vector pgem t easy  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    Thermo Fisher vector pgem t easy
    Vector Pgem T Easy, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vector pgem t easy/product/Thermo Fisher
    Average 92 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    vector pgem t easy - by Bioz Stars, 2020-08
    92/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Characterization of the Dictyostelium Homolog of Chromatin Binding Protein DET1 Suggests a Conserved Pathway Regulating Cell Type Specification and Developmental Plasticity ▿ Homolog of Chromatin Binding Protein DET1 Suggests a Conserved Pathway Regulating Cell Type Specification and Developmental Plasticity ▿ †
    Article Snippet: .. The N-terminal domain of Dictyostelium detA described above (amplified with the primers MJD29 and MJD32) was cloned into vector pGEM-T Easy (Fermentas). pGEM-T-DetAn was double digested with PstI/SmaI, blunted with T4 polymerase, and then religated with T4 ligase in order to remove the NheI site within the vector backbone. .. The resulting vector, pGEM-T-DetAn (-NheI), was then digested with NheI (which is present within the detA gene), blunted with T4 polymerase, and treated with alkaline phosphatase.

    Article Title: A 'universal' type II chaperonin PCR detection system for the investigation of Archaea in complex microbial communities
    Article Snippet: .. For comparison of the archaeal communities in dairy cow rumen, PCR products from each target gene (thermosome, 16S rRNA, mcrA ) and each diet (regular and dry) were cloned into the vector pGEM-T Easy (Invitrogen) as previously described ( ). ..

    Article Title: Molecular Identification of Mumps Virus Genotypes from Clinical Samples: Standardized Method of Analysis
    Article Snippet: .. Following amplification by PCR using primers complementary to the artificial 25-nucleotide flanking sequences, the product was cloned into vector pGEM-T Easy (Invitrogen, Carlsbad, CA). ..

    Article Title: Genetic Vasectomy--Overexpression of Prm1-EGFP Fusion Protein in Elongating Spermatids Causes Dominant Male Sterility in Mice
    Article Snippet: .. The fragment was cloned in vector pGEM-T-easy (Invitrogen). .. The complete EGFP open reading frame was inserted just upstream of the Prm1 STOP codon using inverted PCR and the following primers (Prm1CDS-rev -5′GTATTTTTTACACCTTATGGTGTATG3′, Prm1UTR-fwd - 5′TAGATGCACAGAATAGCAAGTCC3′ to yield plasmid pGEM-Prm1-EGFP.

    Article Title: Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿ †
    Article Snippet: .. The PCR product amplified with primers 1098delfwd/1098delrev was cloned directly into vector pGEM-T easy (Invitrogen), which resulted in plasmid pGEM397. .. A 745-bp DNA fragment of pGEM397 was deleted by cleavage with the restriction enzyme MscI and replaced with the erythromycin resistance gene cassette ( ermB ) amplified by PCR.

    Amplification:

    Article Title: Characterization of the Dictyostelium Homolog of Chromatin Binding Protein DET1 Suggests a Conserved Pathway Regulating Cell Type Specification and Developmental Plasticity ▿ Homolog of Chromatin Binding Protein DET1 Suggests a Conserved Pathway Regulating Cell Type Specification and Developmental Plasticity ▿ †
    Article Snippet: .. The N-terminal domain of Dictyostelium detA described above (amplified with the primers MJD29 and MJD32) was cloned into vector pGEM-T Easy (Fermentas). pGEM-T-DetAn was double digested with PstI/SmaI, blunted with T4 polymerase, and then religated with T4 ligase in order to remove the NheI site within the vector backbone. .. The resulting vector, pGEM-T-DetAn (-NheI), was then digested with NheI (which is present within the detA gene), blunted with T4 polymerase, and treated with alkaline phosphatase.

    Article Title: Molecular Identification of Mumps Virus Genotypes from Clinical Samples: Standardized Method of Analysis
    Article Snippet: .. Following amplification by PCR using primers complementary to the artificial 25-nucleotide flanking sequences, the product was cloned into vector pGEM-T Easy (Invitrogen, Carlsbad, CA). ..

    Article Title: Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿ †
    Article Snippet: .. The PCR product amplified with primers 1098delfwd/1098delrev was cloned directly into vector pGEM-T easy (Invitrogen), which resulted in plasmid pGEM397. .. A 745-bp DNA fragment of pGEM397 was deleted by cleavage with the restriction enzyme MscI and replaced with the erythromycin resistance gene cassette ( ermB ) amplified by PCR.

    Agarose Gel Electrophoresis:

    Article Title: Characterization of Intestinal Microbiota and Response to Dietary Virginiamycin Supplementation in the Broiler Chicken †
    Article Snippet: .. Equal volumes of PCR products produced at each annealing temperature were mixed, agarose gel purified, and ligated into vector pGEM-T Easy (Invitrogen). .. Ligation mixtures were used to transform Escherichia coli JM109 (Invitrogen).

