Structured Review

Promega vector pgem t
Expression of recombinant MAA2 in E. coli . (A) E. coli cells containing the maa2 gene ligated into vector <t>pGEM-T</t> in both orientations with respect to the lacZ promoter were grown in the presence and absence of IPTG, lysed, electrophoresed by SDS-PAGE on 7.5% (wt/vol) gels, transferred to nitrocellulose, and stained with MAA2-specific MAb 7a. Lanes contain M. arthritidis 158p10p9 whole-cell lysate (lane 1), E. coli containing the cloned insert in the forward orientation with respect to the lacZ promoter, in the absence (lane 2) and presence (lane 3) of IPTG, E. coli containing the cloned insert in the reverse orientation with respect to the lacZ promoter, in the absence (lane 4) and presence (lane 5) of IPTG, and untransformed E. coli in the absence (lane 6) and presence (lane 7) of IPTG. (B) E. coli cells containing the maa2 gene from M. arthritidis 158p10p9 clonal variants in which expression of MAA2 was switched ON or OFF were grown in the presence or absence of IPTG, lysed, electrophoresed and immunoblotted as described above. Lanes contain E. coli in which maa2 from an OFF variant was ligated into vector pGEM-T in the reverse orientation with respect to the lacZ promoter, in the absence (lane 1) and presence (lane 2) of IPTG, E. coli in which maa2 from an OFF variant was ligated into vector pGEM-T in the forward orientation with respect to the lacZ promoter, in the absence (lane 3) and presence (lane 4) of IPTG, E. coli in which maa2 from an ON variant was ligated into vector pGEM-T in the forward orientation with respect to the lacZ promoter, in the absence (lane 5) and presence (lane 6) of IPTG, and a whole-cell lysate of M. arthritidis strain 158p10p9 (lane 7).
Vector Pgem T, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 43 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vector pgem t/product/Promega
Average 99 stars, based on 43 article reviews
Price from $9.99 to $1999.99
vector pgem t - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2"

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2

Journal: Infection and Immunity

doi:

Expression of recombinant MAA2 in E. coli . (A) E. coli cells containing the maa2 gene ligated into vector pGEM-T in both orientations with respect to the lacZ promoter were grown in the presence and absence of IPTG, lysed, electrophoresed by SDS-PAGE on 7.5% (wt/vol) gels, transferred to nitrocellulose, and stained with MAA2-specific MAb 7a. Lanes contain M. arthritidis 158p10p9 whole-cell lysate (lane 1), E. coli containing the cloned insert in the forward orientation with respect to the lacZ promoter, in the absence (lane 2) and presence (lane 3) of IPTG, E. coli containing the cloned insert in the reverse orientation with respect to the lacZ promoter, in the absence (lane 4) and presence (lane 5) of IPTG, and untransformed E. coli in the absence (lane 6) and presence (lane 7) of IPTG. (B) E. coli cells containing the maa2 gene from M. arthritidis 158p10p9 clonal variants in which expression of MAA2 was switched ON or OFF were grown in the presence or absence of IPTG, lysed, electrophoresed and immunoblotted as described above. Lanes contain E. coli in which maa2 from an OFF variant was ligated into vector pGEM-T in the reverse orientation with respect to the lacZ promoter, in the absence (lane 1) and presence (lane 2) of IPTG, E. coli in which maa2 from an OFF variant was ligated into vector pGEM-T in the forward orientation with respect to the lacZ promoter, in the absence (lane 3) and presence (lane 4) of IPTG, E. coli in which maa2 from an ON variant was ligated into vector pGEM-T in the forward orientation with respect to the lacZ promoter, in the absence (lane 5) and presence (lane 6) of IPTG, and a whole-cell lysate of M. arthritidis strain 158p10p9 (lane 7).
Figure Legend Snippet: Expression of recombinant MAA2 in E. coli . (A) E. coli cells containing the maa2 gene ligated into vector pGEM-T in both orientations with respect to the lacZ promoter were grown in the presence and absence of IPTG, lysed, electrophoresed by SDS-PAGE on 7.5% (wt/vol) gels, transferred to nitrocellulose, and stained with MAA2-specific MAb 7a. Lanes contain M. arthritidis 158p10p9 whole-cell lysate (lane 1), E. coli containing the cloned insert in the forward orientation with respect to the lacZ promoter, in the absence (lane 2) and presence (lane 3) of IPTG, E. coli containing the cloned insert in the reverse orientation with respect to the lacZ promoter, in the absence (lane 4) and presence (lane 5) of IPTG, and untransformed E. coli in the absence (lane 6) and presence (lane 7) of IPTG. (B) E. coli cells containing the maa2 gene from M. arthritidis 158p10p9 clonal variants in which expression of MAA2 was switched ON or OFF were grown in the presence or absence of IPTG, lysed, electrophoresed and immunoblotted as described above. Lanes contain E. coli in which maa2 from an OFF variant was ligated into vector pGEM-T in the reverse orientation with respect to the lacZ promoter, in the absence (lane 1) and presence (lane 2) of IPTG, E. coli in which maa2 from an OFF variant was ligated into vector pGEM-T in the forward orientation with respect to the lacZ promoter, in the absence (lane 3) and presence (lane 4) of IPTG, E. coli in which maa2 from an ON variant was ligated into vector pGEM-T in the forward orientation with respect to the lacZ promoter, in the absence (lane 5) and presence (lane 6) of IPTG, and a whole-cell lysate of M. arthritidis strain 158p10p9 (lane 7).

