vector pgem t  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    pGEM-T Easy Vector Systems
    Description:

    Catalog Number:
    A1360
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Promega vector pgem t
    Scheme of plasmids used in this study. (a) The tesB gene from the E. coli JM105 genome was amplified by PCR with primers P1 and P3 and inserted into the <t>pGEM-T</t> vector to yield the starting plasmid, pLZZH01. The chloramphenicol resistance cassette from pBBR1MCS replaced the BstBI/BamHI fragment of tesB in pLZZH01, leading to the plasmid pLZZH11 (step 1). The SacII (filled in)-SacI fragment from pLZZH11 was inserted into the HincII/SacI sites of the temperature-sensitive vector pTH19ks1, resulting in pLZZH12 (step 2), which was used to construct the tesB knockout mutant E. coli strain. The HincII/ClaI fragment of pLZZH01, containing the tesB gene, was introduced into the corresponding sites of the vector pBBR1MCS-2 to yield pLZZH09 (step 3). BstBI/BamHI double-digested pLZZH01 was sequentially blunt ended by T4 polymerase and ligated to obtain the competitive plasmid pLZZH08 for the tesB transcriptional assay (step 4). (b) pLZZGPp was digested with PmlI and SnaBI, followed by ligation, resulting in pLZZH10, used for the transcriptional assay for phaG. tesB encodes thioesterase II; tesB ′, the BstBI/BamHI fragment of tesB , was deleted; phaG encodes 3HD-ACP-CoA transacylase; phaG ′, the SnaBI/PmlI fragment of phaG , was deleted. Ap(r) , Kn(r) , and Cm(r) , ampicillin, kanamycin, and chloramphenicol resistance genes, respectively. B, BamHI; Bs, BstBI; C, ClaI; H, HincII; P, PmlI; SI, SacI; SII, SacII; Sn, SnaBI.

    https://www.bioz.com/result/vector pgem t/product/Promega
    Average 99 stars, based on 142 article reviews
    Price from $9.99 to $1999.99
    vector pgem t - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production"

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production

    Journal:

    doi: 10.1128/AEM.70.7.3807-3813.2004

    Scheme of plasmids used in this study. (a) The tesB gene from the E. coli JM105 genome was amplified by PCR with primers P1 and P3 and inserted into the pGEM-T vector to yield the starting plasmid, pLZZH01. The chloramphenicol resistance cassette from pBBR1MCS replaced the BstBI/BamHI fragment of tesB in pLZZH01, leading to the plasmid pLZZH11 (step 1). The SacII (filled in)-SacI fragment from pLZZH11 was inserted into the HincII/SacI sites of the temperature-sensitive vector pTH19ks1, resulting in pLZZH12 (step 2), which was used to construct the tesB knockout mutant E. coli strain. The HincII/ClaI fragment of pLZZH01, containing the tesB gene, was introduced into the corresponding sites of the vector pBBR1MCS-2 to yield pLZZH09 (step 3). BstBI/BamHI double-digested pLZZH01 was sequentially blunt ended by T4 polymerase and ligated to obtain the competitive plasmid pLZZH08 for the tesB transcriptional assay (step 4). (b) pLZZGPp was digested with PmlI and SnaBI, followed by ligation, resulting in pLZZH10, used for the transcriptional assay for phaG. tesB encodes thioesterase II; tesB ′, the BstBI/BamHI fragment of tesB , was deleted; phaG encodes 3HD-ACP-CoA transacylase; phaG ′, the SnaBI/PmlI fragment of phaG , was deleted. Ap(r) , Kn(r) , and Cm(r) , ampicillin, kanamycin, and chloramphenicol resistance genes, respectively. B, BamHI; Bs, BstBI; C, ClaI; H, HincII; P, PmlI; SI, SacI; SII, SacII; Sn, SnaBI.
    Figure Legend Snippet: Scheme of plasmids used in this study. (a) The tesB gene from the E. coli JM105 genome was amplified by PCR with primers P1 and P3 and inserted into the pGEM-T vector to yield the starting plasmid, pLZZH01. The chloramphenicol resistance cassette from pBBR1MCS replaced the BstBI/BamHI fragment of tesB in pLZZH01, leading to the plasmid pLZZH11 (step 1). The SacII (filled in)-SacI fragment from pLZZH11 was inserted into the HincII/SacI sites of the temperature-sensitive vector pTH19ks1, resulting in pLZZH12 (step 2), which was used to construct the tesB knockout mutant E. coli strain. The HincII/ClaI fragment of pLZZH01, containing the tesB gene, was introduced into the corresponding sites of the vector pBBR1MCS-2 to yield pLZZH09 (step 3). BstBI/BamHI double-digested pLZZH01 was sequentially blunt ended by T4 polymerase and ligated to obtain the competitive plasmid pLZZH08 for the tesB transcriptional assay (step 4). (b) pLZZGPp was digested with PmlI and SnaBI, followed by ligation, resulting in pLZZH10, used for the transcriptional assay for phaG. tesB encodes thioesterase II; tesB ′, the BstBI/BamHI fragment of tesB , was deleted; phaG encodes 3HD-ACP-CoA transacylase; phaG ′, the SnaBI/PmlI fragment of phaG , was deleted. Ap(r) , Kn(r) , and Cm(r) , ampicillin, kanamycin, and chloramphenicol resistance genes, respectively. B, BamHI; Bs, BstBI; C, ClaI; H, HincII; P, PmlI; SI, SacI; SII, SacII; Sn, SnaBI.

    Techniques Used: Amplification, Polymerase Chain Reaction, Plasmid Preparation, Construct, Knock-Out, Mutagenesis, Transcription Factor Assay, Ligation

    Related Articles

    Clone Assay:

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: The RNA was eluted in a final volume of 60 μL of elution buffer and used immediately or stored at -80°C. .. In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). .. Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China).

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: The PCR product of 1027 bp was purified using QIAquick PCR purification kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA). .. Each ligation mixture was transformed into One-Shot® TOP10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Expression of mVenus-hGeminin and mCherry-hCdt1 (the kind gifts of the RIKEN Brain Science Institute, Wako, Japan) was after they had been cloned as PCR-amplified Eco RI/Xba I fragments into pCI-neo. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega). .. E1.5 (2-cell) embryos (the day following activation) were transferred to the oviductal ampullae of pseudo-pregnant CD-1 females at day 0.5 (that is, plugged females that had been mated with vasectomized males the previous night).

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Insertion-deletion mutagenesis in the kpsS gene (encoding an ABC transporter involved in capsule transport) of IA3902 was performed in order to define the role of CPS in studies performed here according to our previously reported methods ( ). .. Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS . .. The resulting construct was digested with SwaI and ligated with the aphA-3 gene that was amplified from pMW10 ( ) with primers Kan_F and Kan_R ( ).

    Article Title: Arabidopsis Novel Glycine-Rich Plasma Membrane PSS1 Protein Enhances Disease Resistance in Transgenic Soybean Plants
    Article Snippet: To monitor the mCherry signal, a HeNe 561 laser (561 nm) and a third PMT detector (587–610 nm) were used ( ). .. The gene PSS1 was first cloned into vector pGEM-T (Promega) and sequenced to confirm its identity. .. The gene was then released from the pGEM-T vector and cloned in the modified binary pTF102 vectors carrying one of three promoters: Prom1, Prom2, and Ubi10.

    Article Title: Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp, USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBP?II) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp., USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: Amplified fragments were cloned into vector pGEM-T (Promega) in the case of alr2536 and all0342 or pGEM-T Easy (Promega) for alr3429 , producing pCSR4, pCSR1, and pCSR19, respectively, and then transferred as Bam HI-ended fragments to Bam HI-digested pRL424 [ ] producing pCSR17, pCSR13, and pCSR23, respectively (Nmr ). .. The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1.

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Non-tailed cDNA was used in PCR reactions as negative control. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site. .. For phase contrast and fluorescent microscopy, S. coelicolor M145, mutant strain, TSB01 and the mutant strain complemented with ssbB (TSB02) or with ssbBΔC (TSB03) were grown in the acute angle of sterile coverslips inserted obliquely in an MS plate.

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The 952-bp and 1018-bp PCR products were subsequently hybridized using complementary regions introduced in primers. .. The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD. .. The plasmid was introduced into Escherichia coli DH5α.

    Article Title: Functional Brachyury Binding Sites Establish a Temporal Read-out of Gene Expression in the Ciona NotochordCis-Regulatory Timers for Developmental Gene Expression
    Article Snippet: After incubation with X-Gal, only well-developed embryos that showed β-galactosidase staining in any tissue were counted. .. All genomic fragments were PCR-amplified from C. intestinalis genomic DNA purified from sperm of a single individual and cloned into the pFBΔSP6 vector , either directly or after an intermediate cloning step into the vector pGEM-T (Promega). .. A list of the oligonucleotides employed for PCR amplifications of the initial fragments is provided in ; sequences of the oligonucleotides employed for the construction of the truncations and point mutation constructs are available upon re quest.