    Purification:

    Article Title: Characterization of Intestinal Microbiota and Response to Dietary Virginiamycin Supplementation in the Broiler Chicken †
    Article Snippet: .. Equal volumes of PCR products produced at each annealing temperature were mixed, agarose gel purified, and ligated into vector pGEM-T Easy (Invitrogen). .. Ligation mixtures were used to transform Escherichia coli JM109 (Invitrogen).

    Produced:

    Article Title: Characterization of Intestinal Microbiota and Response to Dietary Virginiamycin Supplementation in the Broiler Chicken †
    Article Snippet: .. Equal volumes of PCR products produced at each annealing temperature were mixed, agarose gel purified, and ligated into vector pGEM-T Easy (Invitrogen). .. Ligation mixtures were used to transform Escherichia coli JM109 (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: A 'universal' type II chaperonin PCR detection system for the investigation of Archaea in complex microbial communities
    Article Snippet: .. For comparison of the archaeal communities in dairy cow rumen, PCR products from each target gene (thermosome, 16S rRNA, mcrA ) and each diet (regular and dry) were cloned into the vector pGEM-T Easy (Invitrogen) as previously described ( ). ..

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: .. The PCR product was subcloned into the vector pGEM-T Easy (Invitrogen) and sequenced. .. T7 polymerase (Promega) was used to generate a digoxigenin-labeled antisense probe by in vitro transcription following manufacturer's protocol.

    Article Title: Molecular Identification of Mumps Virus Genotypes from Clinical Samples: Standardized Method of Analysis
    Article Snippet: .. Following amplification by PCR using primers complementary to the artificial 25-nucleotide flanking sequences, the product was cloned into vector pGEM-T Easy (Invitrogen, Carlsbad, CA). ..

    Article Title: Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿ †
    Article Snippet: .. The PCR product amplified with primers 1098delfwd/1098delrev was cloned directly into vector pGEM-T easy (Invitrogen), which resulted in plasmid pGEM397. .. A 745-bp DNA fragment of pGEM397 was deleted by cleavage with the restriction enzyme MscI and replaced with the erythromycin resistance gene cassette ( ermB ) amplified by PCR.

    Article Title: Characterization of Intestinal Microbiota and Response to Dietary Virginiamycin Supplementation in the Broiler Chicken †
    Article Snippet: .. Equal volumes of PCR products produced at each annealing temperature were mixed, agarose gel purified, and ligated into vector pGEM-T Easy (Invitrogen). .. Ligation mixtures were used to transform Escherichia coli JM109 (Invitrogen).

    Plasmid Preparation:

    Article Title: Characterization of the Dictyostelium Homolog of Chromatin Binding Protein DET1 Suggests a Conserved Pathway Regulating Cell Type Specification and Developmental Plasticity ▿ Homolog of Chromatin Binding Protein DET1 Suggests a Conserved Pathway Regulating Cell Type Specification and Developmental Plasticity ▿ †
    Article Snippet: .. The N-terminal domain of Dictyostelium detA described above (amplified with the primers MJD29 and MJD32) was cloned into vector pGEM-T Easy (Fermentas). pGEM-T-DetAn was double digested with PstI/SmaI, blunted with T4 polymerase, and then religated with T4 ligase in order to remove the NheI site within the vector backbone. .. The resulting vector, pGEM-T-DetAn (-NheI), was then digested with NheI (which is present within the detA gene), blunted with T4 polymerase, and treated with alkaline phosphatase.

    Article Title: A 'universal' type II chaperonin PCR detection system for the investigation of Archaea in complex microbial communities
    Article Snippet: .. For comparison of the archaeal communities in dairy cow rumen, PCR products from each target gene (thermosome, 16S rRNA, mcrA ) and each diet (regular and dry) were cloned into the vector pGEM-T Easy (Invitrogen) as previously described ( ). ..

    Article Title: Brassinosteroid control of sex determination in maize
    Article Snippet: .. The PCR product was subcloned into the vector pGEM-T Easy (Invitrogen) and sequenced. .. T7 polymerase (Promega) was used to generate a digoxigenin-labeled antisense probe by in vitro transcription following manufacturer's protocol.

    Article Title: Molecular Identification of Mumps Virus Genotypes from Clinical Samples: Standardized Method of Analysis
    Article Snippet: .. Following amplification by PCR using primers complementary to the artificial 25-nucleotide flanking sequences, the product was cloned into vector pGEM-T Easy (Invitrogen, Carlsbad, CA). ..

    Article Title: Genetic Vasectomy--Overexpression of Prm1-EGFP Fusion Protein in Elongating Spermatids Causes Dominant Male Sterility in Mice
    Article Snippet: .. The fragment was cloned in vector pGEM-T-easy (Invitrogen). .. The complete EGFP open reading frame was inserted just upstream of the Prm1 STOP codon using inverted PCR and the following primers (Prm1CDS-rev -5′GTATTTTTTACACCTTATGGTGTATG3′, Prm1UTR-fwd - 5′TAGATGCACAGAATAGCAAGTCC3′ to yield plasmid pGEM-Prm1-EGFP.

