Structured Review

Enzymatics uracil dna glycosylase
Uracil Dna Glycosylase, supplied by Enzymatics, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/uracil dna glycosylase/product/Enzymatics
Average 90 stars, based on 4 article reviews
Price from $9.99 to $1999.99
uracil dna glycosylase - by Bioz Stars, 2019-10
90/100 stars

Images

Related Articles

Amplification:

Article Title: Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease
Article Snippet: The second strand of DNA was digested with Uracil DNA Glycosylase (Enzymatics) at 37°C for 15 min. .. The PCR reaction was set up containing UDG-digested DNA, primer A and B, Phusion HF Buffer, dNTP, water, and Phusion II (New England Biolabs).

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Double-stranded cDNA was end repaired, A-tailed, and ligated to adaptors as for the DNA library preparation (described above), and the resultant cDNA was purified and size selected to obtain 750-bp fragments. .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ). .. The final cDNA was purified using AMPure XP beads (Agencourt) and eluted in 15 µl buffer EB (Qiagen).

Article Title: A Low-Cost Library Construction Protocol and Data Analysis Pipeline for Illumina-Based Strand-Specific Multiplex RNA-Seq
Article Snippet: Paragraph title: dUTP excision and amplification of library ... The size-selected dsDNA product (15 µL) was mixed with 1 µL of uracil DNA glycosylase (Enzymatics, MA) and incubated at 37°C for 30 minutes in a PCR machine.

Synthesized:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: After the first strand cDNA synthesis was carried out using random primers, the second strand cDNA was synthesized using a special dNTP mix in which dTTP is replaced by dUTP. .. The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: Second strand cDNA synthesis was performed with dNTPs, but replacing dTTP with dUTP. .. After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics). .. A final PCR reaction was performed using Phusion high-fidelity DNA polymerase (NEB).

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Poly(A)+ RNA was purified using Dynabeads oligo(dT) (Life Technologies) according to the manufacturer’s protocol and fragmented by incubation at 94°C for 2 min to generate long fragments ( > 700 bp). cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen) following the manufacturer’s protocol, and the resulting cDNA was purified using RNA Clean XP magnetic beads (Agencourt). .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Article Title: GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway
Article Snippet: The first-strand cDNA was synthesized using reverse transcriptase SuperScript III (Invitrogen) with random primers and dNTP, whereas the second-strand cDNA was generated using DNA polymerase I (Enzymatics) using dUTP. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics) and adapter ligation (Quick T4 DNA Ligase, NEB), the dUTP-containing second-strand was digested by uracil DNA glycosylase (Enzymatics).

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: Second strands were synthesized using DNA polymerase I and RNaseH, and dsDNA ends were repaired using an End-Repair Mix LC (Enzymatics) and dA-tails were added using Klenow 3′→5′ exo- (Enzymatics). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Single-strand cDNA was synthesized using random primers, dNTPs, and SuperScript III (Invitrogen) reverse transcriptase. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

Construct:

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA).

Real-time Polymerase Chain Reaction:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics). .. The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

Multiplex Assay:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: The RNA-seq libraries were prepared using a customized Illumina-based strand-specific multiplex library construction protocol modified from . .. The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

Incubation:

Article Title: Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease
Article Snippet: The supernatant was transferred to a tube with half of the new volume of AMPure XP beads and incubated at room temperature for 15 min. .. The second strand of DNA was digested with Uracil DNA Glycosylase (Enzymatics) at 37°C for 15 min.

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Poly(A)+ RNA was purified using Dynabeads oligo(dT) (Life Technologies) according to the manufacturer’s protocol and fragmented by incubation at 94°C for 2 min to generate long fragments ( > 700 bp). cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen) following the manufacturer’s protocol, and the resulting cDNA was purified using RNA Clean XP magnetic beads (Agencourt). .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Article Title: A Low-Cost Library Construction Protocol and Data Analysis Pipeline for Illumina-Based Strand-Specific Multiplex RNA-Seq
Article Snippet: The supernatant was then mixed with 12 µL of AMPure XP beads and 5 µL of 40% of PEG8000 and eluted with 10 µL of nuclease-free water, it was then again purified using 12 µL of AMPure XP beads and eluted in 30 µL of EB buffer. .. The size-selected dsDNA product (15 µL) was mixed with 1 µL of uracil DNA glycosylase (Enzymatics, MA) and incubated at 37°C for 30 minutes in a PCR machine. .. Without purification, the mixture was then added to 2 µL of Illumina PE primers (5 µM each) , 6 µL of 5× Phusion HF buffer, 1 µL of 10 mM dNTP, 1 µL of Phusion® Hot Start 2 High-Fidelity DNA Polymerase (NEB, MA) and 4.5 µL of water.