    Article Title: Eutremagiganteum ( Brassicaceae), a new species from Sichuan, southwest China
    Article Snippet: PCR amplification and sequencing approaches followed and . .. For those ITS sequences with double peaks in those possible hybrids, we further cloned them using vector pGEM-T (Promega, Madison, Wisconsin). .. We selected ten positive clones for sequencing with primers “sp6” and “t7”.

    Article Title: Rice Stripe Virus Infection Alters mRNA Levels of Sphingolipid-Metabolizing Enzymes and Sphingolipids Content in Laodelphax striatellus
    Article Snippet: Paragraph title: Sphingolipid Enzymes Cloning ... The resulting PCR product was gel purified, ligated into the vector pGEM-T (Promega, USA), and transformed into Escherichia coli DH5α.

    Article Title: Novel strong promoter of antimicrobial peptides gene pro-SmAMP2 from chickweed (Stellaria media)
    Article Snippet: The target nucleotide sequence was amplified by two-step PCR according to the instructions of the manufacturer. .. The PCR product 2400 bp long was cloned in the vector pGEM-T (Promega, USA) and sequenced. .. The first nucleotide of the transcription start site (TSS) was designated as +1.

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: The PCR was carried out as described by . .. The PCR product was cloned in vector pGEM-T (Promega). .. Plasmid probes were 32 P-labeled by random-priming and oligonucleotide probes were 32 P-labeled with T4 polynucleotide kinase.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: The PCR amplification included denaturalization for 3 min at 94°C, followed by 30 cycles (95°C, 1 min) with one annealing elongation step at 71°C for 1 min and, finally, an elongation step at 72°C for 10 min. PCR was carried out in a PTC-100 (MJ Research Inc.). .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue. .. Positive bacterial colonies were identified by PCR employing the primers; SP6 (5\ATTTAGGTGACACTATAGAA3) and T7 (5\TAATACGACTCACTATAGGG3\).

    Amplification:

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production
    Article Snippet: The coding region of tesB (including the native ribosome binding site) from E. coli JM105 was amplified by PCR employing primers P1 and P3 (Table ). .. The 929-bp product was inserted into the commercial vector pGEM-T (Promega), resulting in plasmid pLZZH01 (Fig. ).

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: The RNA was eluted in a final volume of 60 μL of elution buffer and used immediately or stored at -80°C. .. In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). .. Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China).

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: Paragraph title: Gene amplification and sequencing of PkDBPαII ... The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA).

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Overlapping PCR was performed according to the Genome Walker kit protocol (Takara, Cat#: D316). .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01). .. The insertion sequence was sequenced and compared with the whole pig genome sequence in GenBank.

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: The Prm2 gene was cloned following PCR amplification of tail tip genomic DNA as an Xho I/Eco RI fragment that includes ∼1 kb upstream of the Prm2 start codon, and inserted into pCI-neo-mCherry . .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega).

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Insertion-deletion mutagenesis in the kpsS gene (encoding an ABC transporter involved in capsule transport) of IA3902 was performed in order to define the role of CPS in studies performed here according to our previously reported methods ( ). .. Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS . .. The resulting construct was digested with SwaI and ligated with the aphA-3 gene that was amplified from pMW10 ( ) with primers Kan_F and Kan_R ( ).

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: For inactivation of alr1519 , a 2.3 kb DNA fragment carrying the full ORF and flanking regions was amplified from genomic DNA from strain PCC 7120 using primers AA-1 and AA-2. .. The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1. .. The C.S3 cassette (encoding Smr Spr ) was excised from plasmid pRL463 [ ] with Bam HI and inserted into the Bcl I-digested pCSS1 to interrupt the ORF alr1519 , obtaining plasmid pCSS2.

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Two microlitres of this reaction mixture, ssb nested primers ( Supplementary Table S3 ) and Abridged amplification primer were used for PCR. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site.

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: To construct the BurA1Δeby CAB mutant, two regions of a 1 kb long fragment located upstream and downstream (UD) from the eby CAB operon were amplified from the genome of S . maltophilia BurA1 using primers upBurA1-F/upBurA1-R and dwBurA1-F/dwBurA1-R ( ). .. The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD.

    Article Title: Eutremagiganteum ( Brassicaceae), a new species from Sichuan, southwest China
    Article Snippet: PCR amplification and sequencing approaches followed and . .. For those ITS sequences with double peaks in those possible hybrids, we further cloned them using vector pGEM-T (Promega, Madison, Wisconsin).

    Article Title: Novel strong promoter of antimicrobial peptides gene pro-SmAMP2 from chickweed (Stellaria media)
    Article Snippet: The target nucleotide sequence was amplified by two-step PCR according to the instructions of the manufacturer. .. The PCR product 2400 bp long was cloned in the vector pGEM-T (Promega, USA) and sequenced.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: There was no significant difference between these sequence variants in any of the in vitro kinetic parameters measured in this study ( Supplementary Table S1 and Figure S2 ). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. The insert of this plasmid was reamplified using primers that covered the 451 nt of hTR and included a T7 promoter (5′-end, for transcription) and a FokI restriction sequence (3′-end, for plasmid linearization) and inserted into the EcoRI/BamHI sites of plasmid pUC19.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: The PCR amplification included denaturalization for 3 min at 94°C, followed by 30 cycles (95°C, 1 min) with one annealing elongation step at 71°C for 1 min and, finally, an elongation step at 72°C for 10 min. PCR was carried out in a PTC-100 (MJ Research Inc.). .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue.

    Binding Assay:

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production
    Article Snippet: The coding region of tesB (including the native ribosome binding site) from E. coli JM105 was amplified by PCR employing primers P1 and P3 (Table ). .. The 929-bp product was inserted into the commercial vector pGEM-T (Promega), resulting in plasmid pLZZH01 (Fig. ).

    Synthesized:

    Article Title: Rice Stripe Virus Infection Alters mRNA Levels of Sphingolipid-Metabolizing Enzymes and Sphingolipids Content in Laodelphax striatellus
    Article Snippet: According to the sequences found in the transcriptome dataset of L. striatellus , specific primers for putative sphingolipid genes were designed and synthesized by Biosun Biotech (Hangzhou, China). .. The resulting PCR product was gel purified, ligated into the vector pGEM-T (Promega, USA), and transformed into Escherichia coli DH5α.

    Construct:

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Expression of mVenus-hGeminin and mCherry-hCdt1 (the kind gifts of the RIKEN Brain Science Institute, Wako, Japan) was after they had been cloned as PCR-amplified Eco RI/Xba I fragments into pCI-neo. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega). .. E1.5 (2-cell) embryos (the day following activation) were transferred to the oviductal ampullae of pseudo-pregnant CD-1 females at day 0.5 (that is, plugged females that had been mated with vasectomized males the previous night).

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1. .. The C.S3 cassette (encoding Smr Spr ) was excised from plasmid pRL463 [ ] with Bam HI and inserted into the Bcl I-digested pCSS1 to interrupt the ORF alr1519 , obtaining plasmid pCSS2.

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: To construct the BurA1Δeby CAB mutant, two regions of a 1 kb long fragment located upstream and downstream (UD) from the eby CAB operon were amplified from the genome of S . maltophilia BurA1 using primers upBurA1-F/upBurA1-R and dwBurA1-F/dwBurA1-R ( ). .. The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: There was no significant difference between these sequence variants in any of the in vitro kinetic parameters measured in this study ( Supplementary Table S1 and Figure S2 ). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. The insert of this plasmid was reamplified using primers that covered the 451 nt of hTR and included a T7 promoter (5′-end, for transcription) and a FokI restriction sequence (3′-end, for plasmid linearization) and inserted into the EcoRI/BamHI sites of plasmid pUC19.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: The PCR amplification included denaturalization for 3 min at 94°C, followed by 30 cycles (95°C, 1 min) with one annealing elongation step at 71°C for 1 min and, finally, an elongation step at 72°C for 10 min. PCR was carried out in a PTC-100 (MJ Research Inc.). .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue. .. Positive bacterial colonies were identified by PCR employing the primers; SP6 (5\ATTTAGGTGACACTATAGAA3) and T7 (5\TAATACGACTCACTATAGGG3\).

    Electrophoresis:

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site.

    Nuclear Magnetic Resonance:

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: Amplified fragments were cloned into vector pGEM-T (Promega) in the case of alr2536 and all0342 or pGEM-T Easy (Promega) for alr3429 , producing pCSR4, pCSR1, and pCSR19, respectively, and then transferred as Bam HI-ended fragments to Bam HI-digested pRL424 [ ] producing pCSR17, pCSR13, and pCSR23, respectively (Nmr ). .. The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1.

