universal mirna cloning linker  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    Universal miRNA Cloning Linker
    Description:
    Universal miRNA Cloning Linker 5 ug
    Catalog Number:
    s1315s
    Price:
    148
    Size:
    5 ug
    Category:
    Probes and Primers
    Buy from Supplier


    Structured Review

    New England Biolabs universal mirna cloning linker
    Universal miRNA Cloning Linker
    Universal miRNA Cloning Linker 5 ug
    https://www.bioz.com/result/universal mirna cloning linker/product/New England Biolabs
    Average 90 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    universal mirna cloning linker - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments
    Article Snippet: .. Supplied with PEG 8000 50% w/v and 10x T4 Rnl2 buffer Preadenylated and 3′-blocked linker: Any of miRNA Cloning Linker 1/5rApp/CTGTAGGCACCATCAAT/3ddC/ (IDT), Universal miRNA Cloning Linker 5′ rAppCTGTAGGCACCATCAAT–NH2 3′ (New England Biolabs, cat. no. S1315S), or AIR adenylated linker A (bioo, cat. no. 510205). .. 10 mM dNTP mix (Invitrogen, cat. no. 18427-013) SuperScript III (Invitrogen, cat. no. 18080-093).

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: .. Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds. .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: .. A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. The cDNA was synthesized using a reverse primer (5′-ATT GAT GGT GCC TAC AG-3′) complementary to the adaptor sequence and MMLV reverse transcriptase (Invitrogen).

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: .. A universal miRNA cloning linker (NEB # S1315S) was ligated to the 3′-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242 L) in the presence of PEG 8000 (2.5% w/v), DMSO and SUPERase-In at 37 °C for 2.5 h. The ligated products were resolved by electrophoresis on 15% TBE-Urea gel and the appropriate size fragments eluted from the gel. .. The linker-ligated RNA recovered from RPFs was directly subjected to reverse transcription, while that extracted from fragmented total RNA samples was used as input for the Ribozero reaction (Illumina Ribo-Zero Gold rRNA Removal Kit -Yeast) to remove rRNAs, and subsequently subjected to reverse transcription.

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Hcr1/eIF3j Is a 60S Ribosomal Subunit Recycling Accessory Factor In Vivo
    Article Snippet: .. The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L) and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L). .. The ligated RNA footprints were size selected on a 10% TBE-Urea gel, and reverse transcribed using the RT primer NI-NI-9 ( ) and Superscript III (Invitrogen; 18080044).

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Article Title: Heterogeneous ribosomes preferentially translate distinct subpools of mRNAs genome-wide
    Article Snippet: .. 3′ dephosphorylated RNAs were then incubated with 1.5 μL of 0.5 μg/μL Universal miRNA Cloning Linker (NEB, S1315S) and 1 μL T4 RNA Ligase 2, truncated (NEB, M0242S) in 20 μL of total volume for 2.5 hours at room temperature. .. Samples were then purified by acid-phenol:chloform extraction and isopropanol precipitation.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: .. RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Ligated RNA was gel purified and reverse transcribed by Superscript III (Invitrogen, 18080).

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    Article Title: Tma64 (eIF2D), Tma20 (MCT-1), and Tma22 (DENR) recycle post-termination 40S subunits in vivo
    Article Snippet: .. The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L), and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L). .. The ligated RNA footprints were size selected on a 10% TBE-Urea gel, and reverse transcribed using Superscript III (Invitrogen; 18080044).

    Amplification:

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. Then the 5′ cDNA end was PCR amplified using forward primer SP4FW (5′-GTG AAG GGT GAC TGT AGT CCT GAG C-3′; nt 5227 to 5251) and the reverse primer.

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Amplification was done using Phusion High Fidelity DNA Polymerase (NEB, M0530S).

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The cDNA products were amplified with CJ1341 and a DNA primer that corresponds to the 16S rRNA nts 537–558 (5′ GGAGGGTGCAAGCGTTAATCGG 3′).