Modification:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: The RNA-seq libraries were prepared using a customized Illumina-based strand-specific multiplex library construction protocol modified from . .. The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

High Performance Liquid Chromatography:

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. The resulting paired-end adaptor ligated-cDNA tags at the 3′ end were amplified using PCR indexed primers (IP) annealing in the adaptor sequence for 15 cycles enriching the final libraries (see for all 6-nt tags/index).

Ligation:

Article Title: Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease
Article Snippet: The Y-shape adapter ligation was performed by incubating at room temperature for 15 min. DNA was purified and size selected by cleaning up with AMPure XP beads 3 consecutive times and eluting in TE buffer. .. The second strand of DNA was digested with Uracil DNA Glycosylase (Enzymatics) at 37°C for 15 min.

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: Second strand cDNA synthesis was performed with dNTPs, but replacing dTTP with dUTP. .. After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics). .. A final PCR reaction was performed using Phusion high-fidelity DNA polymerase (NEB).

Article Title: GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway
Article Snippet: The first-strand cDNA was synthesized using reverse transcriptase SuperScript III (Invitrogen) with random primers and dNTP, whereas the second-strand cDNA was generated using DNA polymerase I (Enzymatics) using dUTP. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics) and adapter ligation (Quick T4 DNA Ligase, NEB), the dUTP-containing second-strand was digested by uracil DNA glycosylase (Enzymatics). .. The resulting first-strand adaptor-ligated cDNA was used for PCR enrichment (NEBNext High-Fidelity PCR Master Mix, NEB) for 14 cycles.

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: A-tailed DNA was added to the Y-shape adapters 5′-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T-3′ and 5′-/5P/-G*A*TCGGAAGAGCACACGTC TGAACTCCAGTC*A*C-3′ (asterisk indicates phosphorothioate bonds and 5P indicates phosphorylation) using T4 DNA Ligase (Enzymatics). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics). .. DNA fragments with adapters and an index sequence were amplified using a thermal cycler.

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: The second cDNA strand was generated by DNA polymerase I (Enzymatics, USA) with dUTP mix. .. Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. The resulting paired-end adaptor ligated-cDNA tags at the 3′ end were amplified using PCR indexed primers (IP) annealing in the adaptor sequence for 15 cycles enriching the final libraries (see for all 6-nt tags/index).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Second-strand cDNA was generated using DNA polymerase I (Enzymatics) and dATP, dCTP, dGTP, and dUTPs. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics). .. The remaining first-strand adaptor-ligated cDNA was used for 13 to 15 cycles of PCR enrichment with NEB-Next High-Fidelity PCR Master Mix (New England Biolabs).

Generated:

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Strand-specific libraries were generated with dUTP for second-strand synthesis. .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Article Title: GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway
Article Snippet: The first-strand cDNA was synthesized using reverse transcriptase SuperScript III (Invitrogen) with random primers and dNTP, whereas the second-strand cDNA was generated using DNA polymerase I (Enzymatics) using dUTP. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics) and adapter ligation (Quick T4 DNA Ligase, NEB), the dUTP-containing second-strand was digested by uracil DNA glycosylase (Enzymatics).

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: The second cDNA strand was generated by DNA polymerase I (Enzymatics, USA) with dUTP mix. .. Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Second-strand cDNA was generated using DNA polymerase I (Enzymatics) and dATP, dCTP, dGTP, and dUTPs. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

Sequencing:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics). .. The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics). .. A final PCR reaction was performed using Phusion high-fidelity DNA polymerase (NEB).

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Transcriptome sequencing (RNA-seq) libraries were generated from 2 µg total RNA per replicate, using a published protocol ( ) with minor modifications. .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Article Title: GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway
Article Snippet: Paragraph title: RNA-Seq library preparation and sequencing ... After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics) and adapter ligation (Quick T4 DNA Ligase, NEB), the dUTP-containing second-strand was digested by uracil DNA glycosylase (Enzymatics).