    Activity Assay:

    Article Title: Functional Brachyury Binding Sites Establish a Temporal Read-out of Gene Expression in the Ciona NotochordCis-Regulatory Timers for Developmental Gene Expression
    Article Snippet: All genomic fragments were PCR-amplified from C. intestinalis genomic DNA purified from sperm of a single individual and cloned into the pFBΔSP6 vector , either directly or after an intermediate cloning step into the vector pGEM-T (Promega). .. A list of the oligonucleotides employed for PCR amplifications of the initial fragments is provided in ; sequences of the oligonucleotides employed for the construction of the truncations and point mutation constructs are available upon re quest.

    Expressing:

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Expression of mVenus-hGeminin and mCherry-hCdt1 (the kind gifts of the RIKEN Brain Science Institute, Wako, Japan) was after they had been cloned as PCR-amplified Eco RI/Xba I fragments into pCI-neo. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega). .. E1.5 (2-cell) embryos (the day following activation) were transferred to the oviductal ampullae of pseudo-pregnant CD-1 females at day 0.5 (that is, plugged females that had been mated with vasectomized males the previous night).

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: These hTERT sequence changes (S229T and D516G) were corrected in the wild-type (wt) and mutant +170 expression constructs using the QuikChange II XL site-directed mutagenesis kit (Stratagene). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega).

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). .. The biotinylated LINC00460 and LIMK2 probes were dissolved in binding and washing buffer and incubated with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) at 25°C for 10 minutes to generate probe-coated beads according to the manufacturer’s protocol.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue. .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue.

    Modification:

    Article Title: Eutremagiganteum ( Brassicaceae), a new species from Sichuan, southwest China
    Article Snippet: We extracted total DNA from silica gel-dried leaves using the modified CTAB method (Doyle and Doyle 1990). .. For those ITS sequences with double peaks in those possible hybrids, we further cloned them using vector pGEM-T (Promega, Madison, Wisconsin).

    Transformation Assay:

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Overlapping PCR was performed according to the Genome Walker kit protocol (Takara, Cat#: D316). .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01). .. The insertion sequence was sequenced and compared with the whole pig genome sequence in GenBank.

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS . .. The resulting construct was digested with SwaI and ligated with the aphA-3 gene that was amplified from pMW10 ( ) with primers Kan_F and Kan_R ( ).

    Article Title: Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp, USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBP?II) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp., USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD. .. The plasmid pGEM-UD was then digested by Eco RI in order to release the UD fragment, which was next cloned into plasmid pEx18-Tc.

    Article Title: Rice Stripe Virus Infection Alters mRNA Levels of Sphingolipid-Metabolizing Enzymes and Sphingolipids Content in Laodelphax striatellus
    Article Snippet: The primer pair specific for each putative sphingolipid gene was used along with eTaq (Takara, China) to amplify its cDNA from the cDNA templates. .. The resulting PCR product was gel purified, ligated into the vector pGEM-T (Promega, USA), and transformed into Escherichia coli DH5α. .. Three independent clones were selected and sequenced.

    Derivative Assay:

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Into this construct, we inserted an Eco RV/Not I fragment derived from p3XFLAG-CMV-14 (Sigma-Aldrich, UK) to generate an mKO2-FLAG3 fusion. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega).

    Conjugation Assay:

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD. .. The plasmid pGEM-UD was then digested by Eco RI in order to release the UD fragment, which was next cloned into plasmid pEx18-Tc.

    Gas Chromatography:

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Transcriptional start sites were determined by rapid amplification of cDNA ends (RACE) with the Invitrogen™ RACE kit according to the alternative protocol for first-strand cDNA synthesis of transcripts of high GC content. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site.

    Infection:

    Article Title: Arabidopsis Novel Glycine-Rich Plasma Membrane PSS1 Protein Enhances Disease Resistance in Transgenic Soybean Plants
    Article Snippet: The gene PSS1 was first cloned into vector pGEM-T (Promega) and sequenced to confirm its identity. .. The gene was then released from the pGEM-T vector and cloned in the modified binary pTF102 vectors carrying one of three promoters: Prom1, Prom2, and Ubi10.

    Generated:

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Expression of mVenus-hGeminin and mCherry-hCdt1 (the kind gifts of the RIKEN Brain Science Institute, Wako, Japan) was after they had been cloned as PCR-amplified Eco RI/Xba I fragments into pCI-neo. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega). .. E1.5 (2-cell) embryos (the day following activation) were transferred to the oviductal ampullae of pseudo-pregnant CD-1 females at day 0.5 (that is, plugged females that had been mated with vasectomized males the previous night).

    Polymerase Chain Reaction:

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production
    Article Snippet: The ClaI and HincII restriction sites were introduced into the PCR product. .. The 929-bp product was inserted into the commercial vector pGEM-T (Promega), resulting in plasmid pLZZH01 (Fig. ).

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: The PCR product of 1027 bp was purified using QIAquick PCR purification kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA). .. Each ligation mixture was transformed into One-Shot® TOP10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Overlapping PCR was performed according to the Genome Walker kit protocol (Takara, Cat#: D316). .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01).

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Expression of mVenus-hGeminin and mCherry-hCdt1 (the kind gifts of the RIKEN Brain Science Institute, Wako, Japan) was after they had been cloned as PCR-amplified Eco RI/Xba I fragments into pCI-neo. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega). .. E1.5 (2-cell) embryos (the day following activation) were transferred to the oviductal ampullae of pseudo-pregnant CD-1 females at day 0.5 (that is, plugged females that had been mated with vasectomized males the previous night).

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Insertion-deletion mutagenesis in the kpsS gene (encoding an ABC transporter involved in capsule transport) of IA3902 was performed in order to define the role of CPS in studies performed here according to our previously reported methods ( ). .. Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS . .. The resulting construct was digested with SwaI and ligated with the aphA-3 gene that was amplified from pMW10 ( ) with primers Kan_F and Kan_R ( ).

    Article Title: Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp, USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBP?II) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp., USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: For inactivation of alr2536 , all0342 , and alr3429 , internal fragments of 552 bp, 596 bp, and 469 bp, respectively, were amplified by PCR using DNA from strain PCC 7120 as a template and primers alr2536-7120-1 and alr2536-7120-2 for alr2536 , all0342-7120-1 and all0342-7120-2 for all0342 , and alr3429-7120-1 and alr3429-7120-2 for alr3429 (all primers contain Bam HI restriction sites in their 5' ends and are listed in ). .. The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1.

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Non-tailed cDNA was used in PCR reactions as negative control. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site. .. For phase contrast and fluorescent microscopy, S. coelicolor M145, mutant strain, TSB01 and the mutant strain complemented with ssbB (TSB02) or with ssbBΔC (TSB03) were grown in the acute angle of sterile coverslips inserted obliquely in an MS plate.

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The 952-bp and 1018-bp PCR products were subsequently hybridized using complementary regions introduced in primers. .. The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD.

    Article Title: Functional Brachyury Binding Sites Establish a Temporal Read-out of Gene Expression in the Ciona NotochordCis-Regulatory Timers for Developmental Gene Expression
    Article Snippet: After incubation with X-Gal, only well-developed embryos that showed β-galactosidase staining in any tissue were counted. .. All genomic fragments were PCR-amplified from C. intestinalis genomic DNA purified from sperm of a single individual and cloned into the pFBΔSP6 vector , either directly or after an intermediate cloning step into the vector pGEM-T (Promega). .. A list of the oligonucleotides employed for PCR amplifications of the initial fragments is provided in ; sequences of the oligonucleotides employed for the construction of the truncations and point mutation constructs are available upon re quest.

    Article Title: Eutremagiganteum ( Brassicaceae), a new species from Sichuan, southwest China
    Article Snippet: PCR amplification and sequencing approaches followed and . .. For those ITS sequences with double peaks in those possible hybrids, we further cloned them using vector pGEM-T (Promega, Madison, Wisconsin).

    Article Title: Rice Stripe Virus Infection Alters mRNA Levels of Sphingolipid-Metabolizing Enzymes and Sphingolipids Content in Laodelphax striatellus
    Article Snippet: The primer pair specific for each putative sphingolipid gene was used along with eTaq (Takara, China) to amplify its cDNA from the cDNA templates. .. The resulting PCR product was gel purified, ligated into the vector pGEM-T (Promega, USA), and transformed into Escherichia coli DH5α. .. Three independent clones were selected and sequenced.

    Article Title: Novel strong promoter of antimicrobial peptides gene pro-SmAMP2 from chickweed (Stellaria media)
    Article Snippet: The target nucleotide sequence was amplified by two-step PCR according to the instructions of the manufacturer. .. The PCR product 2400 bp long was cloned in the vector pGEM-T (Promega, USA) and sequenced. .. The first nucleotide of the transcription start site (TSS) was designated as +1.

