 vector) were PCR amplified using the primer set Forward:5′-CAGCTAGCATGGGCGCCGATACCTCCGTGGGCATT-3′, Reverse:5′- TAGTTTAAACTTAAGCAGAGACGGCTGTGGA-3′. .. The PCR fragments were inserted into the pcDNA3.1 vector (Thermo Scientific, Waltham, MA, USA) under a human cytomegalovirus (CMV) promoter using NheI-PmeI digestion/T4 DNA ligation (Thermo Scientific, Waltham, MA, USA).

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi
    Article Snippet: These PCR products were run on a 1% agarose gel and the 775 bp PCR product was excised and gel purified using the Qiagen Gel Extraction Kit (Quiagen). .. The PCR fragments were cloned into the pJET1.2/blunt vector (CloneJet, Fermentas) and used to transform E.coli DH5α. ..

    Generated:

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. This was generated by cloning the 105 bp long ZIKV NS5 PCR amplicon into a pJET1.2 vector (Thermo Scientific, Waltham, MA, USA), and prepared dilutions from 109 to 101. .. Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA).

    Polymerase Chain Reaction:

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. This was generated by cloning the 105 bp long ZIKV NS5 PCR amplicon into a pJET1.2 vector (Thermo Scientific, Waltham, MA, USA), and prepared dilutions from 109 to 101. .. Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA).

    Article Title: Toxin transcripts in Crotalus atrox venom and in silico structures of toxins
    Article Snippet: .. Identification of the most common venom toxin transcripts To identify the most common toxin transcripts of each toxin family from C. atrox crude venom, we adopted the procedure developed in our lab ( ) with some minor modifications: i) we used pJET1.2 (ThermoFisher Scientific, USA) as the cloning vector; and ii) we divided PCR product (20μl) of each clone into two 10μl, one for running agarose gel to obtain the transcript with correct molecular size and the other 10μl for Alu I restriction enzyme digestion of same molecular size to acquire the most common transcript in terms of the enzyme digestion pattern. .. The recombinant plasmid DNAs isolated from the most common clones were sequenced.

    Article Title: CMT3 and SUVH4/KYP silence the exonic Evelknievel retroelement to allow for reconstitution of CMT1 mRNA
    Article Snippet: The amplified sequences were separated by agarose gel electrophoresis before purification using the QIAquick PCR Purification Kit (Qiagen). .. The purified fragments were ligated into a pJET1.2 cloning vector using a CloneJET PCR Cloning Kit (Thermo Fisher Scientific) and transformed into competent E. coli (TOP10 cells). .. Positive clones were selected by colony PCR followed by plasmid isolation with the PrestoTM Mini Plasmid Kit (Geneaid).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. Amplified PCR fragments were stitched and ligated into the pJET1.2 vector and sequences of obtained constructs were verified by Sanger-sequencing. .. The variants of prM and E genes were sub-cloned into an infectious clone of the Brazilian ZIKV that contained gene encoding for the Zoanthus sp. green fluorescence protein (ZsGreen), hereafter termed the wild-type (WT) clone, using a XhoI-AvrII restriction enzymes (Thermo Scientific, Waltham, MA, USA); sequences were confirmed by Sanger-sequencing ( b, ).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). .. 2.6. pcDNA3.1-prME Plasmid ConstructionTo construct an expression plasmid for ZIKV prME, the prME gene from the plasmids used in . (capsid-prME genes in the pJET1.2 vector) were PCR amplified using the primer set Forward:5′-CAGCTAGCATGGGCGCCGATACCTCCGTGGGCATT-3′, Reverse:5′- TAGTTTAAACTTAAGCAGAGACGGCTGTGGA-3′. .. The PCR fragments were inserted into the pcDNA3.1 vector (Thermo Scientific, Waltham, MA, USA) under a human cytomegalovirus (CMV) promoter using NheI-PmeI digestion/T4 DNA ligation (Thermo Scientific, Waltham, MA, USA).

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi
    Article Snippet: These PCR products were run on a 1% agarose gel and the 775 bp PCR product was excised and gel purified using the Qiagen Gel Extraction Kit (Quiagen). .. The PCR fragments were cloned into the pJET1.2/blunt vector (CloneJet, Fermentas) and used to transform E.coli DH5α. ..