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: There are errors in the first paragraph of the Materials and Methods section under the heading “RNA-Seq library preparation and sequence analyses.” The correct paragraph is: To prepare RNA-Seq library, the extracted total RNA was mixed with ERCC RNA Spike-In control mixes (Life Technologies, Carlsbad, CA, USA) and then polyA RNA was isolated using oligo(dT)25 Dynabeads (Invitrogen) (see reference 23). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics).

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Paragraph title: Library preparation and sequencing ... Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Paragraph title: Transcriptome Sequencing, Assembly and Analysis, and RT-qPCR ... After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

RNA Sequencing Assay:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: Paragraph title: RNA isolation and RNA-seq library construction ... The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

Article Title: Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease
Article Snippet: Paragraph title: Strand-specific RNA-Seq library preparation ... The second strand of DNA was digested with Uracil DNA Glycosylase (Enzymatics) at 37°C for 15 min.

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: Paragraph title: RNA-seq Library Preparation ... After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics).

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Paragraph title: Illumina RNA-seq library preparation. ... The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Article Title: GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in the plant mevalonate pathway
Article Snippet: Paragraph title: RNA-Seq library preparation and sequencing ... After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics) and adapter ligation (Quick T4 DNA Ligase, NEB), the dUTP-containing second-strand was digested by uracil DNA glycosylase (Enzymatics).

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: There are errors in the first paragraph of the Materials and Methods section under the heading “RNA-Seq library preparation and sequence analyses.” The correct paragraph is: To prepare RNA-Seq library, the extracted total RNA was mixed with ERCC RNA Spike-In control mixes (Life Technologies, Carlsbad, CA, USA) and then polyA RNA was isolated using oligo(dT)25 Dynabeads (Invitrogen) (see reference 23). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics).

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: For each sample, 5 mg of RNA was used for preparation of RNA-seq libraries as described by with minor modifications. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

Magnetic Beads:

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Poly(A)+ RNA was purified using Dynabeads oligo(dT) (Life Technologies) according to the manufacturer’s protocol and fragmented by incubation at 94°C for 2 min to generate long fragments ( > 700 bp). cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen) following the manufacturer’s protocol, and the resulting cDNA was purified using RNA Clean XP magnetic beads (Agencourt). .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Isolation:

Article Title: Accurate timekeeping is controlled by a cycling activator in Arabidopsis
Article Snippet: Paragraph title: RNA isolation and RNA-seq library construction ... The second strand cDNA was then digested using Uracil DNA glycosylase (Enzymatics).

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: Total RNA was isolated as described above. .. After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics).

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: There are errors in the first paragraph of the Materials and Methods section under the heading “RNA-Seq library preparation and sequence analyses.” The correct paragraph is: To prepare RNA-Seq library, the extracted total RNA was mixed with ERCC RNA Spike-In control mixes (Life Technologies, Carlsbad, CA, USA) and then polyA RNA was isolated using oligo(dT)25 Dynabeads (Invitrogen) (see reference 23). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Briefly, poly(A) RNA was isolated from total RNA using Dynabeads oligo(dT)25 (Invitrogen), fragmented at 94°C for 5 min and eluted. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

Size-exclusion Chromatography:

Article Title: A Low-Cost Library Construction Protocol and Data Analysis Pipeline for Illumina-Based Strand-Specific Multiplex RNA-Seq
Article Snippet: The size-selected dsDNA product (15 µL) was mixed with 1 µL of uracil DNA glycosylase (Enzymatics, MA) and incubated at 37°C for 30 minutes in a PCR machine. .. Without purification, the mixture was then added to 2 µL of Illumina PE primers (5 µM each) , 6 µL of 5× Phusion HF buffer, 1 µL of 10 mM dNTP, 1 µL of Phusion® Hot Start 2 High-Fidelity DNA Polymerase (NEB, MA) and 4.5 µL of water.

Purification:

Article Title: Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease
Article Snippet: The Y-shape adapter ligation was performed by incubating at room temperature for 15 min. DNA was purified and size selected by cleaning up with AMPure XP beads 3 consecutive times and eluting in TE buffer. .. The second strand of DNA was digested with Uracil DNA Glycosylase (Enzymatics) at 37°C for 15 min.

