vector pet15b  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Millipore vector pet15b
    Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of <t>pET15b.</t> (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.
    Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 88/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/vector pet15b/product/Millipore
    Average 88 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    vector pet15b - by Bioz Stars, 2020-04
    88/100 stars

    Images

    1) Product Images from "Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12"

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12

    Journal: Journal of Virology

    doi:

    Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.
    Figure Legend Snippet: Cloning of the Ad12 fiber knob and the extracellular domains of human CAR. (a) The Ad12 knob domain (line) begins at a conserved Thr-Leu-Trp-Thr motif (amino acids 409 to 412) and extends to the fiber protein carboxy terminus (Glu587). A fragment of Ad12 DNA encoding the entire knob domain and several amino acids from the preceding fiber shaft region (striped box) beginning at Ser401 was amplified by PCR using forward primer 1 and reverse primer 2. The resulting PCR product was cloned between the Nde I and Bam HI sites of pET15b. (b) The human CAR protein consists of an amino-terminal signal peptide (open box), two extracellular Ig-related domains (D1 and D2), a membrane-spanning region (TM), and a cytoplasmic domain (CYT). cDNA fragments encoding D1 and D1/D2 were amplified by PCR using forward primer 3 and reverse primers 4 and 5. The resulting PCR products were cloned between the Nco I and Xho I sites of pET20b. Similar D1- and D1/D2-encoding cDNA fragments were amplified by PCR using forward primer 6 and reverse primers 7 and 8. The resulting PCR products were cloned between the Nde I and Bam HI sites of pET15b. (c) pET vectors for protein expression in E. coli . The open and filled boxes represent bacterial signal peptides and hexahistidine tags, respectively. The restriction sites used in this study are shown, and the sequence of the pET15b-encoded 22-amino-acid carboxy-terminal extension of sD1 is given in single-letter code.

    Techniques Used: Clone Assay, Amplification, Polymerase Chain Reaction, Positron Emission Tomography, Expressing, Sequencing

    D1 solubility in the E. coli cytoplasm. BL21-DE3 cells transformed with pET11a-D1 (D1-11a) or pET15b-sD1 (sD1-15b) were induced with IPTG at 18°C. The protein content of whole-cell lysates (W) and that of the soluble fraction of cell sonicates (S) were analyzed by SDS-PAGE. The molecular weights (in thousands) of protein standards loaded in lane M r are indicated.
    Figure Legend Snippet: D1 solubility in the E. coli cytoplasm. BL21-DE3 cells transformed with pET11a-D1 (D1-11a) or pET15b-sD1 (sD1-15b) were induced with IPTG at 18°C. The protein content of whole-cell lysates (W) and that of the soluble fraction of cell sonicates (S) were analyzed by SDS-PAGE. The molecular weights (in thousands) of protein standards loaded in lane M r are indicated.

    Techniques Used: Solubility, Transformation Assay, SDS Page

    2) Product Images from "Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes"

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.07884-11

    Activity of CS74L in crude protein extracts. (A) SDS-PAGE analysis of crude extracts from E. coli expressing His-tagged endolysin CS74L or empty vector controls. Lane 1, SeeBlue marker (Invitrogen); lanes 2 to 4, E. coli cs74l -pET15b total protein; lanes
    Figure Legend Snippet: Activity of CS74L in crude protein extracts. (A) SDS-PAGE analysis of crude extracts from E. coli expressing His-tagged endolysin CS74L or empty vector controls. Lane 1, SeeBlue marker (Invitrogen); lanes 2 to 4, E. coli cs74l -pET15b total protein; lanes

    Techniques Used: Activity Assay, SDS Page, Expressing, Plasmid Preparation, Marker

    3) Product Images from "Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿"

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00989-10

    Turbidity reduction assays for endolysin activity. (A) Fresh (diamonds) or frozen (squares) cells of C. tyrobutyricum 9582 were incubated with 10 μg crude protein extracts from E. coli harboring ctp1l -pET15b (filled symbols) or pET15b controls (open symbols). (B) Frozen C. tyrobutyricum cells were incubated with 10 μg Ni-NTA-purified proteins Ctp1l (▪), Ct* (□), and Orf27 (○) with controls of lysozyme (1,500 U) (×) and buffer (−). (C) Ten micrograms of Ni-NTA-purified Ctp1l (filled symbols) or buffer (open symbols) was incubated with fresh cells of C. sporogenes (□) or C. difficile (⋄) or frozen cells of C. tyrobutyricum (▵). The values are the means of duplicate samples ± standard deviations.
    Figure Legend Snippet: Turbidity reduction assays for endolysin activity. (A) Fresh (diamonds) or frozen (squares) cells of C. tyrobutyricum 9582 were incubated with 10 μg crude protein extracts from E. coli harboring ctp1l -pET15b (filled symbols) or pET15b controls (open symbols). (B) Frozen C. tyrobutyricum cells were incubated with 10 μg Ni-NTA-purified proteins Ctp1l (▪), Ct* (□), and Orf27 (○) with controls of lysozyme (1,500 U) (×) and buffer (−). (C) Ten micrograms of Ni-NTA-purified Ctp1l (filled symbols) or buffer (open symbols) was incubated with fresh cells of C. sporogenes (□) or C. difficile (⋄) or frozen cells of C. tyrobutyricum (▵). The values are the means of duplicate samples ± standard deviations.