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: The PCR was carried out as described by . .. The PCR product was cloned in vector pGEM-T (Promega). .. Plasmid probes were 32 P-labeled by random-priming and oligonucleotide probes were 32 P-labeled with T4 polynucleotide kinase.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: There was no significant difference between these sequence variants in any of the in vitro kinetic parameters measured in this study ( Supplementary Table S1 and Figure S2 ). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. The insert of this plasmid was reamplified using primers that covered the 451 nt of hTR and included a T7 promoter (5′-end, for transcription) and a FokI restriction sequence (3′-end, for plasmid linearization) and inserted into the EcoRI/BamHI sites of plasmid pUC19.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: The PCR amplification included denaturalization for 3 min at 94°C, followed by 30 cycles (95°C, 1 min) with one annealing elongation step at 71°C for 1 min and, finally, an elongation step at 72°C for 10 min. PCR was carried out in a PTC-100 (MJ Research Inc.). .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue.

    DNA Sequencing:

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA). .. Each ligation mixture was transformed into One-Shot® TOP10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: Paragraph title: DNA analysis, sequencing and probes ... The PCR product was cloned in vector pGEM-T (Promega).

    Sequencing:

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: Paragraph title: Gene amplification and sequencing of PkDBPαII ... The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA).

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Three sequence-specific primers were designed based on the right side of the pTTGH sequence as follows, R-SP1 (5′ - CCGGATACCTGTCCGCCTTTCTC - 3′) , R-SP2 (5′ - GTGGCGCTTTCTCATAGCTCACG - 3′) and R-SP3 (5′ - TGCGCCTTATCCCGGTAACTATCG - 3′). .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01).

    Article Title: Eutremagiganteum ( Brassicaceae), a new species from Sichuan, southwest China
    Article Snippet: PCR amplification and sequencing approaches followed and . .. For those ITS sequences with double peaks in those possible hybrids, we further cloned them using vector pGEM-T (Promega, Madison, Wisconsin).

    Article Title: Novel strong promoter of antimicrobial peptides gene pro-SmAMP2 from chickweed (Stellaria media)
    Article Snippet: Paragraph title: Cloning nucleotide sequence of pro-SmAMP2 gene promoter region from chickweed S. media ... The PCR product 2400 bp long was cloned in the vector pGEM-T (Promega, USA) and sequenced.

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: The PCR product was cloned in vector pGEM-T (Promega). .. The BAC clones were sequenced at The Wellcome Trust Sanger Institute by the standard shotgun sequencing and directed finishing approach.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega).

    Recombinant:

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA). .. Each ligation mixture was transformed into One-Shot® TOP10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Paragraph title: Generation of recombinant fusion constructs ... To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega).

    Article Title: Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia
    Article Snippet: The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp, USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBP?II) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia
    Article Snippet: The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp., USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: Paragraph title: Recombinant somatic H. contortus protein 26/23 (rHcp26/23) ... The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue.

    Pulsed-Field Gel:

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: DNA was analyzed by pulsed-field gel electrophoresis using a “Waltzer” apparatus , and transferred to Hybond N+ nylon filters (Amersham) in 0.4 M NaOH. .. The PCR product was cloned in vector pGEM-T (Promega).

    Pull Down Assay:

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: Paragraph title: RNA pull-down assay ... LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA).

    Mutagenesis:

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production
    Article Snippet: Paragraph title: Construction and characterization of an isogenic tesB knockout mutant of E. coli . ... The 929-bp product was inserted into the commercial vector pGEM-T (Promega), resulting in plasmid pLZZH01 (Fig. ).

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Paragraph title: Construction of a CPS mutant. ... Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS .

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: To construct the BurA1Δeby CAB mutant, two regions of a 1 kb long fragment located upstream and downstream (UD) from the eby CAB operon were amplified from the genome of S . maltophilia BurA1 using primers upBurA1-F/upBurA1-R and dwBurA1-F/dwBurA1-R ( ). .. The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: These hTERT sequence changes (S229T and D516G) were corrected in the wild-type (wt) and mutant +170 expression constructs using the QuikChange II XL site-directed mutagenesis kit (Stratagene). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega).

    RNA Extraction:

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: Paragraph title: RNA Extraction and Real-time Quantitative RT-PCR ... In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA).

    Article Title: Rice Stripe Virus Infection Alters mRNA Levels of Sphingolipid-Metabolizing Enzymes and Sphingolipids Content in Laodelphax striatellus
    Article Snippet: First, second-, third-, fourth-, fifth-instar nymphs and their male or female adults of non-viruliferous L. striatellus and viruliferous L. striatellus were collected and total RNA were extracted from these insects using the RNA extraction reagent Trizol (Invitrogen, USA) according to the instructions from the manufacturer. .. The resulting PCR product was gel purified, ligated into the vector pGEM-T (Promega, USA), and transformed into Escherichia coli DH5α.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: Adult male H. contortus was used in an RNA extraction kit protocol (Qiagen, Germany) according to Garcıa-Coiradas et al . .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue.

    Labeling:

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: Forty-eight hours after transfection, fluorescence signal changes in each group were evaluated by a Dual-Luciferase Reporter Assay System (Promega Corporation, Fitchburg, WI, USA) according to the manufacturer’s protocol. .. LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). .. The biotinylated LINC00460 and LIMK2 probes were dissolved in binding and washing buffer and incubated with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) at 25°C for 10 minutes to generate probe-coated beads according to the manufacturer’s protocol.

    Purification:

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). .. Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China).

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: The PCR product of 1027 bp was purified using QIAquick PCR purification kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA). .. Each ligation mixture was transformed into One-Shot® TOP10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp, USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBP?II) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp., USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Three micrograms of total RNA from the exponential phase of growth (18 h) was reverse transcribed using SuperScript™ II RT and ssb -specific primers ( Supplementary Table S3 ) or with MultiScribe™ Reverse Transcriptase (Applied Biosystems) according to the manufacturer’s instructions. cDNA was purified using SNAP columns and C-tailed by terminal deoxyribonucleoside transferase (TdT). .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site.

    Article Title: Functional Brachyury Binding Sites Establish a Temporal Read-out of Gene Expression in the Ciona NotochordCis-Regulatory Timers for Developmental Gene Expression
    Article Snippet: After incubation with X-Gal, only well-developed embryos that showed β-galactosidase staining in any tissue were counted. .. All genomic fragments were PCR-amplified from C. intestinalis genomic DNA purified from sperm of a single individual and cloned into the pFBΔSP6 vector , either directly or after an intermediate cloning step into the vector pGEM-T (Promega). .. A list of the oligonucleotides employed for PCR amplifications of the initial fragments is provided in ; sequences of the oligonucleotides employed for the construction of the truncations and point mutation constructs are available upon re quest.

    Article Title: Rice Stripe Virus Infection Alters mRNA Levels of Sphingolipid-Metabolizing Enzymes and Sphingolipids Content in Laodelphax striatellus
    Article Snippet: The primer pair specific for each putative sphingolipid gene was used along with eTaq (Takara, China) to amplify its cDNA from the cDNA templates. .. The resulting PCR product was gel purified, ligated into the vector pGEM-T (Promega, USA), and transformed into Escherichia coli DH5α. .. Three independent clones were selected and sequenced.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. Linearization of the plasmid with FokI results in a transcription product terminating at the hTR 3′-end.

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: Forty-eight hours after transfection, fluorescence signal changes in each group were evaluated by a Dual-Luciferase Reporter Assay System (Promega Corporation, Fitchburg, WI, USA) according to the manufacturer’s protocol. .. LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). .. The biotinylated LINC00460 and LIMK2 probes were dissolved in binding and washing buffer and incubated with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) at 25°C for 10 minutes to generate probe-coated beads according to the manufacturer’s protocol.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: The RNA was eluted in a final volume of 60 μL of elution buffer and used immediately or stored at -80°C. .. In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). .. Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China).

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: H3.3 was cloned into pCI-Neo-mKO2-FLAG as an Xba I/Sal GI fragment from cDNA generated by mII oocyte RT-PCR. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega).

    Positron Emission Tomography:

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: To create plasmids for in vitro expression, selected mutants were digested with EcoRI/SalI and the FLAG-hTERT fragment was sub-cloned into EcoRI/SalI sites of the pET-28 plasmid (Invitrogen). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega).

    Quantitative RT-PCR:

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: Paragraph title: RNA Extraction and Real-time Quantitative RT-PCR ... In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA).

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Paragraph title: Chromosome walking and QRT-PCR analysis of the transgene in cells ... Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01).

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). .. The biotinylated LINC00460 and LIMK2 probes were dissolved in binding and washing buffer and incubated with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) at 25°C for 10 minutes to generate probe-coated beads according to the manufacturer’s protocol.

    Periodic Counter-current Chromatography:

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: For inactivation of alr1519 , a 2.3 kb DNA fragment carrying the full ORF and flanking regions was amplified from genomic DNA from strain PCC 7120 using primers AA-1 and AA-2. .. The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1.

    Gel Extraction:

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Overlapping PCR was performed according to the Genome Walker kit protocol (Takara, Cat#: D316). .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01). .. The insertion sequence was sequenced and compared with the whole pig genome sequence in GenBank.