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Double-stranded cDNA was end repaired, A-tailed, and ligated to adaptors as for the DNA library preparation (described above), and the resultant cDNA was purified and size selected to obtain 750-bp fragments. .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ).

Article Title: A Low-Cost Library Construction Protocol and Data Analysis Pipeline for Illumina-Based Strand-Specific Multiplex RNA-Seq
Article Snippet: The size-selected dsDNA product (15 µL) was mixed with 1 µL of uracil DNA glycosylase (Enzymatics, MA) and incubated at 37°C for 30 minutes in a PCR machine. .. The PCR mix was incubated with a programmed cycle as following: 94°C for 30 sec, 11 cycles of 98°C, for 10 sec, 65°C for 30 sec, 72°C for 30 sec; 72°C for 5 min followed by a hold at 4°C.

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: A-tailed DNA was added to the Y-shape adapters 5′-A*A*TGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGAT*C*T-3′ and 5′-/5P/-G*A*TCGGAAGAGCACACGTC TGAACTCCAGTC*A*C-3′ (asterisk indicates phosphorothioate bonds and 5P indicates phosphorylation) using T4 DNA Ligase (Enzymatics). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics). .. DNA fragments with adapters and an index sequence were amplified using a thermal cycler.

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. The resulting paired-end adaptor ligated-cDNA tags at the 3′ end were amplified using PCR indexed primers (IP) annealing in the adaptor sequence for 15 cycles enriching the final libraries (see for all 6-nt tags/index).

Polymerase Chain Reaction:

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: Double-stranded cDNA was end repaired, A-tailed, and ligated to adaptors as for the DNA library preparation (described above), and the resultant cDNA was purified and size selected to obtain 750-bp fragments. .. The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ). .. The final cDNA was purified using AMPure XP beads (Agencourt) and eluted in 15 µl buffer EB (Qiagen).

Article Title: A Low-Cost Library Construction Protocol and Data Analysis Pipeline for Illumina-Based Strand-Specific Multiplex RNA-Seq
Article Snippet: The supernatant was then mixed with 12 µL of AMPure XP beads and 5 µL of 40% of PEG8000 and eluted with 10 µL of nuclease-free water, it was then again purified using 12 µL of AMPure XP beads and eluted in 30 µL of EB buffer. .. The size-selected dsDNA product (15 µL) was mixed with 1 µL of uracil DNA glycosylase (Enzymatics, MA) and incubated at 37°C for 30 minutes in a PCR machine. .. Without purification, the mixture was then added to 2 µL of Illumina PE primers (5 µM each) , 6 µL of 5× Phusion HF buffer, 1 µL of 10 mM dNTP, 1 µL of Phusion® Hot Start 2 High-Fidelity DNA Polymerase (NEB, MA) and 4.5 µL of water.

Quantitative RT-PCR:

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Paragraph title: Transcriptome Sequencing, Assembly and Analysis, and RT-qPCR ... After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

cDNA Library Assay:

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. The resulting paired-end adaptor ligated-cDNA tags at the 3′ end were amplified using PCR indexed primers (IP) annealing in the adaptor sequence for 15 cycles enriching the final libraries (see for all 6-nt tags/index).

Liquid Chromatography:

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: Second strands were synthesized using DNA polymerase I and RNaseH, and dsDNA ends were repaired using an End-Repair Mix LC (Enzymatics) and dA-tails were added using Klenow 3′→5′ exo- (Enzymatics). .. The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics).

Electrophoresis:

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: The integrity of the RNA was assessed and verified using an Experion Automated Electrophoresis System (Bio-Rad) before mRNA-seq libraries were prepared using methods described previously ( ). .. After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics).

RNA Extraction:

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Wheat BL and CASL*2BS libraries for Illumina high-throughput strand-specific RNA-seq were prepared as follows: Total RNA was extracted with the TRIzol method using standard TRIzol RNA extraction protocol. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

Selection:

Article Title: Systems genomics evaluation of the SH-SY5Y neuroblastoma cell line as a model for Parkinson’s disease
Article Snippet: The first cleanup was performed with 1 volume of AMPure XP beads, the second with 1.4 volumes, and the last with 1 volume incubated at room temperature for 5 min without washing to perform size selection. .. The second strand of DNA was digested with Uracil DNA Glycosylase (Enzymatics) at 37°C for 15 min.