    Techniques Used: Activity Assay, Incubation, Purification

    SDS-PAGE analysis of Ni-NTA column-purified His-tagged φCTP1 endolysin Ctp1l and truncated Ct*. Lane 1, SeeBlue Plus2 marker (Invitrogen); lanes 2 to 8, E. coli ctp1l- pET15b total soluble protein extracts after 4 h of induction with IPTG (lane 2, crude lysate; lane 3, column flowthrough; lane 4, primary wash effluent; lane 5, secondary wash effluent; lane 6, primary eluate; lane 7, secondary eluate; lane 8, tertiary eluate); lane 9, blank; lanes 10 to 12, Ni-NTA eluates from E. coli ct*- pET15b total protein extracts after 4 h of induction with IPTG (lane 10, primary eluate; lane 11, secondary eluate; lane 12, tertiary eluate).
    Figure Legend Snippet: SDS-PAGE analysis of Ni-NTA column-purified His-tagged φCTP1 endolysin Ctp1l and truncated Ct*. Lane 1, SeeBlue Plus2 marker (Invitrogen); lanes 2 to 8, E. coli ctp1l- pET15b total soluble protein extracts after 4 h of induction with IPTG (lane 2, crude lysate; lane 3, column flowthrough; lane 4, primary wash effluent; lane 5, secondary wash effluent; lane 6, primary eluate; lane 7, secondary eluate; lane 8, tertiary eluate); lane 9, blank; lanes 10 to 12, Ni-NTA eluates from E. coli ct*- pET15b total protein extracts after 4 h of induction with IPTG (lane 10, primary eluate; lane 11, secondary eluate; lane 12, tertiary eluate).

    Techniques Used: SDS Page, Purification, Marker

    4) Product Images from "The Pseudomonas aeruginosa Flagellar Cap Protein, FliD, Is Responsible for Mucin Adhesion"

    Article Title: The Pseudomonas aeruginosa Flagellar Cap Protein, FliD, Is Responsible for Mucin Adhesion

    Journal: Infection and Immunity

    doi:

    Overexpression and purification of FliD. FliD was overexpressed in E. coli host BL21 with the expression vector pET15B (Novagen, Inc.). Lanes: 1, BL21(pET15B) vector control induced with 2 mM IPTG for 4 h at 37°C; 2, BL21(pET15BD) vector with FliD insert uninduced; 3, BL21(pET15BD) vector with FliD insert induced with 2 mM IPTG for 4 h at 37°C; 4, Pharmacia low-molecular-mass (kilodaltons) markers; 5, approximately 400 ng of purified His-FliD protein; 6, approximately 400 ng of purified His-FlaG protein.
    Figure Legend Snippet: Overexpression and purification of FliD. FliD was overexpressed in E. coli host BL21 with the expression vector pET15B (Novagen, Inc.). Lanes: 1, BL21(pET15B) vector control induced with 2 mM IPTG for 4 h at 37°C; 2, BL21(pET15BD) vector with FliD insert uninduced; 3, BL21(pET15BD) vector with FliD insert induced with 2 mM IPTG for 4 h at 37°C; 4, Pharmacia low-molecular-mass (kilodaltons) markers; 5, approximately 400 ng of purified His-FliD protein; 6, approximately 400 ng of purified His-FlaG protein.

    Techniques Used: Over Expression, Purification, Expressing, Plasmid Preparation

    5) Product Images from "Conservation of Helical Bundle Structure between the Exocyst Subunits"

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0004443

    Recombinant Sec10(145–827) is soluble. Several Sec10p truncation constructs designed using secondary structure predictions are not generally soluble. ( A ) Secondary structure prediction [41] and schematic of several representative N- and C-terminal truncations tested. The secondary structure prediction is schematically depicted as in Figure 1 . Truncations 1–589 and 590–871 were derived from dominant negative constructs described previously [27] . ( B ) E. coli cells were transformed with Sec10p truncation variants cloned with an N-terminal His 6 -tag in the vector pET15b (Novagen). Expression was induced by addition of IPTG to 0.1 mM, and growth was continued at 15°C for 14–18 h. Cells were pelleted, lysed and the insoluble (P) material was separated from the soluble material (S) by centrifugation; these were run on a 10% SDS-PAGE gel and stained with Coomassie blue dye. Asterisks indicate the migration of each construct. For each construct except Sec10(145–827), very little of the His 6 -tagged protein was in the soluble fraction. Although the Sec10(75–859) construct initially appeared promising, it was sticky and aggregated after partial purification on Ni-NTA resin. The right hand lane contains Sec10(145–827) after purification by Ni-NTA resin and gel filtration chromatography.
    Figure Legend Snippet: Recombinant Sec10(145–827) is soluble. Several Sec10p truncation constructs designed using secondary structure predictions are not generally soluble. ( A ) Secondary structure prediction [41] and schematic of several representative N- and C-terminal truncations tested. The secondary structure prediction is schematically depicted as in Figure 1 . Truncations 1–589 and 590–871 were derived from dominant negative constructs described previously [27] . ( B ) E. coli cells were transformed with Sec10p truncation variants cloned with an N-terminal His 6 -tag in the vector pET15b (Novagen). Expression was induced by addition of IPTG to 0.1 mM, and growth was continued at 15°C for 14–18 h. Cells were pelleted, lysed and the insoluble (P) material was separated from the soluble material (S) by centrifugation; these were run on a 10% SDS-PAGE gel and stained with Coomassie blue dye. Asterisks indicate the migration of each construct. For each construct except Sec10(145–827), very little of the His 6 -tagged protein was in the soluble fraction. Although the Sec10(75–859) construct initially appeared promising, it was sticky and aggregated after partial purification on Ni-NTA resin. The right hand lane contains Sec10(145–827) after purification by Ni-NTA resin and gel filtration chromatography.