    Shotgun Sequencing:

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: The PCR product was cloned in vector pGEM-T (Promega). .. Plasmid probes were 32 P-labeled by random-priming and oligonucleotide probes were 32 P-labeled with T4 polynucleotide kinase.

    Rapid Amplification of cDNA Ends:

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Transcriptional start sites were determined by rapid amplification of cDNA ends (RACE) with the Invitrogen™ RACE kit according to the alternative protocol for first-strand cDNA synthesis of transcripts of high GC content. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site.

    SPR Assay:

    Article Title: Amino Acid Transporters and Release of Hydrophobic Amino Acids in the Heterocyst-Forming Cyanobacterium Anabaena sp. Strain PCC 7120
    Article Snippet: The amplified fragment was inserted into vector pGEM-T (Promega) producing pCSS1. .. The C.S3 cassette (encoding Smr Spr ) was excised from plasmid pRL463 [ ] with Bam HI and inserted into the Bcl I-digested pCSS1 to interrupt the ORF alr1519 , obtaining plasmid pCSS2.

    Plasmid Preparation:

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production
    Article Snippet: The ClaI and HincII restriction sites were introduced into the PCR product. .. The 929-bp product was inserted into the commercial vector pGEM-T (Promega), resulting in plasmid pLZZH01 (Fig. ). .. The DNA sequence of tesB obtained from the inserted DNA fragment (sequenced by BioAsia Co.) exactly matched that found in the GenBank database (accession number ).

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: The RNA was eluted in a final volume of 60 μL of elution buffer and used immediately or stored at -80°C. .. In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). .. Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China).

    Article Title: The Duffy binding protein (PkDBPαII) of Plasmodium knowlesi from Peninsular Malaysia and Malaysian Borneo show different binding activity level to human erythrocytes
    Article Snippet: The PCR product of 1027 bp was purified using QIAquick PCR purification kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR product was then ligated into cloning vector pGEM-T® (Promega Corp, USA). .. Each ligation mixture was transformed into One-Shot® TOP10 chemically competent E. coli cells (Invitrogen, Carlsbad, CA).

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Overlapping PCR was performed according to the Genome Walker kit protocol (Takara, Cat#: D316). .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01). .. The insertion sequence was sequenced and compared with the whole pig genome sequence in GenBank.

    Article Title: Mice produced by mitotic reprogramming of sperm injected into haploid parthenogenotes
    Article Snippet: Expression of mVenus-hGeminin and mCherry-hCdt1 (the kind gifts of the RIKEN Brain Science Institute, Wako, Japan) was after they had been cloned as PCR-amplified Eco RI/Xba I fragments into pCI-neo. .. To generate the transgene construct in which the Oct4A promoter drives mCherry expression, a fragment including the Oct4A start codon and ∼5 kb of upstream promoter sequences was generated by PCR and cloned with an mCherry reporter fragment into the Not I site of vector pGEM-T (Promega). .. E1.5 (2-cell) embryos (the day following activation) were transferred to the oviductal ampullae of pseudo-pregnant CD-1 females at day 0.5 (that is, plugged females that had been mated with vasectomized males the previous night).

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Insertion-deletion mutagenesis in the kpsS gene (encoding an ABC transporter involved in capsule transport) of IA3902 was performed in order to define the role of CPS in studies performed here according to our previously reported methods ( ). .. Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS . .. The resulting construct was digested with SwaI and ligated with the aphA-3 gene that was amplified from pMW10 ( ) with primers Kan_F and Kan_R ( ).

    Article Title: Arabidopsis Novel Glycine-Rich Plasma Membrane PSS1 Protein Enhances Disease Resistance in Transgenic Soybean Plants
    Article Snippet: To monitor the mCherry signal, a HeNe 561 laser (561 nm) and a third PMT detector (587–610 nm) were used ( ). .. The gene PSS1 was first cloned into vector pGEM-T (Promega) and sequenced to confirm its identity. .. The gene was then released from the pGEM-T vector and cloned in the modified binary pTF102 vectors carrying one of three promoters: Prom1, Prom2, and Ubi10.

    Article Title: Distinct genetic difference between the Duffy binding protein (PkDBPαII) of Plasmodium knowlesi clinical isolates from North Borneo and Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp, USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Genetic diversity, haplotypes and allele groups of Duffy binding protein (PkDBP?II) of Plasmodium knowlesi clinical isolates from Peninsular Malaysia
    Article Snippet: PCR products were purified by QIAquick PCR purification Kit (QIAGEN, Hilden, Germany) following the manufacturer’s instructions. .. The purified PCR products were then ligated into cloning vector pGEM-T® (Promega Corp., USA) and transformed into Escherichia coli TOP10F’. .. Plasmids of recombinant clones harbouring the PkDBPαII fragment were sent to a commercial laboratory for DNA sequencing.

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Non-tailed cDNA was used in PCR reactions as negative control. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site. .. For phase contrast and fluorescent microscopy, S. coelicolor M145, mutant strain, TSB01 and the mutant strain complemented with ssbB (TSB02) or with ssbBΔC (TSB03) were grown in the acute angle of sterile coverslips inserted obliquely in an MS plate.

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The 952-bp and 1018-bp PCR products were subsequently hybridized using complementary regions introduced in primers. .. The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD. .. The plasmid was introduced into Escherichia coli DH5α.

    Article Title: Functional Brachyury Binding Sites Establish a Temporal Read-out of Gene Expression in the Ciona NotochordCis-Regulatory Timers for Developmental Gene Expression
    Article Snippet: After incubation with X-Gal, only well-developed embryos that showed β-galactosidase staining in any tissue were counted. .. All genomic fragments were PCR-amplified from C. intestinalis genomic DNA purified from sperm of a single individual and cloned into the pFBΔSP6 vector , either directly or after an intermediate cloning step into the vector pGEM-T (Promega). .. A list of the oligonucleotides employed for PCR amplifications of the initial fragments is provided in ; sequences of the oligonucleotides employed for the construction of the truncations and point mutation constructs are available upon re quest.

    Article Title: Eutremagiganteum ( Brassicaceae), a new species from Sichuan, southwest China
    Article Snippet: PCR amplification and sequencing approaches followed and . .. For those ITS sequences with double peaks in those possible hybrids, we further cloned them using vector pGEM-T (Promega, Madison, Wisconsin). .. We selected ten positive clones for sequencing with primers “sp6” and “t7”.

    Article Title: Novel strong promoter of antimicrobial peptides gene pro-SmAMP2 from chickweed (Stellaria media)
    Article Snippet: The target nucleotide sequence was amplified by two-step PCR according to the instructions of the manufacturer. .. The PCR product 2400 bp long was cloned in the vector pGEM-T (Promega, USA) and sequenced. .. The first nucleotide of the transcription start site (TSS) was designated as +1.

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: The PCR was carried out as described by . .. The PCR product was cloned in vector pGEM-T (Promega). .. Plasmid probes were 32 P-labeled by random-priming and oligonucleotide probes were 32 P-labeled with T4 polynucleotide kinase.

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: There was no significant difference between these sequence variants in any of the in vitro kinetic parameters measured in this study ( Supplementary Table S1 and Figure S2 ). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. The insert of this plasmid was reamplified using primers that covered the 451 nt of hTR and included a T7 promoter (5′-end, for transcription) and a FokI restriction sequence (3′-end, for plasmid linearization) and inserted into the EcoRI/BamHI sites of plasmid pUC19.

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: Forty-eight hours after transfection, fluorescence signal changes in each group were evaluated by a Dual-Luciferase Reporter Assay System (Promega Corporation, Fitchburg, WI, USA) according to the manufacturer’s protocol. .. LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). .. The biotinylated LINC00460 and LIMK2 probes were dissolved in binding and washing buffer and incubated with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) at 25°C for 10 minutes to generate probe-coated beads according to the manufacturer’s protocol.

    Article Title: Evaluation of crude larval protein and recombinant somatic protein 26/23 (rHcp26/23) immunization against Haemonchuscontortus in sheep
    Article Snippet: The PCR amplification included denaturalization for 3 min at 94°C, followed by 30 cycles (95°C, 1 min) with one annealing elongation step at 71°C for 1 min and, finally, an elongation step at 72°C for 10 min. PCR was carried out in a PTC-100 (MJ Research Inc.). .. The resulting fragment was cloned in the vector pGEM-T (Promega), and the construct was used to transform Escherichia coli XL2-blue. .. Positive bacterial colonies were identified by PCR employing the primers; SP6 (5\ATTTAGGTGACACTATAGAA3) and T7 (5\TAATACGACTCACTATAGGG3\).

    Negative Control:

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Non-tailed cDNA was used in PCR reactions as negative control. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site.

    Selection:

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD. .. The plasmid pEx18-UD was introduced into E . coli S17-1 by transformation and mobilized into S . maltophilia BurA1 via conjugation.