Techniques Used: Expressing, Recombinant, Plasmid Preparation, SDS Page, Staining, Clone Assay, Variant Assay

Related Articles

Clone Assay:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: .. To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega). .. Recombinant MAA2 was expressed from the lacZ promoter of vector pGEM-T. Transcriptional fusions were prepared by cloning the PCR-amplified full-length coding region of maa2 into this vector as described above; the recombinant plasmids were inserted into E. coli XL1-Blue MRF′ by electroporation.

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega). .. PCR amplification of the cassette via Q5 polymerase for sticky-end cloning into vector pRS306 (Addgene) after restriction performed with the XhoI and XbaI enzymes led to formation of plasmid pBBA5.1, which was transformed into S. cerevisiae strain BY4741 ( ) via electroporation.

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: Paragraph title: Isolation of J8 and Toc12 cDNA and Genomic Clones ... PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega).

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: .. The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916. ..

Amplification:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: Rpi-vnt1 allele mining in S. okadae accessions Rpi-vnt1-like genes have been amplified from the S. okadae accessions 7129, 7625, and 7629 through PCRs with the Rpi-vnt1 specific primers Rpi-vnt1_F_full: 5′ATGAATTATTGTGTTTACAAGACTTGG3′ and Rpi-vnt1_R_full: 5′TTATAGTACCTGTGATATTCTCAACTTTGC3′. .. To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega).

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega). .. Recombinant MAA2 was expressed from the lacZ promoter of vector pGEM-T. Transcriptional fusions were prepared by cloning the PCR-amplified full-length coding region of maa2 into this vector as described above; the recombinant plasmids were inserted into E. coli XL1-Blue MRF′ by electroporation.

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: The fungal ITS fragments were amplified using a nested PCR approach with primer pairs ITS1F / ITS4 and ITS1FGC / ITS2. .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega). .. After restriction performed with EcoRI and NotI, the corresponding fragment containing Δ3(E )-desaturase was ligated into pGAPZ/C (Invitrogen), leading to production of the plasmid, which, after linearization with BglII, was transformed into P. pastoris strain GS115, resulting in strain SZ51.

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: .. The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916. ..

DNA Synthesis:

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega). .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega).

Synthesized:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: Semiquantitative PCR was performed as previously described. siRNA were either chemically synthesized for Fzd 2 , Fz 4 , and Fzd 7 genes, (Ambion) or made for Fz 5 and Fz 6 genes by in vitro transcription using RNA silencer kit (Ambion). .. The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced.

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: First-strand cDNAs were synthesized using the Moloney murine leukemia virus reverse transcriptase (Invitrogen) with RNA isolated from pea ( Pisum sativum ‘Little Marvel’) or Arabidopsis ( Arabidopsis thaliana ) leaves. .. PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega).