    Article Title: Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿Impact of Glutamine Transporters on Pneumococcal Fitness under Infection-Related Conditions ▿ †
    Article Snippet: .. The PCR product amplified with primers 1098delfwd/1098delrev was cloned directly into vector pGEM-T easy (Invitrogen), which resulted in plasmid pGEM397. .. A 745-bp DNA fragment of pGEM397 was deleted by cleavage with the restriction enzyme MscI and replaced with the erythromycin resistance gene cassette ( ermB ) amplified by PCR.

    Article Title: Characterization of Intestinal Microbiota and Response to Dietary Virginiamycin Supplementation in the Broiler Chicken †
    Article Snippet: .. Equal volumes of PCR products produced at each annealing temperature were mixed, agarose gel purified, and ligated into vector pGEM-T Easy (Invitrogen). .. Ligation mixtures were used to transform Escherichia coli JM109 (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher pgem t easy vector
    General strategy of construction of DNA clones of a <t>GVA</t> and b GVB genetic variants P163-M5 and 953-1, respectively. Numbers I–VI describe RT-PCR amplified CaMV 35S promoter and virus genome fragments using primers which nucleotide sequences are shown it Table 1 . The fragments III-VI were cloned into the TA site of <t>pGEM-T</t> Easy vector (Promega) ( single dashed line ) and then assembled in this vector using carefully selected restriction enzymes to digest the vector and virus sequences. The open arrows show the sequence of the assembling of virus fragments in the vector. Closed arrows show the stages of ligation of virus fragments to obtain full-length DNA clones of viruses under CaMV 35S promoter
    Pgem T Easy Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 133 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgem t easy vector/product/Thermo Fisher
    Average 94 stars, based on 133 article reviews
    Price from $9.99 to $1999.99
    pgem t easy vector - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    88
    Thermo Fisher pcmv6 neo expression vector pgem t easy cd19 gene construct
    General strategy of construction of DNA clones of a <t>GVA</t> and b GVB genetic variants P163-M5 and 953-1, respectively. Numbers I–VI describe RT-PCR amplified CaMV 35S promoter and virus genome fragments using primers which nucleotide sequences are shown it Table 1 . The fragments III-VI were cloned into the TA site of <t>pGEM-T</t> Easy vector (Promega) ( single dashed line ) and then assembled in this vector using carefully selected restriction enzymes to digest the vector and virus sequences. The open arrows show the sequence of the assembling of virus fragments in the vector. Closed arrows show the stages of ligation of virus fragments to obtain full-length DNA clones of viruses under CaMV 35S promoter
    Pcmv6 Neo Expression Vector Pgem T Easy Cd19 Gene Construct, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv6 neo expression vector pgem t easy cd19 gene construct/product/Thermo Fisher
    Average 88 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    pcmv6 neo expression vector pgem t easy cd19 gene construct - by Bioz Stars, 2020-08
    88/100 stars
      Buy from Supplier

    Image Search Results


    General strategy of construction of DNA clones of a GVA and b GVB genetic variants P163-M5 and 953-1, respectively. Numbers I–VI describe RT-PCR amplified CaMV 35S promoter and virus genome fragments using primers which nucleotide sequences are shown it Table 1 . The fragments III-VI were cloned into the TA site of pGEM-T Easy vector (Promega) ( single dashed line ) and then assembled in this vector using carefully selected restriction enzymes to digest the vector and virus sequences. The open arrows show the sequence of the assembling of virus fragments in the vector. Closed arrows show the stages of ligation of virus fragments to obtain full-length DNA clones of viruses under CaMV 35S promoter

    Journal: SpringerPlus

    Article Title: Brief report of the construction of infectious DNA clones of South African genetic variants of grapevine virus A and grapevine virus B

    doi: 10.1186/s40064-015-1517-2

    Figure Lengend Snippet: General strategy of construction of DNA clones of a GVA and b GVB genetic variants P163-M5 and 953-1, respectively. Numbers I–VI describe RT-PCR amplified CaMV 35S promoter and virus genome fragments using primers which nucleotide sequences are shown it Table 1 . The fragments III-VI were cloned into the TA site of pGEM-T Easy vector (Promega) ( single dashed line ) and then assembled in this vector using carefully selected restriction enzymes to digest the vector and virus sequences. The open arrows show the sequence of the assembling of virus fragments in the vector. Closed arrows show the stages of ligation of virus fragments to obtain full-length DNA clones of viruses under CaMV 35S promoter

    Article Snippet: The cloned virus genome fragments were digested with restriction enzymes, purified from agarose and re-assembled to the full GVA and GVB genome in pGEM-T Easy vector using T4 ligase (Thermo Scientific) as shown in Fig. .

    Techniques: Clone Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing, Ligation