    Agarose Gel Electrophoresis:

    Article Title: Structure-function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation
    Article Snippet: Non-tailed cDNA was used in PCR reactions as negative control. .. PCR products were separated, extracted from an agarose gel, cloned into vector pGEM-T (Promega) and sequenced to determine the transcriptional start site. .. For phase contrast and fluorescent microscopy, S. coelicolor M145, mutant strain, TSB01 and the mutant strain complemented with ssbB (TSB02) or with ssbBΔC (TSB03) were grown in the acute angle of sterile coverslips inserted obliquely in an MS plate.

    In Vitro:

    Article Title: Clinical Efficacy of Therapy with Recombinant Human Interferon α1b in Hand, Foot, and Mouth Disease with Enterovirus 71 Infection
    Article Snippet: In order to establish copy number as a unit of viral load, a 226 bp fragment of the VP1 gene of EV71 was amplified by RT-PCR then cloned into vector pGEM-T (Promega, Madison, WI, USA). .. Next, the recombinant plasmids extracted were linearized by the SpeI digestion (TaKaRa, Dalian, China).

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: There was no significant difference between these sequence variants in any of the in vitro kinetic parameters measured in this study ( Supplementary Table S1 and Figure S2 ). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega). .. The insert of this plasmid was reamplified using primers that covered the 451 nt of hTR and included a T7 promoter (5′-end, for transcription) and a FokI restriction sequence (3′-end, for plasmid linearization) and inserted into the EcoRI/BamHI sites of plasmid pUC19.

    Transgenic Assay:

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: The foreign pTTGH insertion sites and their chromosomal positions in the transgenic cell lines were detected using the genome walking method. .. Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01).

    Article Title: Arabidopsis Novel Glycine-Rich Plasma Membrane PSS1 Protein Enhances Disease Resistance in Transgenic Soybean Plants
    Article Snippet: Paragraph title: Generation of Transgenic Soybean Lines ... The gene PSS1 was first cloned into vector pGEM-T (Promega) and sequenced to confirm its identity.

    Chromosome Walking:

    Article Title: The transgenic cloned pig population with integrated and controllable GH expression that has higher feed efficiency and meat production
    Article Snippet: Paragraph title: Chromosome walking and QRT-PCR analysis of the transgene in cells ... Specific amplified products were recovered via gel extraction (BioTeke, Cat#: DP4101, Beijing, China), linked with the vector pGEM-T (Promega, Cat#: A1360, Madison, USA) and then transformed into competent cell E . coli. (Transgen, Cat#: CD201-01).

    Incubation:

    Article Title: lncRNA LINC00460 promoted colorectal cancer cells metastasis via miR-939-5p sponging
    Article Snippet: LINC00460-wt and LINC00460-mut as well as LIMK2-wt and LIMK2-mut were transcribed from vector pGEM® -T (Promega Corporation) and biotin-labeled with the Biotin RNA Labeling Mix (Hoffman-La Roche Ltd., Basel, Switzerland) and T7 RNA polymerase (Hoffman-La Roche Ltd.), treated with RNase-free DNase I (Hoffman-La Roche Ltd.), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). .. The biotinylated LINC00460 and LIMK2 probes were dissolved in binding and washing buffer and incubated with Dynabeads M-280 Streptavidin (Thermo Fisher Scientific) at 25°C for 10 minutes to generate probe-coated beads according to the manufacturer’s protocol.

    Knock-Out:

    Article Title: Thioesterase II of Escherichia coli Plays an Important Role in 3-Hydroxydecanoic Acid Production
    Article Snippet: Paragraph title: Construction and characterization of an isogenic tesB knockout mutant of E. coli . ... The 929-bp product was inserted into the commercial vector pGEM-T (Promega), resulting in plasmid pLZZH01 (Fig. ).

    FLAG-tag:

    Article Title: Direct involvement of the TEN domain at the active site of human telomerase
    Article Snippet: A panel of hTERT mutants with substitutions of the sequence NAAIRS and an N-terminal FLAG tag in the retroviral vector pBabehygro was kindly provided by Dr Christopher Counter, Duke University Medical Centre, Durham, NC ( ). .. To construct a plasmid for in vitro transcription of hTR, the hTR gene [nucleotides 1–592] was amplified by PCR ( ) and inserted into the vector pGEM-T (Promega).

    BAC Assay:

    Article Title: The structure of an endogenous Drosophila centromere reveals the prevalence of tandemly repeated sequences able to form i-motifs
    Article Snippet: The PCR product was cloned in vector pGEM-T (Promega). .. Plasmid probes were 32 P-labeled by random-priming and oligonucleotide probes were 32 P-labeled with T4 polynucleotide kinase.

    Staining:

    Article Title: Key Role of Capsular Polysaccharide in the Induction of Systemic Infection and Abortion by Hypervirulent Campylobacter jejuni
    Article Snippet: Briefly, a 1,693-bp region harboring kpsS (CJSA_1344) (1,182 bp) of IA3902 was PCR amplified with primers kpsS_F and kpsS_R ( ) and cloned into the commercial vector pGEM-T (Promega, Madison, WI) to yield pGEM-T:: kpsS . .. The suicide vector was delivered to C. jejuni IA3902 via natural transformation, and mutants were selected on MH agar plates containing kanamycin (50 μg/ml).

    Homologous Recombination:

    Article Title: Survival and growth of Stenotrophomonas maltophilia in free-living amoebae (FLA) and bacterial virulence properties
    Article Snippet: The UD fragment obtained was cloned into the vector pGEM-T (Promega) yielding plasmid pGEM-UD. .. The plasmid pEx18-UD was introduced into E . coli S17-1 by transformation and mobilized into S . maltophilia BurA1 via conjugation.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 79
    Promega pgem t easy vector
    Binding between ApoH and Hepatitis C virus-related particles. Sera from both five <t>HCV-positive</t> patients (HCV-pos) and three HCV-negative healthy controls (HC) were assayed for viral detection. (A) <t>RT-PCR</t> detection of HCV from 20-fold diluted sera, after the viral capture by ApoH-coated beads. Lanes M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (pGEM-T easy with an HCV/PCR-insert) and the negative extraction control. (B) ApoH-ELISA immunoassay to detect HCV-related particles binding from serially-diluted sera. Aliquots from the same sera as used for RT-PCR were 10, 50, 500, and 5,000-fold diluted and subsequently detected with the anti-HCV/E2 MAb.
    Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector/product/Promega
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2019-12
    79/100 stars
      Buy from Supplier

    Image Search Results


    Binding between ApoH and Hepatitis C virus-related particles. Sera from both five HCV-positive patients (HCV-pos) and three HCV-negative healthy controls (HC) were assayed for viral detection. (A) RT-PCR detection of HCV from 20-fold diluted sera, after the viral capture by ApoH-coated beads. Lanes M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (pGEM-T easy with an HCV/PCR-insert) and the negative extraction control. (B) ApoH-ELISA immunoassay to detect HCV-related particles binding from serially-diluted sera. Aliquots from the same sera as used for RT-PCR were 10, 50, 500, and 5,000-fold diluted and subsequently detected with the anti-HCV/E2 MAb.

    Journal: PLoS ONE

    Article Title: Interactions between Hepatitis C Virus and the Human Apolipoprotein H Acute Phase Protein: A Tool for a Sensitive Detection of the Virus

    doi: 10.1371/journal.pone.0140900

    Figure Lengend Snippet: Binding between ApoH and Hepatitis C virus-related particles. Sera from both five HCV-positive patients (HCV-pos) and three HCV-negative healthy controls (HC) were assayed for viral detection. (A) RT-PCR detection of HCV from 20-fold diluted sera, after the viral capture by ApoH-coated beads. Lanes M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (pGEM-T easy with an HCV/PCR-insert) and the negative extraction control. (B) ApoH-ELISA immunoassay to detect HCV-related particles binding from serially-diluted sera. Aliquots from the same sera as used for RT-PCR were 10, 50, 500, and 5,000-fold diluted and subsequently detected with the anti-HCV/E2 MAb.

    Article Snippet: An HCV plasmid (pGEM-T easy, Promega, with an HCV/PCR-insert) was used as template to make the standard curve and compute HCV copies.

    Techniques: Binding Assay, Reverse Transcription Polymerase Chain Reaction, Marker, Positive Control, Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay

    Statistical comparisons and correlations between positive qRT-PCR HCV detection with and without the preparative ApoH-capture HCV step. (A) Scatter-plot comparing the HCV loads using the real-time RT-PCR COBAS® TaqMan® HCV Test, v2.0 alone versus the open home-made HCV real-time RT-PCR assay after the ApoH-HCV capture. Forty-eight clinical samples from HCV-infected patients were tested. The solid line represents the regression curve. (B) Bland-Altman plot depicts the correlation of the viral load figures from COBAS HCV real-time RT-PCR assay alone and the figures resulting from the HCV real-time RT-PCR assay associated with the ApoH sample pretreatment (n = 48). The graph displays a scatter diagram of the differences plotted against the averages of the two measurements. Horizontal lines are drawn at the mean difference and at the mean difference ± 1.96 times the standard deviation, SD, of the differences (95% limits of confidence).