Construct:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: Paragraph title: Construction of chpE complementation constructs. ... The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916.

Transformation Assay:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: The resulting plasmid, pNP1.13, was linearized with SacI and transformed into P. pastoris strain GS115 (Invitrogen) via electroporation, giving strain BBA21.3. .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Electroporation:

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: The resulting plasmid, pNP1.13, was linearized with SacI and transformed into P. pastoris strain GS115 (Invitrogen) via electroporation, giving strain BBA21.3. .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Ligation:

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: This PCR product also served as a template for a PCR to amplify an open reading frame fragment for sticky-end ligation into plasmid pPIC3.5 ( ) restricted with EcoRI and NotI. .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Generated:

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: In order to clone the cDNA of the predicted Δ3(E )-desaturase from A. niger (An01g09800), total RNA from a culture of A. niger strain N402 was extracted from its biomass following the TRIzol method ( ) and treated with DNase using an Ambion DNA-free kit (Invitrogen). cDNA was generated from total RNA using a Thermo Fisher RevertAid H Minus first-strand cDNA synthesis kit with an oligo(dT)18 primer, according to the manufacturer’s instructions. .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Polymerase Chain Reaction:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: .. The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced. ..

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: .. To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega). .. Recombinant MAA2 was expressed from the lacZ promoter of vector pGEM-T. Transcriptional fusions were prepared by cloning the PCR-amplified full-length coding region of maa2 into this vector as described above; the recombinant plasmids were inserted into E. coli XL1-Blue MRF′ by electroporation.

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: This PCR product also served as a template for a PCR to amplify an open reading frame fragment for sticky-end ligation into plasmid pPIC3.5 ( ) restricted with EcoRI and NotI. .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: .. PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega). .. Site-directed mutagenesis to create Toc12 and Toc12MM was performed on plasmids containing the coding sequence for PsJ8b using the QuikChange site-directed mutagenesis kit (Stratagene) and primers listed in .

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: .. The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916. ..

DNA Sequencing:

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: Paragraph title: DNA sequencing. ... For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: Paragraph title: Analysis of Frizzled RNA by Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and RNA Interference Assay ... The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced.

Denaturing Gradient Gel Electrophoresis:

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Molecular Cloning:

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: Paragraph title: Molecular cloning. ... Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Mutagenesis:

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega). .. Site-directed mutagenesis to create Toc12 and Toc12MM was performed on plasmids containing the coding sequence for PsJ8b using the QuikChange site-directed mutagenesis kit (Stratagene) and primers listed in .

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916. .. The chpE knockout cosmid was then introduced into the plasmid-containing strain, and the resulting colonies were screened for the creation of a chpE null mutant in the presence (10 μg/ml) or absence of the inducer, vancomycin.

Isolation:

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: Paragraph title: Isolation of J8 and Toc12 cDNA and Genomic Clones ... PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega).

Purification:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: .. The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced. ..

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

Sequencing:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: .. To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega). .. Recombinant MAA2 was expressed from the lacZ promoter of vector pGEM-T. Transcriptional fusions were prepared by cloning the PCR-amplified full-length coding region of maa2 into this vector as described above; the recombinant plasmids were inserted into E. coli XL1-Blue MRF′ by electroporation.

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: Sequence alignments of the PCR product confirmed the predicted intron-exon boundaries of An01g09800. .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega).

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega). .. Site-directed mutagenesis to create Toc12 and Toc12MM was performed on plasmids containing the coding sequence for PsJ8b using the QuikChange site-directed mutagenesis kit (Stratagene) and primers listed in .

Nested PCR:

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: The fungal ITS fragments were amplified using a nested PCR approach with primer pairs ITS1F / ITS4 and ITS1FGC / ITS2. .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

Plasmid Preparation:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: .. The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced. ..

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: .. To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega). .. Recombinant MAA2 was expressed from the lacZ promoter of vector pGEM-T. Transcriptional fusions were prepared by cloning the PCR-amplified full-length coding region of maa2 into this vector as described above; the recombinant plasmids were inserted into E. coli XL1-Blue MRF′ by electroporation.