    Techniques Used: Recombinant, Construct, Derivative Assay, Dominant Negative Mutation, Transformation Assay, Clone Assay, Plasmid Preparation, Expressing, Centrifugation, SDS Page, Staining, Migration, Purification, Filtration, Chromatography

    Related Articles

    Clone Assay:

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: .. Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen). .. Digestion of this with XmaI and KpnI restriction enzymes (New England BioLabs) led to the elimination of 39 base pairs.

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: .. The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. Overnight cultures in Luria-Bertani (LB) broth containing 150 mg of penicillin G (Sigma)/liter were diluted 100-fold into fresh LB-penicillin broth and grown at 37°C until mid-log phase (optical density of 0.8 at 600 nm), at which time they were chilled to 24°C and adjusted to 50 μM isopropyl β- d -thiogalactopyranoside (IPTG) to induce knob expression.

    Article Title: The Pseudomonas aeruginosa Flagellar Cap Protein, FliD, Is Responsible for Mucin Adhesion
    Article Snippet: .. RER39 [5′(CCCAAAAAAAAA CATATG GCGAACAGTACGACG)3′] was used as the 5′ primer to amplify the complete fliD gene, which was cloned into the vector pET15B (Novagen, Inc., Madison, Wis.); an Nde I site was added to this primer, which is shown here in boldface. .. pG10E was constructed by cloning a 10-kb Eco RI fragment which was excised from the cosmid pRR194 ( ) into the Eco RI site of pGEM3Z (Promega, Inc., Madison, Wis.).

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: The PCR products were cloned into Gateway pDONR/Zeo Vector (Invitrogen) by BP reaction and by LR reaction subcloned into plant Gateway binary vectors pGWB414 , pMDC85 (ABRC), pMDC43(ABRC), pDEST-VYNE(R) GW, and pDEST-SCYCE (R) GW ( ) or yeast two-hybrid expression vectors pDEST-GADT7 and pDEST-GBKT7 (Invitrogen). .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3).

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: Paragraph title: Cloning and expression of C. tentans proteins ... Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN).

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: .. Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. The following primers were used to create PCR fragments flanked by NdeI - BamHI sites, with restriction sites underlined: 5RdxA_NdeI (5′-GGGAATTC CATATG GAATTTTTGGATCAAG) and 3RdxA_BamHI (5′-CGC GGATCC TCACAACCAAGTAATCGCATC).

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. The C-terminal portion of CHC22 (residues 1521–1640) was cloned into the pET15b vector.

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ). .. The endolysin orf sequence was truncated via a stop codon introduced after the Asn 197 codon, via PCR cloning using primers T7P from the vector (5′-TAA TAC GAC TCA CTA TAG GG) and Ctp1l-EAD (5′-AAC TAC T T A ATT TTC CAC TTC AT; the altered nucleotide is in boldface), with ctp1l- pET15b as the template.

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: .. Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. ..

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: Paragraph title: Cloning and Protein Expression. ... Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia).

    Centrifugation:

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. After shaking (250 rpm) overnight at 24°C, the cells were collected by centrifugation, resuspended in 10% of the original culture volume of STE (10 mM Tris-HCl [pH 8.0], 100 mM NaCl, 1 mM EDTA) containing 100 μg of lysozyme/ml, and subjected to three cycles of freezing and thawing.

    Amplification:

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: A DNA fragment encoding the entire Ad12 fiber knob domain and several flanking amino acids from the fiber shaft (amino acids 401 to 587) was amplified from viral DNA by PCR (30 cycles at 94°C for 30 s, 55°C for 40 s, and 72°C for 60 s) using forward primer 1, CATATGAGCAACACTCCATACG, and reverse primer 2, GGATCCTTATTCTTGGGTAATGT (Fig. a). .. The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein.

    Article Title: The Pseudomonas aeruginosa Flagellar Cap Protein, FliD, Is Responsible for Mucin Adhesion
    Article Snippet: Paragraph title: PCR amplification. ... RER39 [5′(CCCAAAAAAAAA CATATG GCGAACAGTACGACG)3′] was used as the 5′ primer to amplify the complete fliD gene, which was cloned into the vector pET15B (Novagen, Inc., Madison, Wis.); an Nde I site was added to this primer, which is shown here in boldface.

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3). .. The GRIK1 was removed with Eco RI and Xho I from vector pGEX-5X-3 (pNSB1554; ) and inserted between the Eco RI and Xho I sites of pET28b (Novagen) for production of recombinant His-tag GRIK1. s of KIN10 mutants T175A and K48M ( ) were amplified by PCR and cloned into pGWB414 for tobacco transient expression assays.

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. The C-terminal portion of CHC22 (residues 1521–1640) was cloned into the pET15b vector.