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The cDNA products were amplified with CJ1341 and a DNA primer that corresponds to the 16S rRNA nts 537–558 (5′ GGAGGGTGCAAGCGTTAATCGG 3′).

    Synthesized:

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. The cDNA was synthesized using a reverse primer (5′-ATT GAT GGT GCC TAC AG-3′) complementary to the adaptor sequence and MMLV reverse transcriptase (Invitrogen).

    Construct:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences. .. The adapter-ligated RNA constructs were then reverse-transcribed using SuperScript III Reverse Transcriptase (ThermoFisher) and the following reverse transcription primer: 5′-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3′.

    Suction Filtration:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: Generation, processing, and analysis of sequence libraries of ribosome protected footprints or total mRNA fragments tif11-R13P (FZY010, FZY011) and WT (PMY337, PMY338) yeast strains growing exponentially in SC medium at 30°C were harvested by vacuum filtration at room temperature, without prior treatment with cycloheximide, and quick-frozen in liquid nitrogen. .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system.

    Electrophoresis:

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: .. A universal miRNA cloning linker (NEB # S1315S) was ligated to the 3′-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242 L) in the presence of PEG 8000 (2.5% w/v), DMSO and SUPERase-In at 37 °C for 2.5 h. The ligated products were resolved by electrophoresis on 15% TBE-Urea gel and the appropriate size fragments eluted from the gel. .. The linker-ligated RNA recovered from RPFs was directly subjected to reverse transcription, while that extracted from fragmented total RNA samples was used as input for the Ribozero reaction (Illumina Ribo-Zero Gold rRNA Removal Kit -Yeast) to remove rRNAs, and subsequently subjected to reverse transcription.

    Incubation:

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: .. Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds. .. The denatured sample was then incubated with 1 uL T4 RNA Ligase 2, truncated (NEB, catalog no. M0242S), 2 uL 10× buffer, 1 uL SUPERase In, and 6 uL 50% PEG 8000 for 2.5 hours at room temperature.

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: A universal miRNA cloning linker (NEB # S1315S) was ligated to the 3′-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242 L) in the presence of PEG 8000 (2.5% w/v), DMSO and SUPERase-In at 37 °C for 2.5 h. The ligated products were resolved by electrophoresis on 15% TBE-Urea gel and the appropriate size fragments eluted from the gel. .. For reverse transcription, 10 μl RNA (dissolved in 10 mM Tris pH 8.0) from the previous reaction was mixed with 2 μl of 1.25 μM reverse transcription primer [5′-(Phos) AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC (SpC18) CACTA (SpC18) TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG], denatured at 80 °C for 2 min and incubated on ice.

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (Cat#S1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min. .. Reactions to ligate the linker to the RNA were prepared using truncated T4 RNA ligase 2 (NEB) and were incubated for 2 hours at 24°C with gentle agitation.

    Article Title: Heterogeneous ribosomes preferentially translate distinct subpools of mRNAs genome-wide
    Article Snippet: .. 3′ dephosphorylated RNAs were then incubated with 1.5 μL of 0.5 μg/μL Universal miRNA Cloning Linker (NEB, S1315S) and 1 μL T4 RNA Ligase 2, truncated (NEB, M0242S) in 20 μL of total volume for 2.5 hours at room temperature. .. Samples were then purified by acid-phenol:chloform extraction and isopropanol precipitation.

    Luciferase:

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: Paragraph title: In vitro capping and polyadenylation of luciferase mRNA ... Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (Cat#S1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min.

    RNA Binding Assay:

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: The fragmented total RNA and ribosome protected fragments were then purified using Zymo RNA Clean & Concentrator 5 columns using a protocol in which 100 uL sample, 200 uL RNA binding buffer, and 450 uL 100% ethanol were used for binding (see above). .. Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds.

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: Paragraph title: Measurement of RNA Binding Affinity Distributions by HTS-EQ. ... Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Gel Purification:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences. .. The adapter-ligated RNA constructs were then reverse-transcribed using SuperScript III Reverse Transcriptase (ThermoFisher) and the following reverse transcription primer: 5′-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3′.