Article Title: Catalytic-Independent Functions of PARP-1 Determine Sox2 Pioneer Activity at Intractable Genomic Loci
Article Snippet: Second strand cDNA synthesis was performed with dNTPs, but replacing dTTP with dUTP. .. After end-repair, dA-tailing, ligation to adaptors containing barcode sequences, and size selection using AMPure beads (Agencourt), the synthesized second-strand was digested using uracil DNA glycosylase (Enzymatics). .. A final PCR reaction was performed using Phusion high-fidelity DNA polymerase (NEB).

Random Hexamer Labeling:

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Cleaved RNA fragments were primed with random hexamer primers to synthesize the first cDNA strand using reverse transcriptase SuperScript III (Invitrogen, USA) with dNTP. .. Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA).

Concentration Assay:

Article Title: The Cost of Metabolic Interactions in Symbioses between Insects and Bacteria with Reduced Genomes
Article Snippet: The uracil-containing second strand was then digested using uracil DNA glycosylase (Enzymatics), and cDNA was subjected to 15 cycles of PCR amplification using barcoded Illumina index primers ( ). .. The final cDNA was purified using AMPure XP beads (Agencourt) and eluted in 15 µl buffer EB (Qiagen).

High Throughput Screening Assay:

Article Title: Transcriptomic Analysis of Petunia hybrida in Response to Salt Stress Using High Throughput RNA Sequencing
Article Snippet: Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA). .. Following end-repair (Enzymatics, USA), dA-tailing (Klenow 3′–5′, Enzymatics, USA) and adapter ligation (T4 DNA Ligase HC Enzymatics, USA), the second dUTP-strand was digested by uracil DNA glycosylase (Uracil DNA Glycosylase, Enzymatics, USA).

Article Title: A Metabolic Gene Cluster in the Wheat W1 and the Barley Cer-cqu Loci Determines β-Diketone Biosynthesis and Glaucousness
Article Snippet: Wheat BL and CASL*2BS libraries for Illumina high-throughput strand-specific RNA-seq were prepared as follows: Total RNA was extracted with the TRIzol method using standard TRIzol RNA extraction protocol. .. After end-repair (Enzymatics), dA-tailing with Klenow 3′-5′ (Enzymatics), and adapter ligation (Quick T4 DNA Ligase; New England Biolabs), the second strand (dUTP-containing) was digested by uracil DNA glycosylase (Enzymatics).

Gel Extraction:

Article Title: Correction: Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant FactoryTranscriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory
Article Snippet: The ligation product was purified and size selected by using AMpure XP (Beckman Coulter) and then the purified second strand DNA was digested using uracil DNA glycosylase (Enzymatics). .. DNA fragments with adapters and an index sequence were amplified using a thermal cycler.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Enzymatics uracil dna glycosylase
    Uracil Dna Glycosylase, supplied by Enzymatics, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uracil dna glycosylase/product/Enzymatics
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    uracil dna glycosylase - by Bioz Stars, 2019-10
    90/100 stars
      Buy from Supplier

    90
    Enzymatics uracil dna glycosylase udg
    Uracil Dna Glycosylase Udg, supplied by Enzymatics, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/uracil dna glycosylase udg/product/Enzymatics
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    uracil dna glycosylase udg - by Bioz Stars, 2019-10
    90/100 stars
      Buy from Supplier