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: The putative endolysin gene, ctp1l , was amplified from genomic DNA using primers Ctp1l-NDE (5′-GGA AAA TA C A T A TGA AGA AAA TAG C; altered nucleotides are in boldface; Sigma Genosys) and Ctp1l-XHO (5′-GAT TCT GCT CG A GTT GCT AAT), giving a product of 973 bp. orf27 was amplified with primers ORF27-NDE (5′-AGA GAT TTA CAT ATG GCA AAC AC) and ORF27-XHO (5′-TAG TTT C TC G A G ACT ATC ACC AC), giving a 2,113-bp product. .. The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ).

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: .. Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. ..

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: The Φ8074-B1 putative endolysin gene, cs74l , was amplified from genomic DNA using Phusion polymerase (Finnzymes) and primers CS74L-F (5′-GGA CTA C AT ATG AAG ATA GGT ATT G [bold letters represent altered nucleotides]; Sigma Genosys) and CS74L-R (5′-TAT TGG G A T CCC TAA ATC CTT), giving a product of 849 bp. .. The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ).

    Filtration:

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: .. Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia). .. Region 4.2 of σA (residues 349–399) was expressed in E. coli BL21(DE3) cells as a His-tagged fusion by using the vector pET28 (Novagen).

    Synthesized:

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN). .. The protein coding sequences of C. tentans eIF4AIII, Btz, NXF1, and UPF3 were obtained by PCR using cDNA synthesized from mRNA as template and cloned into the expression vector pET-46Ek/LIC (Novagen).

    Construct:

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: .. Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen). .. Digestion of this with XmaI and KpnI restriction enzymes (New England BioLabs) led to the elimination of 39 base pairs.

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: Paragraph title: Genetic Constructs ... WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3).

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: .. Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. The following primers were used to create PCR fragments flanked by NdeI - BamHI sites, with restriction sites underlined: 5RdxA_NdeI (5′-GGGAATTC CATATG GAATTTTTGGATCAAG) and 3RdxA_BamHI (5′-CGC GGATCC TCACAACCAAGTAATCGCATC).

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: Partial CHC22 cDNA construct (HS6) was a gift of Raju Kucherlapati, Albert Einstein College of Medicine, NY ( ). .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ).

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, constructs ctp1l- pET15b and orf27- pET15b were transformed into E. coli BL21(DE3) (Invitrogen).

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, construct cs74l -pET15b was transformed into E. coli BL21(DE3) (Invitrogen) for protein expression.

    Expressing:

    Article Title: A FAK scaffold inhibitor disrupts FAK and VEGFR-3 signaling and blocks melanoma growth by targeting both tumor and endothelial cells
    Article Snippet: His-tagged recombinant FAK C-terminal FAT domain protein (residues 892–1052) was expressed from the vector pET15b (Novagen) in E. coli BL21 (DE3) cells. .. Protein expression was induced by 0.2 mM IPTG at 37°C for 6 h. Cells were lysed in 1X PBS, 2% Triton-X and EDTA-free complete ULTRA solution (Roche Diagnostics) on ice followed by ultrasonication (Sonicator 3000 with a microprobe, Misonix) at 4°C.

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: .. The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. Overnight cultures in Luria-Bertani (LB) broth containing 150 mg of penicillin G (Sigma)/liter were diluted 100-fold into fresh LB-penicillin broth and grown at 37°C until mid-log phase (optical density of 0.8 at 600 nm), at which time they were chilled to 24°C and adjusted to 50 μM isopropyl β- d -thiogalactopyranoside (IPTG) to induce knob expression.

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: The PCR products were cloned into Gateway pDONR/Zeo Vector (Invitrogen) by BP reaction and by LR reaction subcloned into plant Gateway binary vectors pGWB414 , pMDC85 (ABRC), pMDC43(ABRC), pDEST-VYNE(R) GW, and pDEST-SCYCE (R) GW ( ) or yeast two-hybrid expression vectors pDEST-GADT7 and pDEST-GBKT7 (Invitrogen). .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3).

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: Paragraph title: Cloning and expression of C. tentans proteins ... Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN).

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: Paragraph title: Subcloning and expression of φCTP1 sequences. ... The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ).

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: .. Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. ..

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: Paragraph title: Subcloning and expression of Φ8074-B1 endolysin. ... The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ).

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: Paragraph title: Cloning and Protein Expression. ... Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia).

    Modification:

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen). .. The modified mtDNA ligase III sequence was confirmed by DNA sequencing.

    Transformation Assay:

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: .. The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. Overnight cultures in Luria-Bertani (LB) broth containing 150 mg of penicillin G (Sigma)/liter were diluted 100-fold into fresh LB-penicillin broth and grown at 37°C until mid-log phase (optical density of 0.8 at 600 nm), at which time they were chilled to 24°C and adjusted to 50 μM isopropyl β- d -thiogalactopyranoside (IPTG) to induce knob expression.

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: .. The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, constructs ctp1l- pET15b and orf27- pET15b were transformed into E. coli BL21(DE3) (Invitrogen).

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: .. The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, construct cs74l -pET15b was transformed into E. coli BL21(DE3) (Invitrogen) for protein expression.

    Over Expression:

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. This construct allowed overexpression of the RdxA protein with N-terminal His6 tag extensions to facilitate its purification.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: The putative endolysin gene, ctp1l , was amplified from genomic DNA using primers Ctp1l-NDE (5′-GGA AAA TA C A T A TGA AGA AAA TAG C; altered nucleotides are in boldface; Sigma Genosys) and Ctp1l-XHO (5′-GAT TCT GCT CG A GTT GCT AAT), giving a product of 973 bp. orf27 was amplified with primers ORF27-NDE (5′-AGA GAT TTA CAT ATG GCA AAC AC) and ORF27-XHO (5′-TAG TTT C TC G A G ACT ATC ACC AC), giving a 2,113-bp product. .. The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ).