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

Article Title: Species-Specific Differences in the Susceptibility of Fungi to the Antifungal Protein AFP Depend on C-3 Saturation of Glycosylceramides
Article Snippet: .. Total cDNA from F. graminearum strain 8/1 ( ) was used as a template for the amplification of the Δ3(E )-desaturase FJ176923 gene with Pwo polymerase (Peqlab) and was ligated into vector pGEM-T (Promega). .. After restriction performed with EcoRI and NotI, the corresponding fragment containing Δ3(E )-desaturase was ligated into pGAPZ/C (Invitrogen), leading to production of the plasmid, which, after linearization with BglII, was transformed into P. pastoris strain GS115, resulting in strain SZ51.

Article Title: Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C] [W]Pea Chloroplast DnaJ-J8 and Toc12 Are Encoded by the Same Gene and Localized in the Stroma 1 [C]
Article Snippet: .. PCR-amplified fragments were subcloned into vector pGEM-T or pSP72 (Promega). .. Site-directed mutagenesis to create Toc12 and Toc12MM was performed on plasmids containing the coding sequence for PsJ8b using the QuikChange site-directed mutagenesis kit (Stratagene) and primers listed in .

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: .. The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916. ..

Software:

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: DNA and deduced amino acid sequence data were analyzed by using the MacDNASIS Pro version 3.6 software package (Hitachi Software Engineering Co., Ltd., South San Francisco, Calif.). .. For sequencing through the repeat regions of maa2 , sequences amplified by PCR from forward and reverse primers NT and HMPR were cloned into vector pGEM-T as described above, and a series of nested deletions was prepared by using the Erase-A-Base system (Promega).

Functional Assay:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Sequencing products were subjected to a BLASTn analysis and compared to functional Rpi-vnt1 variants (Pel et al., ) using Geneious v5.6.3 (Biomatters).

Recombinant:

Article Title: Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections
Article Snippet: To assess the diversity of the Rpi-vnt1-like sequences PCR products were cloned into the vector pGEM-T easy for Sanger sequencing, according to the manufacturer's recommendations (pGEM®-T Easy Vector System—Promega). .. Recombinant clones were selected following transformation of the constructs into electro competent Escherichia coli DH10B and DH5α cells (Invitrogen) using colony PCR with the gene specific primers mentioned above.

In Vitro:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: The Fzd 5 siRNAs were produced by in vitro transcription using the Silencer siRNA cocktail kit. .. The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced.

Knock-Out:

Article Title: Function and Redundancy of the Chaplin Cell Surface Proteins in Aerial Hypha Formation, Rodlet Assembly, and Viability in Streptomyces coelicolor ▿
Article Snippet: The vancomycin-inducible promoter of vanJ ( vanJp ) was excised from pIJ6882 ( ) with HindIII and SalI and was cloned into pIJ2925 digested with the same enzymes. chpE was PCR amplified using primers chpE up and chpE end (Table ) and was cloned into the vector pGEM-T (Promega). chpE was removed using BglII and SacI and was cloned into pIJ2925+p vanJ digested with BamHI and SacI, creating pIJ6916. .. The chpE knockout cosmid was then introduced into the plasmid-containing strain, and the resulting colonies were screened for the creation of a chpE null mutant in the presence (10 μg/ml) or absence of the inducer, vancomycin.

Produced:

Article Title: Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway
Article Snippet: The Fzd 5 siRNAs were produced by in vitro transcription using the Silencer siRNA cocktail kit. .. The PCR fragments for Fzd5 (using the following primers for Fzd5: sense 5′-AAGGAAGAGAAGGCGAGTGACC-3′ and antisense 5′-TAGGGCTGGAGGGATGATTAGG-3′; for Fzd6, sense 5′-TATCTCTGCGGTCTTCTGGGTTGG-3′ and antisense 5′-TCCATTGCTTCTCTCCTTCAGGC-3′) were purified (QIAquick PCR purification kit; Qiagen), subcloned into the vector pGEM-T (Promega) and sequenced.

Concentration Assay:

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

High Throughput Screening Assay:

Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Promega pgem t easy vector
    Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 6980 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector/product/Promega
    Average 90 stars, based on 6980 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results