    Agarose Gel Electrophoresis:

    Article Title: Toxin transcripts in Crotalus atrox venom and in silico structures of toxins
    Article Snippet: .. Identification of the most common venom toxin transcripts To identify the most common toxin transcripts of each toxin family from C. atrox crude venom, we adopted the procedure developed in our lab ( ) with some minor modifications: i) we used pJET1.2 (ThermoFisher Scientific, USA) as the cloning vector; and ii) we divided PCR product (20μl) of each clone into two 10μl, one for running agarose gel to obtain the transcript with correct molecular size and the other 10μl for Alu I restriction enzyme digestion of same molecular size to acquire the most common transcript in terms of the enzyme digestion pattern. .. The recombinant plasmid DNAs isolated from the most common clones were sequenced.

    Purification:

    Article Title: CMT3 and SUVH4/KYP silence the exonic Evelknievel retroelement to allow for reconstitution of CMT1 mRNA
    Article Snippet: The amplified sequences were separated by agarose gel electrophoresis before purification using the QIAquick PCR Purification Kit (Qiagen). .. The purified fragments were ligated into a pJET1.2 cloning vector using a CloneJET PCR Cloning Kit (Thermo Fisher Scientific) and transformed into competent E. coli (TOP10 cells). .. Positive clones were selected by colony PCR followed by plasmid isolation with the PrestoTM Mini Plasmid Kit (Geneaid).

    Transformation Assay:

    Article Title: CMT3 and SUVH4/KYP silence the exonic Evelknievel retroelement to allow for reconstitution of CMT1 mRNA
    Article Snippet: The amplified sequences were separated by agarose gel electrophoresis before purification using the QIAquick PCR Purification Kit (Qiagen). .. The purified fragments were ligated into a pJET1.2 cloning vector using a CloneJET PCR Cloning Kit (Thermo Fisher Scientific) and transformed into competent E. coli (TOP10 cells). .. Positive clones were selected by colony PCR followed by plasmid isolation with the PrestoTM Mini Plasmid Kit (Geneaid).

    Construct:

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: .. Amplified PCR fragments were stitched and ligated into the pJET1.2 vector and sequences of obtained constructs were verified by Sanger-sequencing. .. The variants of prM and E genes were sub-cloned into an infectious clone of the Brazilian ZIKV that contained gene encoding for the Zoanthus sp. green fluorescence protein (ZsGreen), hereafter termed the wild-type (WT) clone, using a XhoI-AvrII restriction enzymes (Thermo Scientific, Waltham, MA, USA); sequences were confirmed by Sanger-sequencing ( b, ).

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). .. 2.6. pcDNA3.1-prME Plasmid ConstructionTo construct an expression plasmid for ZIKV prME, the prME gene from the plasmids used in . (capsid-prME genes in the pJET1.2 vector) were PCR amplified using the primer set Forward:5′-CAGCTAGCATGGGCGCCGATACCTCCGTGGGCATT-3′, Reverse:5′- TAGTTTAAACTTAAGCAGAGACGGCTGTGGA-3′. .. The PCR fragments were inserted into the pcDNA3.1 vector (Thermo Scientific, Waltham, MA, USA) under a human cytomegalovirus (CMV) promoter using NheI-PmeI digestion/T4 DNA ligation (Thermo Scientific, Waltham, MA, USA).

    Expressing:

    Article Title: N-glycosylation in the Pre-Membrane Protein Is Essential for the Zika Virus Life Cycle
    Article Snippet: Ct values were transformed to a standard curve by using GraphPad Prism 7.0 software (GraphPad Software, San Diego, CA, USA). .. 2.6. pcDNA3.1-prME Plasmid ConstructionTo construct an expression plasmid for ZIKV prME, the prME gene from the plasmids used in . (capsid-prME genes in the pJET1.2 vector) were PCR amplified using the primer set Forward:5′-CAGCTAGCATGGGCGCCGATACCTCCGTGGGCATT-3′, Reverse:5′- TAGTTTAAACTTAAGCAGAGACGGCTGTGGA-3′. .. The PCR fragments were inserted into the pcDNA3.1 vector (Thermo Scientific, Waltham, MA, USA) under a human cytomegalovirus (CMV) promoter using NheI-PmeI digestion/T4 DNA ligation (Thermo Scientific, Waltham, MA, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher pjet1 2 blunt vector
    Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer <t>pJET1.2/forward</t> was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.
    Pjet1 2 Blunt Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pjet1 2 blunt vector/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pjet1 2 blunt vector - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer pJET1.2/forward was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.