    Countercurrent Chromatography:

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: The Φ8074-B1 putative endolysin gene, cs74l , was amplified from genomic DNA using Phusion polymerase (Finnzymes) and primers CS74L-F (5′-GGA CTA C AT ATG AAG ATA GGT ATT G [bold letters represent altered nucleotides]; Sigma Genosys) and CS74L-R (5′-TAT TGG G A T CCC TAA ATC CTT), giving a product of 849 bp. .. The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ).

    Sequencing:

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: .. Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen). .. Digestion of this with XmaI and KpnI restriction enzymes (New England BioLabs) led to the elimination of 39 base pairs.

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3). .. The GRIK1 was removed with Eco RI and Xho I from vector pGEX-5X-3 (pNSB1554; ) and inserted between the Eco RI and Xho I sites of pET28b (Novagen) for production of recombinant His-tag GRIK1. s of KIN10 mutants T175A and K48M ( ) were amplified by PCR and cloned into pGWB414 for tobacco transient expression assays.

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: The full-length cDNA sequence was isolated from a C. tentans lambda Zap cDNA library. .. Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN).

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, constructs ctp1l- pET15b and orf27- pET15b were transformed into E. coli BL21(DE3) (Invitrogen).

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, construct cs74l -pET15b was transformed into E. coli BL21(DE3) (Invitrogen) for protein expression.

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia). .. The sequence -MIEGRCG-, which contains a factor Xa cleavage site, was inserted between the poly(His) tag and region 4.2.

    Chromatography:

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: .. Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia). .. Region 4.2 of σA (residues 349–399) was expressed in E. coli BL21(DE3) cells as a His-tagged fusion by using the vector pET28 (Novagen).

    Solubility:

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. .. To maximize protein solubility, cells were grown in LB to an OD at 600 nm of ∼0.4 at 37°C.

    DNA Sequencing:

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen). .. The modified mtDNA ligase III sequence was confirmed by DNA sequencing.

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. All DNA inserts were verified by automated DNA sequencing at the Biomolecular Research Facility at the University of Virginia School of Medicine.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. To generate stable CHC22 transfectants in mammalian cells, full-length CHC22 cDNA was isolated by reverse transcriptase (RT)–PCR using human skeletal muscle Marathon-Ready cDNA (Clontech) as template.

    Sonication:

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. The viscous cell lysate was then sonicated and cleared by centrifugation at 25,000 × g for 10 min. Knob was precipitated from the supernatant by the addition of solid ammonium sulfate to 35% saturation (25°C), dialyzed against several changes of 10 mM Tris-HCl (pH 7.5), and passed over a column of DEAE-cellulose (DE52; Whatman) equilibrated in the same buffer.

    Recombinant:

    Article Title: A FAK scaffold inhibitor disrupts FAK and VEGFR-3 signaling and blocks melanoma growth by targeting both tumor and endothelial cells
    Article Snippet: .. His-tagged recombinant FAK C-terminal FAT domain protein (residues 892–1052) was expressed from the vector pET15b (Novagen) in E. coli BL21 (DE3) cells. ..

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3). .. The GRIK1 was removed with Eco RI and Xho I from vector pGEX-5X-3 (pNSB1554; ) and inserted between the Eco RI and Xho I sites of pET28b (Novagen) for production of recombinant His-tag GRIK1. s of KIN10 mutants T175A and K48M ( ) were amplified by PCR and cloned into pGWB414 for tobacco transient expression assays.

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: DNA isolation and all recombinant DNA manipulations were carried out using standard methods[ ]. .. Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.).

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. The C-terminal portion of CHC22 (residues 1521–1640) was cloned into the pET15b vector.

    DNA Extraction:

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: DNA isolation and all recombinant DNA manipulations were carried out using standard methods[ ]. .. Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.).

    Mutagenesis:

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: The wild-type DNA ligase III construct was named pREP4-lig and the constructs encoding the mutant proteins were called pREP4-lig(K-V) and pREP4-lig(R-H). .. Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen).

    Isolation:

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: The full-length cDNA sequence was isolated from a C. tentans lambda Zap cDNA library. .. Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN).

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: Paragraph title: cDNA isolation and plasmid construction ... Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ).

    Subcloning:

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: Paragraph title: Subcloning and expression of φCTP1 sequences. ... The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ).

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: Paragraph title: Subcloning and expression of Φ8074-B1 endolysin. ... The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ).

    Purification:

    Article Title: A FAK scaffold inhibitor disrupts FAK and VEGFR-3 signaling and blocks melanoma growth by targeting both tumor and endothelial cells
    Article Snippet: His-tagged recombinant FAK C-terminal FAT domain protein (residues 892–1052) was expressed from the vector pET15b (Novagen) in E. coli BL21 (DE3) cells. .. The protein was purified using HisPur Ni-NTA spin columns (Thermo Scientific) according to the manufacturer's protocol.

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: Paragraph title: Expression and purification of Ad12 knob. ... The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein.