    81
    Enzymatics formanidopyrimidine dna glycosylase fpg enzyme
    c-Met mediates PARP1 functions through phosphorylation of PARP1 at Y907 ( a ) MDA-MB-231 cells were treated with ABT-888 (50 μM), foretinib (1 μM), or the combination for 18 h. Representative images and quantitation of γ-H2AX (green) from three independent experiments are shown. Bar, 20 μm. ( b ) c-Met- or control-knockdown MDA-MB-231 cells as well as c-Met-knockdown MDA-MB-231 cells re-expressing wild-type (Wt) or kinase dead (KD) mutant were treated with the indicated drugs for 18 h. Representative images and quantitation of γ-H2AX (green) from three independent experiments are shown. Bar, 20 μm. ( c ) HEK293T cells were transfected with V5-PARP1 and Flag-c-Met expression plasmids, and the cells were treated with 10 μM H 2 O 2 for 15 min. PARP1 was immunoprecipitated with V5 antibody, followed by Western blotting with 4G10 (anti phosphor-tyrosine antibody). ( d ) Left, Western blot showing expression of PARP1 and tubulin in PARP1-knockdown (shRNA targeting 3′-UTR) MDA-MB-231 cells and PARP1-knockdown MDA-MB-231 cells re-expressing PARP1 wild-type or Y907 mutant. Center, <t>DNA</t> damage as measured by comet assay with pre-incubation with <t>formanidopyrimidine</t> DNA <t>glycosylase</t> <t>(Fpg)</t> in PARP1-wild-type-, PARP1-Y907E-, PARP1-Y907F-expressing MDA-MB-231 stable cells treated with 20 μM H 2 O 2 for 30 min. Right, quantitation of intensity of damaged DNA from three independent experiments. Bar, 100 μm. ( e ) Western blot showing poly-ADP ribosylation as indicated by PAR in MDA-MB-231 stable cells described in (d) treated with or without 20 μM H 2 O 2 for 30 min. ( f ) MDA-MB-231 cells were treated with or without 20 μM H 2 O 2 for 30 min or H 2 O 2 plus 2 μM crizotinib or 1 μM foretinib pre-treatment 1h. Cell lysates were subjected to Western blot analysis using the indicated antibodies. ( g ) Re-expression of wild-type or mutant PARP1 in PARP1-knockdown MDA-MB-231 cells with or without c-Met knockdown were treated with 50 μM ABT-888 for 18 h. γ-H2AX (green) was detected by immunofluorescence confocal microscopy. Bar, 20 μm. Representative images and quantitation of three independent experiments are shown. ( h ) Stable cells described in (g) were treated with the indicated concentrations of AG014699 and subjected to clonogenic formation assay for 8 days. Representative images and quantitation of clongenic cells from three independent experiments are shown. Bar, 10 mm. Error bars represent s.d. * P
    Formanidopyrimidine Dna Glycosylase Fpg Enzyme, supplied by Enzymatics, used in various techniques. Bioz Stars score: 81/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/formanidopyrimidine dna glycosylase fpg enzyme/product/Enzymatics
    Average 81 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    formanidopyrimidine dna glycosylase fpg enzyme - by Bioz Stars, 2019-10
    81/100 stars
      Buy from Supplier

    Image Search Results


    c-Met mediates PARP1 functions through phosphorylation of PARP1 at Y907 ( a ) MDA-MB-231 cells were treated with ABT-888 (50 μM), foretinib (1 μM), or the combination for 18 h. Representative images and quantitation of γ-H2AX (green) from three independent experiments are shown. Bar, 20 μm. ( b ) c-Met- or control-knockdown MDA-MB-231 cells as well as c-Met-knockdown MDA-MB-231 cells re-expressing wild-type (Wt) or kinase dead (KD) mutant were treated with the indicated drugs for 18 h. Representative images and quantitation of γ-H2AX (green) from three independent experiments are shown. Bar, 20 μm. ( c ) HEK293T cells were transfected with V5-PARP1 and Flag-c-Met expression plasmids, and the cells were treated with 10 μM H 2 O 2 for 15 min. PARP1 was immunoprecipitated with V5 antibody, followed by Western blotting with 4G10 (anti phosphor-tyrosine antibody). ( d ) Left, Western blot showing expression of PARP1 and tubulin in PARP1-knockdown (shRNA targeting 3′-UTR) MDA-MB-231 cells and PARP1-knockdown MDA-MB-231 cells re-expressing PARP1 wild-type or Y907 mutant. Center, DNA damage as measured by comet assay with pre-incubation with formanidopyrimidine DNA glycosylase (Fpg) in PARP1-wild-type-, PARP1-Y907E-, PARP1-Y907F-expressing MDA-MB-231 stable cells treated with 20 μM H 2 O 2 for 30 min. Right, quantitation of intensity of damaged DNA from three independent experiments. Bar, 100 μm. ( e ) Western blot showing poly-ADP ribosylation as indicated by PAR in MDA-MB-231 stable cells described in (d) treated with or without 20 μM H 2 O 2 for 30 min. ( f ) MDA-MB-231 cells were treated with or without 20 μM H 2 O 2 for 30 min or H 2 O 2 plus 2 μM crizotinib or 1 μM foretinib pre-treatment 1h. Cell lysates were subjected to Western blot analysis using the indicated antibodies. ( g ) Re-expression of wild-type or mutant PARP1 in PARP1-knockdown MDA-MB-231 cells with or without c-Met knockdown were treated with 50 μM ABT-888 for 18 h. γ-H2AX (green) was detected by immunofluorescence confocal microscopy. Bar, 20 μm. Representative images and quantitation of three independent experiments are shown. ( h ) Stable cells described in (g) were treated with the indicated concentrations of AG014699 and subjected to clonogenic formation assay for 8 days. Representative images and quantitation of clongenic cells from three independent experiments are shown. Bar, 10 mm. Error bars represent s.d. * P