    Transfection:

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: Polyadenylation reactions were purified by LiCl-precipitation before being used for transfection. .. Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (Cat#S1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min.

    Ligation:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Protease Inhibitor:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: Vented T175 tissue culture flasks (Sarstedt, cat. no. 83.3912.002) 100 mm tissue culture dishes (Sarstedt, cat. no. 83.3902) Trypan Blue Solution, 0.4% (ThermoFisher Scientific, cat. no. 15250–061) Conical 15 ml polypropylene centrifuge tubes (Sarstedt, cat. no. 62.554.002) Nuclease-free 1.7 ml microcentrifuge tubes (GeneMates, cat. no. C-3262–1) MicroAmp Reaction Tube with Cap, 0.2 mL, autoclaved (ThermoFisher Scientific, cat. no. N8010612) Phosphate-buffered saline (PBS, ThermoFisher Scientific, cat. no. 10010–0023) TRIzol reagent (Life Technologies, cat. no. 15596–026) Chloroform (Sigma-Aldrich, cat. no. C2432) Isopropanol (Sigma-Aldrich, cat. no. I9516) UltraPure 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (ThermoFisher Scientific, cat. no. 15593–031) GlycoBlue Coprecipitant (15mg/ml, Ambion, cat. no. AM9516) DEPC-treated ultrapure water (K.D Medical, cat. no. RGF-3050) RIPA buffer (50 mM Tris-HCl, 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, and 0.1% SDS, pH 7.4, Boston BioProducts, cat. no. BP-115) IP buffer (50 mM HEPES pH 7.5, 200 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10% glycerol, 0.1% NP-40) prepared in DEPC-water Complete EDTA-free mini protease inhibitor cocktail tablets (Roche, cat. no. 04 693 159 001). .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Sedimentation:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: For ribosome footprint library preparation, 30 A260 units of extract were treated with 450U of RNAse I (Ambion, #AM2295) for 1 hr at 25°C on a Thermomixer at 700 rpm, and 80S ribosomes were purified by sedimentation through a sucrose density gradient as described ( ). .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system.

    DNA Sequencing:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Sequencing:

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. The cDNA was synthesized using a reverse primer (5′-ATT GAT GGT GCC TAC AG-3′) complementary to the adaptor sequence and MMLV reverse transcriptase (Invitrogen).

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: Paragraph title: Sequencing library construction ... A universal miRNA cloning linker (NEB # S1315S) was ligated to the 3′-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242 L) in the presence of PEG 8000 (2.5% w/v), DMSO and SUPERase-In at 37 °C for 2.5 h. The ligated products were resolved by electrophoresis on 15% TBE-Urea gel and the appropriate size fragments eluted from the gel.

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: Paragraph title: Generation, processing, and analysis of sequence libraries of ribosome protected footprints or total mRNA fragments ... Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Gel purified cDNAs were circularized by Circligase (Epicentra, CL4111K) and rRNA sequence were subtracted using biotinylated oligos .

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: After separating the UP1–SL3ESS3R complex and the substrate, the unbound substrates were collected for high-throughput sequencing. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Affinity Purification:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: A custom polyclonal anti-ORF57 antibody prepared by rabbit immunization with KLH-linked synthetic peptide corresponding to aa 119–132 of ORF57 protein and followed by on-column affinity purification ( ; ) is used for this protocol, together with rabbit IgG isotype (ThermoFisher Scientific, cat. no. 02–6102) used in parallel as an antibody negative control. .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Recombinant:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    RNA Sequencing Assay:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: 28–31 nt RPFs and 30–50 nt fragmented RNAs were excised from the gel for Ribo-Seq and RNA-Seq respectively. .. RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S).