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: .. Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN). .. The protein coding sequences of C. tentans eIF4AIII, Btz, NXF1, and UPF3 were obtained by PCR using cDNA synthesized from mRNA as template and cloned into the expression vector pET-46Ek/LIC (Novagen).

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. This construct allowed overexpression of the RdxA protein with N-terminal His6 tag extensions to facilitate its purification.

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: .. Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. ..

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: .. Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia). .. Region 4.2 of σA (residues 349–399) was expressed in E. coli BL21(DE3) cells as a His-tagged fusion by using the vector pET28 (Novagen).

    Protein Purification:

    Article Title: A FAK scaffold inhibitor disrupts FAK and VEGFR-3 signaling and blocks melanoma growth by targeting both tumor and endothelial cells
    Article Snippet: Paragraph title: Protein purification ... His-tagged recombinant FAK C-terminal FAT domain protein (residues 892–1052) was expressed from the vector pET15b (Novagen) in E. coli BL21 (DE3) cells.

    Polymerase Chain Reaction:

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: .. The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. Overnight cultures in Luria-Bertani (LB) broth containing 150 mg of penicillin G (Sigma)/liter were diluted 100-fold into fresh LB-penicillin broth and grown at 37°C until mid-log phase (optical density of 0.8 at 600 nm), at which time they were chilled to 24°C and adjusted to 50 μM isopropyl β- d -thiogalactopyranoside (IPTG) to induce knob expression.

    Article Title: The Pseudomonas aeruginosa Flagellar Cap Protein, FliD, Is Responsible for Mucin Adhesion
    Article Snippet: Paragraph title: PCR amplification. ... RER39 [5′(CCCAAAAAAAAA CATATG GCGAACAGTACGACG)3′] was used as the 5′ primer to amplify the complete fliD gene, which was cloned into the vector pET15B (Novagen, Inc., Madison, Wis.); an Nde I site was added to this primer, which is shown here in boldface.

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3). .. The GRIK1 was removed with Eco RI and Xho I from vector pGEX-5X-3 (pNSB1554; ) and inserted between the Eco RI and Xho I sites of pET28b (Novagen) for production of recombinant His-tag GRIK1. s of KIN10 mutants T175A and K48M ( ) were amplified by PCR and cloned into pGWB414 for tobacco transient expression assays.

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: The degenerate primers were used for PCR. .. Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN).

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: .. Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. The following primers were used to create PCR fragments flanked by NdeI - BamHI sites, with restriction sites underlined: 5RdxA_NdeI (5′-GGGAATTC CATATG GAATTTTTGGATCAAG) and 3RdxA_BamHI (5′-CGC GGATCC TCACAACCAAGTAATCGCATC).

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. The C-terminal portion of CHC22 (residues 1521–1640) was cloned into the pET15b vector.

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: .. The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, constructs ctp1l- pET15b and orf27- pET15b were transformed into E. coli BL21(DE3) (Invitrogen).

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: .. Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. ..

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: .. The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, construct cs74l -pET15b was transformed into E. coli BL21(DE3) (Invitrogen) for protein expression.

    Positron Emission Tomography:

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN). .. The protein coding sequences of C. tentans eIF4AIII, Btz, NXF1, and UPF3 were obtained by PCR using cDNA synthesized from mRNA as template and cloned into the expression vector pET-46Ek/LIC (Novagen).

    cDNA Library Assay:

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: The full-length cDNA sequence was isolated from a C. tentans lambda Zap cDNA library. .. Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN).

    Activated Clotting Time Assay:

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: The putative endolysin gene, ctp1l , was amplified from genomic DNA using primers Ctp1l-NDE (5′-GGA AAA TA C A T A TGA AGA AAA TAG C; altered nucleotides are in boldface; Sigma Genosys) and Ctp1l-XHO (5′-GAT TCT GCT CG A GTT GCT AAT), giving a product of 973 bp. orf27 was amplified with primers ORF27-NDE (5′-AGA GAT TTA CAT ATG GCA AAC AC) and ORF27-XHO (5′-TAG TTT C TC G A G ACT ATC ACC AC), giving a 2,113-bp product. .. The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ).

    Plasmid Preparation:

    Article Title: A FAK scaffold inhibitor disrupts FAK and VEGFR-3 signaling and blocks melanoma growth by targeting both tumor and endothelial cells
    Article Snippet: .. His-tagged recombinant FAK C-terminal FAT domain protein (residues 892–1052) was expressed from the vector pET15b (Novagen) in E. coli BL21 (DE3) cells. ..

    Article Title: A novel interaction between DNA ligase III and DNA polymerase ? plays an essential role in mitochondrial DNA stability
    Article Snippet: .. Briefly, a mitochondria-specific full-length DNA ligase III construct (comprising nucleotides 73–3102 of human DNA ligase III cDNA, GenBank® accession number ) with a 3′ terminal HA tag sequence (5′-GGCGTAGTCGGGGACGTCGTAGGGGTA-3′) flanked by BamH1 sites was cloned into the vector pET15b (Novagen). .. Digestion of this with XmaI and KpnI restriction enzymes (New England BioLabs) led to the elimination of 39 base pairs.