    Journal: Nature medicine

    Article Title: Blocking c-Met-mediated PARP1 phosphorylation enhances anti-tumor effects of PARP inhibitors

    doi: 10.1038/nm.4032

    Figure Lengend Snippet: c-Met mediates PARP1 functions through phosphorylation of PARP1 at Y907 ( a ) MDA-MB-231 cells were treated with ABT-888 (50 μM), foretinib (1 μM), or the combination for 18 h. Representative images and quantitation of γ-H2AX (green) from three independent experiments are shown. Bar, 20 μm. ( b ) c-Met- or control-knockdown MDA-MB-231 cells as well as c-Met-knockdown MDA-MB-231 cells re-expressing wild-type (Wt) or kinase dead (KD) mutant were treated with the indicated drugs for 18 h. Representative images and quantitation of γ-H2AX (green) from three independent experiments are shown. Bar, 20 μm. ( c ) HEK293T cells were transfected with V5-PARP1 and Flag-c-Met expression plasmids, and the cells were treated with 10 μM H 2 O 2 for 15 min. PARP1 was immunoprecipitated with V5 antibody, followed by Western blotting with 4G10 (anti phosphor-tyrosine antibody). ( d ) Left, Western blot showing expression of PARP1 and tubulin in PARP1-knockdown (shRNA targeting 3′-UTR) MDA-MB-231 cells and PARP1-knockdown MDA-MB-231 cells re-expressing PARP1 wild-type or Y907 mutant. Center, DNA damage as measured by comet assay with pre-incubation with formanidopyrimidine DNA glycosylase (Fpg) in PARP1-wild-type-, PARP1-Y907E-, PARP1-Y907F-expressing MDA-MB-231 stable cells treated with 20 μM H 2 O 2 for 30 min. Right, quantitation of intensity of damaged DNA from three independent experiments. Bar, 100 μm. ( e ) Western blot showing poly-ADP ribosylation as indicated by PAR in MDA-MB-231 stable cells described in (d) treated with or without 20 μM H 2 O 2 for 30 min. ( f ) MDA-MB-231 cells were treated with or without 20 μM H 2 O 2 for 30 min or H 2 O 2 plus 2 μM crizotinib or 1 μM foretinib pre-treatment 1h. Cell lysates were subjected to Western blot analysis using the indicated antibodies. ( g ) Re-expression of wild-type or mutant PARP1 in PARP1-knockdown MDA-MB-231 cells with or without c-Met knockdown were treated with 50 μM ABT-888 for 18 h. γ-H2AX (green) was detected by immunofluorescence confocal microscopy. Bar, 20 μm. Representative images and quantitation of three independent experiments are shown. ( h ) Stable cells described in (g) were treated with the indicated concentrations of AG014699 and subjected to clonogenic formation assay for 8 days. Representative images and quantitation of clongenic cells from three independent experiments are shown. Bar, 10 mm. Error bars represent s.d. * P

    Article Snippet: Prepared slides were washed three times in water for 5 min and incubated with formanidopyrimidine DNA glycosylase (Fpg) enzyme (2 U/slide, Enzymatics, Beverly, MA) at 37 °C for 1 h to digest oxidative damage DNA and induce comet tails which were imaged by fluorescence microscope and analyzed by using the Image J software.

    Techniques: Multiple Displacement Amplification, Quantitation Assay, Expressing, Mutagenesis, Transfection, Immunoprecipitation, Western Blot, shRNA, Single Cell Gel Electrophoresis, Incubation, Immunofluorescence, Confocal Microscopy, Tube Formation Assay