    Journal: PLoS ONE

    Article Title: Interactions between Hepatitis C Virus and the Human Apolipoprotein H Acute Phase Protein: A Tool for a Sensitive Detection of the Virus

    doi: 10.1371/journal.pone.0140900

    Figure Lengend Snippet: Statistical comparisons and correlations between positive qRT-PCR HCV detection with and without the preparative ApoH-capture HCV step. (A) Scatter-plot comparing the HCV loads using the real-time RT-PCR COBAS® TaqMan® HCV Test, v2.0 alone versus the open home-made HCV real-time RT-PCR assay after the ApoH-HCV capture. Forty-eight clinical samples from HCV-infected patients were tested. The solid line represents the regression curve. (B) Bland-Altman plot depicts the correlation of the viral load figures from COBAS HCV real-time RT-PCR assay alone and the figures resulting from the HCV real-time RT-PCR assay associated with the ApoH sample pretreatment (n = 48). The graph displays a scatter diagram of the differences plotted against the averages of the two measurements. Horizontal lines are drawn at the mean difference and at the mean difference ± 1.96 times the standard deviation, SD, of the differences (95% limits of confidence).

    Article Snippet: An HCV plasmid (pGEM-T easy, Promega, with an HCV/PCR-insert) was used as template to make the standard curve and compute HCV copies.

    Techniques: Quantitative RT-PCR, Infection, Standard Deviation

    ApoH captures HCV/RNA-containing particles, from low-density and high-density plasma fractions. A pool of 10 HCV/RNA-positive untreated patients was separated into three fractions, respectively corresponding to the floating densities of VLDL, LDL and HDL. One hundred μL of VLDL, 10 μL of LDL and 1 μL of HDL were respectively incubated with 10 μL of ApoH-coated nanomagnetic beads and HCV/RNA was submitted to a home-made HCV RT-PCR. Lanes M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (plasmid pGEM-T easy with an HCV/PCR-insert) and negative PCR control.

    Journal: PLoS ONE

    Article Title: Interactions between Hepatitis C Virus and the Human Apolipoprotein H Acute Phase Protein: A Tool for a Sensitive Detection of the Virus

    doi: 10.1371/journal.pone.0140900

    Figure Lengend Snippet: ApoH captures HCV/RNA-containing particles, from low-density and high-density plasma fractions. A pool of 10 HCV/RNA-positive untreated patients was separated into three fractions, respectively corresponding to the floating densities of VLDL, LDL and HDL. One hundred μL of VLDL, 10 μL of LDL and 1 μL of HDL were respectively incubated with 10 μL of ApoH-coated nanomagnetic beads and HCV/RNA was submitted to a home-made HCV RT-PCR. Lanes M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (plasmid pGEM-T easy with an HCV/PCR-insert) and negative PCR control.

    Article Snippet: An HCV plasmid (pGEM-T easy, Promega, with an HCV/PCR-insert) was used as template to make the standard curve and compute HCV copies.

    Techniques: Incubation, Reverse Transcription Polymerase Chain Reaction, Marker, Positive Control, Plasmid Preparation, Polymerase Chain Reaction

    Enhanced detection of HCV following HCV capture with ApoH-coated beads. (A) In the presence or in the absence of the ApoH-coated beads, HCV/RNA from 10-fold serial dilutions of a single HCV-infected patient serum was detected in gel after HCV RT-PCR amplification. HCV-negative healthy control serum (HC). (B) List of HCV sequences from 11 HCV-seropositive patients (samples #: 32, 36, 148, 169, 171, 151, 459, 450, 465, 448, 445) with prior negative COBAS HCV RT-PCR, but tested as HCV-positive with the two-step detection method consecutively including the ApoH-sample pretreatment and the home-made HCV RT-PCR.

    Journal: PLoS ONE

    Article Title: Interactions between Hepatitis C Virus and the Human Apolipoprotein H Acute Phase Protein: A Tool for a Sensitive Detection of the Virus

    doi: 10.1371/journal.pone.0140900

    Figure Lengend Snippet: Enhanced detection of HCV following HCV capture with ApoH-coated beads. (A) In the presence or in the absence of the ApoH-coated beads, HCV/RNA from 10-fold serial dilutions of a single HCV-infected patient serum was detected in gel after HCV RT-PCR amplification. HCV-negative healthy control serum (HC). (B) List of HCV sequences from 11 HCV-seropositive patients (samples #: 32, 36, 148, 169, 171, 151, 459, 450, 465, 448, 445) with prior negative COBAS HCV RT-PCR, but tested as HCV-positive with the two-step detection method consecutively including the ApoH-sample pretreatment and the home-made HCV RT-PCR.

    Article Snippet: An HCV plasmid (pGEM-T easy, Promega, with an HCV/PCR-insert) was used as template to make the standard curve and compute HCV copies.

    Techniques: Infection, Reverse Transcription Polymerase Chain Reaction, Amplification

    Binding specificity of ApoH and HCV. (A) One hundred microliters of sera from five HCV-positive patients were incubated with either the α1-acid glycoprotein- or the ApoH- coated plates. The HCV-related antigens were revealed with the anti-HCV/E2 MAb. The bars represent the corresponding means with SD. (B) Sera from both a single healthy control (HC) and one HCV-pos were either incubated with α1-acid glycoprotein or with the ApoH-coated magnetic beads and HCV/RNA was subsequently detected by RT-PCR. M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (plasmid pGEM-T easy with an HCV/PCR-insert) and the negative PCR control. (C) The inhibition of the interaction between ApoH and HCV, previously shown, was assessed either by using the anti-ApoH, 8C3, MAb, or the anti-thyroglobulin, TG2, irrelevant MAb. Increasing concentrations of either 8C3 (solid line) or TG2 (hatched line) were used for the pre-incubation of the ApoH-coated plate with a 50-fold diluted HCV-positive serum.

    Journal: PLoS ONE

    Article Title: Interactions between Hepatitis C Virus and the Human Apolipoprotein H Acute Phase Protein: A Tool for a Sensitive Detection of the Virus

    doi: 10.1371/journal.pone.0140900

    Figure Lengend Snippet: Binding specificity of ApoH and HCV. (A) One hundred microliters of sera from five HCV-positive patients were incubated with either the α1-acid glycoprotein- or the ApoH- coated plates. The HCV-related antigens were revealed with the anti-HCV/E2 MAb. The bars represent the corresponding means with SD. (B) Sera from both a single healthy control (HC) and one HCV-pos were either incubated with α1-acid glycoprotein or with the ApoH-coated magnetic beads and HCV/RNA was subsequently detected by RT-PCR. M, C+ and C- respectively correspond to the DNA molecular mass marker (1 Kb Plus DNA Ladder), the positive control (plasmid pGEM-T easy with an HCV/PCR-insert) and the negative PCR control. (C) The inhibition of the interaction between ApoH and HCV, previously shown, was assessed either by using the anti-ApoH, 8C3, MAb, or the anti-thyroglobulin, TG2, irrelevant MAb. Increasing concentrations of either 8C3 (solid line) or TG2 (hatched line) were used for the pre-incubation of the ApoH-coated plate with a 50-fold diluted HCV-positive serum.

    Article Snippet: An HCV plasmid (pGEM-T easy, Promega, with an HCV/PCR-insert) was used as template to make the standard curve and compute HCV copies.

    Techniques: Binding Assay, Incubation, Magnetic Beads, Reverse Transcription Polymerase Chain Reaction, Marker, Positive Control, Plasmid Preparation, Polymerase Chain Reaction, Inhibition

    ApoH binds the RNA-containing HCV-related particles. (A) Isolation of HCV-related particles by ultracentrifugation. After the ultracentrifugation at 436,000 x g for 4 h at 4°C of pooled sera from HCV/RNA-positive patients, 100 μL fractions of the pellet were layered onto a 900 μL CsCl gradient ranging from 10% to 60% (w/w) (open dots) and ultracentrifuged again at 300,000 g for 18 h at 4°C. The resulting gradient fractions were ten-fold diluted and tested using the HCV-ApoH immunoassay (black dots). (B) The presence or the absence of HCV-RNA in the centrifugation pellet was revealed by RT-PCR, prior to the CsCl gradient and after the gradient, in some of the resulting gradient fractions (CsCl-fr 5, 7, 9, 13, 14, 15 and 18). (C) CsCl ultracentrifugation gradient fractions corresponding to a density of 1.45 g/mL were layered directly onto ApoH-coated electron microscopy grids to observe the purified HCV-particles as previously done for HBV [ 44 ].