    Article Title: Coxsackievirus and Adenovirus Receptor Amino-Terminal Immunoglobulin V-Related Domain Binds Adenovirus Type 2 and Fiber Knob from Adenovirus Type 12
    Article Snippet: .. The PCR product was cloned between the Nde I and Bam HI sites of vector pET15b (Novagen) and transformed into strain BL21-DE3 (Novagen) for expression of the hexahistidine-tagged knob protein. .. Overnight cultures in Luria-Bertani (LB) broth containing 150 mg of penicillin G (Sigma)/liter were diluted 100-fold into fresh LB-penicillin broth and grown at 37°C until mid-log phase (optical density of 0.8 at 600 nm), at which time they were chilled to 24°C and adjusted to 50 μM isopropyl β- d -thiogalactopyranoside (IPTG) to induce knob expression.

    Article Title: The Pseudomonas aeruginosa Flagellar Cap Protein, FliD, Is Responsible for Mucin Adhesion
    Article Snippet: .. RER39 [5′(CCCAAAAAAAAA CATATG GCGAACAGTACGACG)3′] was used as the 5′ primer to amplify the complete fliD gene, which was cloned into the vector pET15B (Novagen, Inc., Madison, Wis.); an Nde I site was added to this primer, which is shown here in boldface. .. pG10E was constructed by cloning a 10-kb Eco RI fragment which was excised from the cosmid pRR194 ( ) into the Eco RI site of pGEM3Z (Promega, Inc., Madison, Wis.).

    Article Title: Phosphorylation of WRINKLED1 by KIN10 Results in Its Proteasomal Degradation, Providing a Link between Energy Homeostasis and Lipid Biosynthesis [OPEN]
    Article Snippet: .. WRI1 coding sequence ( ) was also amplified by PCR and inserted between Xho I and Bam HI of vector pET15b (Novagen) for production of recombinant WRI1 protein in Escherichia coli BL21(DE3). .. The GRIK1 was removed with Eco RI and Xho I from vector pGEX-5X-3 (pNSB1554; ) and inserted between the Eco RI and Xho I sites of pET28b (Novagen) for production of recombinant His-tag GRIK1. s of KIN10 mutants T175A and K48M ( ) were amplified by PCR and cloned into pGWB414 for tobacco transient expression assays.

    Article Title: Intranuclear binding in space and time of exon junction complex and NXF1 to premRNPs/mRNPs in vivo
    Article Snippet: .. Y14 was expressed as a His-tagged fusion protein from the vector pET15B (Novagen) in BL21 bacteria (Agilent Technologies) and purified on Ni-NTA (QIAGEN). .. The protein coding sequences of C. tentans eIF4AIII, Btz, NXF1, and UPF3 were obtained by PCR using cDNA synthesized from mRNA as template and cloned into the expression vector pET-46Ek/LIC (Novagen).

    Article Title: Characterization of the NAD(P)H Oxidase and Metronidazole Reductase Activities of the RdxA Nitroreductase of Helicobacter pylori
    Article Snippet: .. Plasmid pET15b-rdxA5 in which the rdxA gene is expressed under the control of the T7 promoter, was constructed by cloning the PCR-amplified rdxA genes from H. pylori SS1 chromosomal DNA into vector pET15b (Novagen, Inc.). .. The following primers were used to create PCR fragments flanked by NdeI - BamHI sites, with restriction sites underlined: 5RdxA_NdeI (5′-GGGAATTC CATATG GAATTTTTGGATCAAG) and 3RdxA_BamHI (5′-CGC GGATCC TCACAACCAAGTAATCGCATC).

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. The C-terminal portion of CHC22 (residues 1521–1640) was cloned into the pET15b vector.

    Article Title: Genomic Sequence and Characterization of the Virulent Bacteriophage ?CTP1 from Clostridium tyrobutyricum and Heterologous Expression of Its Endolysin ▿
    Article Snippet: .. The PCR products were subcloned into the NdeI and XhoI sites of vector pET15b (Novagen) and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, constructs ctp1l- pET15b and orf27- pET15b were transformed into E. coli BL21(DE3) (Invitrogen).

    Article Title: Conservation of Helical Bundle Structure between the Exocyst Subunits
    Article Snippet: .. Protein Expression and Purification Genes encoding full-length Sec10p (residues 1–872), the various truncations [Sec10(1–589); Sec10(590–871); Sec10(75–859), and the predicted structural domain Sec10(145–827)] were amplified by polymerase chain reaction and cloned into the Nde I and Bam HI restriction sites of the vector pET15b (Novagen), which introduces a 6-histidine tag (His6 ) at the N termini. ..

    Article Title: Genomic Sequence of Bacteriophage ATCC 8074-B1 and Activity of Its Endolysin and Engineered Variants against Clostridium sporogenes
    Article Snippet: .. The PCR product was restricted, subcloned into the NdeI and BamHI sites of vector pET15b (Novagen), and transformed into E. coli as described previously ( ). .. Positive transformants were selected with ampicillin (100 μg/ml), and after sequence confirmation, construct cs74l -pET15b was transformed into E. coli BL21(DE3) (Invitrogen) for protein expression.

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: .. Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia). .. Region 4.2 of σA (residues 349–399) was expressed in E. coli BL21(DE3) cells as a His-tagged fusion by using the vector pET28 (Novagen).

    Affinity Chromatography:

    Article Title: Autoregulation of a bacterial ? factor explored by using segmental isotopic labeling and NMR
    Article Snippet: .. Wild-type σA [1–399] and Δ1.1-σA [137–399] were expressed in E. coli BL21(DE3)pLysS cells by using the vector pET15b (Novagen) and purified by Ni2+ -charged Hi-Trap affinity chromatography (Pharmacia) followed by gel filtration chromatography on a Superdex 75 column (Pharmacia). .. Region 4.2 of σA (residues 349–399) was expressed in E. coli BL21(DE3) cells as a His-tagged fusion by using the vector pET28 (Novagen).