    Mutagenesis:

    Article Title: The ribosome profiling strategy for monitoring translation in vivo by deep sequencing of ribosome-protected mRNA fragments
    Article Snippet: [CRITICAL -- Avoid the 3′ phosphatase minus mutant, cat. no. .. Supplied with PEG 8000 50% w/v and 10x T4 Rnl2 buffer Preadenylated and 3′-blocked linker: Any of miRNA Cloning Linker 1/5rApp/CTGTAGGCACCATCAAT/3ddC/ (IDT), Universal miRNA Cloning Linker 5′ rAppCTGTAGGCACCATCAAT–NH2 3′ (New England Biolabs, cat. no. S1315S), or AIR adenylated linker A (bioo, cat. no. 510205).

    Isolation:

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    RNA Extraction:

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: Gel slices were crushed and extracted at room temperature overnight in 400 uL RNA extraction buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.25% SDS). .. Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds.

    Article Title: Heterogeneous ribosomes preferentially translate distinct subpools of mRNAs genome-wide
    Article Snippet: Gel slices were crushed with a razor blade and incubated overnight at room temperature in 400 μL of RNA extraction buffer (300 mM NaOAc pH 5.5, 1 mM EDTA, 0.25% SDS). .. 3′ dephosphorylated RNAs were then incubated with 1.5 μL of 0.5 μg/μL Universal miRNA Cloning Linker (NEB, S1315S) and 1 μL T4 RNA Ligase 2, truncated (NEB, M0242S) in 20 μL of total volume for 2.5 hours at room temperature.

    Microscopy:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Purification:

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: The fragmented total RNA and ribosome protected fragments were then purified using Zymo RNA Clean & Concentrator 5 columns using a protocol in which 100 uL sample, 200 uL RNA binding buffer, and 450 uL 100% ethanol were used for binding (see above). .. Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds.

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Hcr1/eIF3j Is a 60S Ribosomal Subunit Recycling Accessory Factor In Vivo
    Article Snippet: .. The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L) and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L). .. The ligated RNA footprints were size selected on a 10% TBE-Urea gel, and reverse transcribed using the RT primer NI-NI-9 ( ) and Superscript III (Invitrogen; 18080044).

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: Polyadenylation reactions were purified by LiCl-precipitation before being used for transfection. .. Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (Cat#S1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min.

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: Ribosome-protected mRNA fragments (footprints) were purified using a miRNeasy Mini kit (Qiagen) per the vendor's instructions. .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system.

    Article Title: Heterogeneous ribosomes preferentially translate distinct subpools of mRNAs genome-wide
    Article Snippet: 3′ dephosphorylated RNAs were then incubated with 1.5 μL of 0.5 μg/μL Universal miRNA Cloning Linker (NEB, S1315S) and 1 μL T4 RNA Ligase 2, truncated (NEB, M0242S) in 20 μL of total volume for 2.5 hours at room temperature. .. Samples were then purified by acid-phenol:chloform extraction and isopropanol precipitation.

    Article Title: Pervasive translational regulation of the cell signalling circuitry underlies mammalian development
    Article Snippet: RNAs were eluted, dephosphorylated by PNK (NEB, M0201S), and ligated to the miRNA Cloning linker (NEB, S1315S) by T4 RNA Ligase2 truncated K227Q (NEB, M0242S). .. Ligated RNA was gel purified and reverse transcribed by Superscript III (Invitrogen, 18080).

    Article Title: Tma64 (eIF2D), Tma20 (MCT-1), and Tma22 (DENR) recycle post-termination 40S subunits in vivo
    Article Snippet: .. The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L), and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L). .. The ligated RNA footprints were size selected on a 10% TBE-Urea gel, and reverse transcribed using Superscript III (Invitrogen; 18080044).

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: The UP1 protein was expressed and purified as previously described ( ). .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Polymerase Chain Reaction:

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. Then the 5′ cDNA end was PCR amplified using forward primer SP4FW (5′-GTG AAG GGT GAC TGT AGT CCT GAG C-3′; nt 5227 to 5251) and the reverse primer.