    Journal: PLoS ONE

    Article Title: Interactions between Hepatitis C Virus and the Human Apolipoprotein H Acute Phase Protein: A Tool for a Sensitive Detection of the Virus

    doi: 10.1371/journal.pone.0140900

    Figure Lengend Snippet: ApoH binds the RNA-containing HCV-related particles. (A) Isolation of HCV-related particles by ultracentrifugation. After the ultracentrifugation at 436,000 x g for 4 h at 4°C of pooled sera from HCV/RNA-positive patients, 100 μL fractions of the pellet were layered onto a 900 μL CsCl gradient ranging from 10% to 60% (w/w) (open dots) and ultracentrifuged again at 300,000 g for 18 h at 4°C. The resulting gradient fractions were ten-fold diluted and tested using the HCV-ApoH immunoassay (black dots). (B) The presence or the absence of HCV-RNA in the centrifugation pellet was revealed by RT-PCR, prior to the CsCl gradient and after the gradient, in some of the resulting gradient fractions (CsCl-fr 5, 7, 9, 13, 14, 15 and 18). (C) CsCl ultracentrifugation gradient fractions corresponding to a density of 1.45 g/mL were layered directly onto ApoH-coated electron microscopy grids to observe the purified HCV-particles as previously done for HBV [ 44 ].

    Article Snippet: An HCV plasmid (pGEM-T easy, Promega, with an HCV/PCR-insert) was used as template to make the standard curve and compute HCV copies.

    Techniques: Isolation, Centrifugation, Reverse Transcription Polymerase Chain Reaction, Electron Microscopy, Purification

    Validation of a qPCR system for the analysis of mouse tissues. The analyzed cDNAs were the following: (A) , BRP-39; (B) , Ym1; (C) , Ym2; (D) , Chit1; (E) , AMCase; (F) , GAPDH; (G) , β-actin; and (H) , pepsinogen C. Standard curves were obtained using the mouse Refs/CLPs standard DNA with pGEM-T Easy containing the eight mouse cDNA fragments (red closed circles). In addition, the quantification of the mouse entire coding cDNA was performed using the primer pairs for each gene. The target cDNA was amplified from a dilution of the entire coding cDNA with a known concentration and subsequently analyzed as an unknown sample (blue closed rhombuses). Equal quantities were obtained for each tested dilution of the standard curve and entire coding cDNA. Data are expressed as mean ± standard deviation (SD) of three measurements.

    Journal: BMC Molecular Biology

    Article Title: Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung

    doi: 10.1186/1471-2199-15-23

    Figure Lengend Snippet: Validation of a qPCR system for the analysis of mouse tissues. The analyzed cDNAs were the following: (A) , BRP-39; (B) , Ym1; (C) , Ym2; (D) , Chit1; (E) , AMCase; (F) , GAPDH; (G) , β-actin; and (H) , pepsinogen C. Standard curves were obtained using the mouse Refs/CLPs standard DNA with pGEM-T Easy containing the eight mouse cDNA fragments (red closed circles). In addition, the quantification of the mouse entire coding cDNA was performed using the primer pairs for each gene. The target cDNA was amplified from a dilution of the entire coding cDNA with a known concentration and subsequently analyzed as an unknown sample (blue closed rhombuses). Equal quantities were obtained for each tested dilution of the standard curve and entire coding cDNA. Data are expressed as mean ± standard deviation (SD) of three measurements.

    Article Snippet: The PCR product was purified, and 3’-dA was added to the amplified DNA using Takara Taq HS (Takara Bio) and the resulting fragment was cloned into the pGEM-T Easy vector (Promega).

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Concentration Assay, Standard Deviation

    Preparation and validation of the mouse Refs/CLPs standard DNA with pGEM-T Easy. (A) Schematic representation of the mouse Refs/CLPs standard DNA cloning into pGEM-T Easy vector. (B) The mouse Refs/CLPs standard DNA with pGEM-T Easy was PCR-amplified from the plasmid DNA using the BRP-39 forward (blue arrow) and Ym1 reverse (red arrow) primers. As described above, we amplified the Ym1 and Ym2 cDNAs from this standard DNA using the Ym1 (C) and Ym2 (D) primers and these PCR products were analyzed using 10% polyacrylamide gel electrophoresis (E) . The y axis was expressed as first derivative of the fluorescence as a function of temperature (C and D) .

    Journal: BMC Molecular Biology

    Article Title: Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung

    doi: 10.1186/1471-2199-15-23

    Figure Lengend Snippet: Preparation and validation of the mouse Refs/CLPs standard DNA with pGEM-T Easy. (A) Schematic representation of the mouse Refs/CLPs standard DNA cloning into pGEM-T Easy vector. (B) The mouse Refs/CLPs standard DNA with pGEM-T Easy was PCR-amplified from the plasmid DNA using the BRP-39 forward (blue arrow) and Ym1 reverse (red arrow) primers. As described above, we amplified the Ym1 and Ym2 cDNAs from this standard DNA using the Ym1 (C) and Ym2 (D) primers and these PCR products were analyzed using 10% polyacrylamide gel electrophoresis (E) . The y axis was expressed as first derivative of the fluorescence as a function of temperature (C and D) .

    Article Snippet: The PCR product was purified, and 3’-dA was added to the amplified DNA using Takara Taq HS (Takara Bio) and the resulting fragment was cloned into the pGEM-T Easy vector (Promega).

    Techniques: Clone Assay, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Polyacrylamide Gel Electrophoresis, Fluorescence

    BRP-39, Ym1 and Ym2 mRNA expression in mouse tissues. Quantification of BRP-39 (A) , Ym1 (B) and Ym2 (C) mRNAs in mouse tissues. The expression levels of the CLPs were quantified by real-time PCR using the standard DNA containing the eight mouse genes (the mouse Refs/CLPs standard DNA with pGEM-T Easy). The y axis was expressed as molecules per 10 ng of total RNA. The upper panel indicates the actual value, and the lower panel shows each value on logarithmic scale. Data are presented as mean ± SD of three measurements.

    Journal: BMC Molecular Biology

    Article Title: Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung

    doi: 10.1186/1471-2199-15-23

    Figure Lengend Snippet: BRP-39, Ym1 and Ym2 mRNA expression in mouse tissues. Quantification of BRP-39 (A) , Ym1 (B) and Ym2 (C) mRNAs in mouse tissues. The expression levels of the CLPs were quantified by real-time PCR using the standard DNA containing the eight mouse genes (the mouse Refs/CLPs standard DNA with pGEM-T Easy). The y axis was expressed as molecules per 10 ng of total RNA. The upper panel indicates the actual value, and the lower panel shows each value on logarithmic scale. Data are presented as mean ± SD of three measurements.

    Article Snippet: The PCR product was purified, and 3’-dA was added to the amplified DNA using Takara Taq HS (Takara Bio) and the resulting fragment was cloned into the pGEM-T Easy vector (Promega).

    Techniques: Expressing, Real-time Polymerase Chain Reaction

    Construction and validation of the mouse Refs/CLPs standard DNA. (A) Schematic representation of the mouse Refs/CLPs standard DNA used for qPCR analysis. We ligated the standard DNAs of the CLPs and the reference genes (Refs) DNA [ 40 , 41 ] using EcoRI restriction sites and the resulting fragment was then cloned into the pGEM-T Easy vector. The linearized standard DNA was amplified from the plasmid DNA. To examine whether the standard DNA gave one melting temperature, we amplified the mouse Refs/CLPs standard DNA using the Ym1 (B) and Ym2 (C) primers. (D) The Ym1 and Ym2 PCR products were evaluated using 10% polyacrylamide gel analysis. (E) Multiple products were amplified from the mouse Refs/CLPs standard DNA using the Ym2 primers. Pink arrows indicate Ym2 primers. Lines indicate the putative amplified DNA products.

    Journal: BMC Molecular Biology

    Article Title: Establishment of a quantitative PCR system for discriminating chitinase-like proteins: catalytically inactive breast regression protein-39 and Ym1 are constitutive genes in mouse lung

    doi: 10.1186/1471-2199-15-23

    Figure Lengend Snippet: Construction and validation of the mouse Refs/CLPs standard DNA. (A) Schematic representation of the mouse Refs/CLPs standard DNA used for qPCR analysis. We ligated the standard DNAs of the CLPs and the reference genes (Refs) DNA [ 40 , 41 ] using EcoRI restriction sites and the resulting fragment was then cloned into the pGEM-T Easy vector. The linearized standard DNA was amplified from the plasmid DNA. To examine whether the standard DNA gave one melting temperature, we amplified the mouse Refs/CLPs standard DNA using the Ym1 (B) and Ym2 (C) primers. (D) The Ym1 and Ym2 PCR products were evaluated using 10% polyacrylamide gel analysis. (E) Multiple products were amplified from the mouse Refs/CLPs standard DNA using the Ym2 primers. Pink arrows indicate Ym2 primers. Lines indicate the putative amplified DNA products.

    Article Snippet: The PCR product was purified, and 3’-dA was added to the amplified DNA using Takara Taq HS (Takara Bio) and the resulting fragment was cloned into the pGEM-T Easy vector (Promega).

    Techniques: Real-time Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, Amplification, Polymerase Chain Reaction