    Produced:

    Article Title: A novel clathrin homolog that co-distributes with cytoskeletal components functions in the trans-Golgi network
    Article Snippet: .. Recombinant CHC22Hub (residues 1074–1640) was produced by PCR amplification from HS6 and insertion into vector pET15b (Novagen), and bovine neuronal light chains LCa and LCb cDNA were each cloned upstream of CHC22Hub as described ( ). .. The C-terminal portion of CHC22 (residues 1521–1640) was cloned into the pET15b vector.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Millipore his tag pet15b vector
    F-5 peptide retains the full promotility activity of full-length Hsp90α. ( A ) A schematic representation of 7 human Hsp90α proteins/peptides (wild type and mutants). Each cDNA fragment by PCR was subcloned into <t>pET15b</t> and expressed in BL-21 bacteria, according to the manufacturer’s protocol. Protein was sequentially purified by Ni + column and finally FPLC, prior to in vitro motility assays and in vivo wound healing assays. ( B ) A Coomassie Blue-stained SDS-PAGE gel to show the proteins after FPLC (~3 μg/lane). The first lane on far left is molecular weight markers. Mr, molecular weight. ( C – F ) of the migration experiments ( n = 4, * P
    His Tag Pet15b Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/his tag pet15b vector/product/Millipore
    Average 86 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    his tag pet15b vector - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    92
    Millipore expression vector pet15b
    F-5 peptide retains the full promotility activity of full-length Hsp90α. ( A ) A schematic representation of 7 human Hsp90α proteins/peptides (wild type and mutants). Each cDNA fragment by PCR was subcloned into <t>pET15b</t> and expressed in BL-21 bacteria, according to the manufacturer’s protocol. Protein was sequentially purified by Ni + column and finally FPLC, prior to in vitro motility assays and in vivo wound healing assays. ( B ) A Coomassie Blue-stained SDS-PAGE gel to show the proteins after FPLC (~3 μg/lane). The first lane on far left is molecular weight markers. Mr, molecular weight. ( C – F ) of the migration experiments ( n = 4, * P
    Expression Vector Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 110 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expression vector pet15b/product/Millipore
    Average 92 stars, based on 110 article reviews
    Price from $9.99 to $1999.99
    expression vector pet15b - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    86
    Millipore t7 expression plasmids pet15b
    F-5 peptide retains the full promotility activity of full-length Hsp90α. ( A ) A schematic representation of 7 human Hsp90α proteins/peptides (wild type and mutants). Each cDNA fragment by PCR was subcloned into <t>pET15b</t> and expressed in BL-21 bacteria, according to the manufacturer’s protocol. Protein was sequentially purified by Ni + column and finally FPLC, prior to in vitro motility assays and in vivo wound healing assays. ( B ) A Coomassie Blue-stained SDS-PAGE gel to show the proteins after FPLC (~3 μg/lane). The first lane on far left is molecular weight markers. Mr, molecular weight. ( C – F ) of the migration experiments ( n = 4, * P
    T7 Expression Plasmids Pet15b, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 expression plasmids pet15b/product/Millipore
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t7 expression plasmids pet15b - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    F-5 peptide retains the full promotility activity of full-length Hsp90α. ( A ) A schematic representation of 7 human Hsp90α proteins/peptides (wild type and mutants). Each cDNA fragment by PCR was subcloned into pET15b and expressed in BL-21 bacteria, according to the manufacturer’s protocol. Protein was sequentially purified by Ni + column and finally FPLC, prior to in vitro motility assays and in vivo wound healing assays. ( B ) A Coomassie Blue-stained SDS-PAGE gel to show the proteins after FPLC (~3 μg/lane). The first lane on far left is molecular weight markers. Mr, molecular weight. ( C – F ) of the migration experiments ( n = 4, * P

    Journal: The Journal of Clinical Investigation

    Article Title: A fragment of secreted Hsp90? carries properties that enable it to accelerate effectively both acute and diabetic wound healing in mice

    doi: 10.1172/JCI46475

    Figure Lengend Snippet: F-5 peptide retains the full promotility activity of full-length Hsp90α. ( A ) A schematic representation of 7 human Hsp90α proteins/peptides (wild type and mutants). Each cDNA fragment by PCR was subcloned into pET15b and expressed in BL-21 bacteria, according to the manufacturer’s protocol. Protein was sequentially purified by Ni + column and finally FPLC, prior to in vitro motility assays and in vivo wound healing assays. ( B ) A Coomassie Blue-stained SDS-PAGE gel to show the proteins after FPLC (~3 μg/lane). The first lane on far left is molecular weight markers. Mr, molecular weight. ( C – F ) of the migration experiments ( n = 4, * P

    Article Snippet: PCR fragments were subcloned into the His-tag pET15b vector (EMD Biosciences Inc.) at BamH1 or Bam H1 and NdeI sites.

    Techniques: Activity Assay, Polymerase Chain Reaction, Purification, Fast Protein Liquid Chromatography, In Vitro, In Vivo, Staining, SDS Page, Molecular Weight, Migration