    Journal: PLoS Pathogens

    Article Title: Investigation of the Genes Involved in Antigenic Switching at the vlsE Locus in Borrelia burgdorferi: An Essential Role for the RuvAB Branch MigraseCentral Role of the Holliday Junction Helicase RuvAB in vlsE Recombination and Infectivity of Borrelia burgdorferi

    doi: 10.1371/journal.ppat.1000680

    Figure Lengend Snippet: Number of switched vlsE clones in SCID C3H/HeN mice. Sequencing of the cloned PCR product of the vlsE variable regions using primer pJET1.2/forward was performed on 10 clones from each tissue type culture for each genotype (see Materials and Methods ). The y-axis denotes the number of clones out of ten that contained templated nucleotide changes in variable regions 1–6 (switches) and the x-axis denotes the tissue type. The P-values above the bars indicate the level of significance of the difference between the wild-type and mutant samples, calculated using Fisher's Exact test.

    Article Snippet: The PCR fragments were cloned into the pJET1.2/blunt vector (CloneJet, Fermentas) and used to transform E.coli DH5α.

    Techniques: Clone Assay, Mouse Assay, Sequencing, Polymerase Chain Reaction, Mutagenesis

    Schematic presentation of the phaCAB operon of R. eutropha PHB - 4. Primers phaCAB_fw and phaCAB_rv were applied to generate the 4,860-bp DNA fragment comprising the phaCAB operon. The PCR fragment was subcloned into vector pJET1.2/blunt, and subsequently fragments of three independent hybrid plasmids were sequenced. The arrow marks the observed G320A mutation in phaC causing a stop codon obviously leading to a truncated and non functional PHA synthase (PhaC) in strain PHB - 4.

    Journal: PLoS ONE

    Article Title: A Closer Look on the Polyhydroxybutyrate- (PHB-) Negative Phenotype of Ralstonia eutropha PHB-4

    doi: 10.1371/journal.pone.0095907

    Figure Lengend Snippet: Schematic presentation of the phaCAB operon of R. eutropha PHB - 4. Primers phaCAB_fw and phaCAB_rv were applied to generate the 4,860-bp DNA fragment comprising the phaCAB operon. The PCR fragment was subcloned into vector pJET1.2/blunt, and subsequently fragments of three independent hybrid plasmids were sequenced. The arrow marks the observed G320A mutation in phaC causing a stop codon obviously leading to a truncated and non functional PHA synthase (PhaC) in strain PHB - 4.

    Article Snippet: The purified PCR product (peqGOLD Gel Extraction Kit, peqlab) was ligated with vector pJET1.2/blunt and applied for transformation of competent E. coli TOP10 cells according to the CloneJET PCR Cloning Kit (Thermo Scientific).

    Techniques: Polymerase Chain Reaction, Plasmid Preparation, Mutagenesis, Functional Assay

    Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.

    Journal: PLoS ONE

    Article Title: Suggested Role for G4 DNA in Recombinational Switching at the Antigenic Variation Locus of the Lyme Disease Spirochete

    doi: 10.1371/journal.pone.0057792

    Figure Lengend Snippet: Precise excision of the vlsE variable region during PCR amplification. A) Schematic showing the variable, constant and 17 bp direct repeats of the vlsE gene. The location of PCR primers used for amplification are shown by arrows below the constant regions. B) An ethidium bromide-stained agarose gel showing amplification of a portion of vlsE with Phusion DNA polymerase using three different templates and two different primer sets. The templates used were B. burgdorferi B31 5A4 genomic DNA [29] pMBL20, a plasmid carrying the vlsE gene [51] ; the 776 bp or 935 bp PCR products resulting from PCR amplification. The asterisks indicate smaller discrete bands observed in lanes 1–3 and 4–6. M denotes a 100 bp molecular weight ladder marker. PCR samples were run on a 1.2% agarose gel in 1X TAE buffer at 80 V for 1.2 hours. C) Characterization of precise deletions in vlsE . The first entry on the left side of the panel shows the sequence obtained from direct sequencing of the PCR product obtained with either B248 and B249 or B1701 and 1702. The remainder of the lineup shows sequence generated with 10 randomly selected E. coli transformants. The transformants were generated by cloning the 223 bp truncated PCR product generated in vitro with primers B248 and B249. The fragment was gel-excised and cloned into pJET1.2/blunt vector (Fermentas). The alignment shows that all the sequenced vlsE inserts had a precise excision of the 570 bp variable region. D) Schematic showing the precise excision of the vlsE variable region that occurred during PCR amplification.

    Article Snippet: Purified fragments were cloned into the pJET1.2/blunt vector (CloneJet, Fermentas) and used to transform E.coli DH5α or SURE 2 cells when the large inverted repeat in the vlsE promoter region was present.

    Techniques: Polymerase Chain Reaction, Amplification, Staining, Agarose Gel Electrophoresis, Plasmid Preparation, Molecular Weight, Marker, Sequencing, Generated, Clone Assay, In Vitro