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: For assessment of poly(A) tail lengths, a PCR-based assay was performed. .. Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (Cat#S1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min.

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Selection:

    Article Title: Temperature-dependent regulation of upstream open reading frame translation in S. cerevisiae
    Article Snippet: Following the size selection, the RNA was gel extracted and was dephosphorylated using polynucleotide kinase (NEB #M0201S). .. A universal miRNA cloning linker (NEB # S1315S) was ligated to the 3′-ends of the RNA using T4 RNA Ligase 2 (NEB #M0242 L) in the presence of PEG 8000 (2.5% w/v), DMSO and SUPERase-In at 37 °C for 2.5 h. The ligated products were resolved by electrophoresis on 15% TBE-Urea gel and the appropriate size fragments eluted from the gel.

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    De-Phosphorylation Assay:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Lysis:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: The tablet could be also directly dissolved in 10 ml of lysis buffer. .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: Cells were lysed in a freezer mill with lysis buffer (20 mM Tris [pH 8.0], 140 mM KCl, 1.5 mM MgCl2 , 1% Triton, 500 µg/mL cycloheximide). .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system.

    Article Title: Tma64 (eIF2D), Tma20 (MCT-1), and Tma22 (DENR) recycle post-termination 40S subunits in vivo
    Article Snippet: Cells were lysed in a freezer mill in the presence of lysis buffer (20 mM Tris [pH8], 140 mM KCl, 1.5 mM MgCl2 , 1% Triton X-100) containing 0.1 mg/ml CHX. .. The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L), and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L).

    cDNA Library Assay:

    Article Title: eIF1A residues implicated in cancer stabilize translation preinitiation complexes and favor suboptimal initiation sites in yeast
    Article Snippet: .. Following size selection and dephosphorylation, a Universal miRNA cloning linker (New England Biolabs, #S1315S) was ligated to the 3’ ends of footprints, followed by reverse transcription, circular ligation, rRNA subtraction, PCR amplification of the cDNA library, and DNA sequencing with an Illumina HiSeq system. .. For RNA-seq library preparation, total RNA was purified using miRNeasy Mini kit (Qiagen) from aliquots of the same extracts used for footprint library preparation, 5 µg total RNA was randomly fragmented at 70°C for 8 min in fragmentation reagent (Ambion #AM8740).

    Agarose Gel Electrophoresis:

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. PCR fragments were electrophoresed on a 1.5% agarose gel.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: Total cellular RNA was isolated from a Δ rnr Δ rimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The products were resolved on an agarose gel, eluted and sequenced to determine the 3′ ends of the different rRNA fragments.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The products were resolved on an agarose gel, eluted and sequenced to determine the 3′ ends of the different rRNA fragments.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: .. Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (CatS1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min. .. Reactions to ligate the linker to the RNA were prepared using truncated T4 RNA ligase 2 (NEB) and were incubated for 2 hours at 24°C with gentle agitation.

    Hybridization:

    Article Title: Hcr1/eIF3j Is a 60S Ribosomal Subunit Recycling Accessory Factor In Vivo
    Article Snippet: The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L) and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L). .. Ribosomal RNA footprints were removed from the circularized libraries by oligonucleotide subtraction hybridization using Dynabeads MyOne Streptavidin C1 (Invitrogen; 65001) and a pool of DNA oligonucleotides that are the reverse complement of common rRNA contaminants ( ).

    Article Title: Tma64 (eIF2D), Tma20 (MCT-1), and Tma22 (DENR) recycle post-termination 40S subunits in vivo
    Article Snippet: The purified RNA fragments were dephosphorylated using PNK (NEB; M0201L), and ligated to universal miRNA cloning linker (NEB; S1315S) using truncated T4 RNA ligase 2 (NEB; M0242L). .. Ribosomal RNA footprints were removed from the circularized libraries by oligonucleotide subtraction hybridization.

    Negative Control:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: A custom polyclonal anti-ORF57 antibody prepared by rabbit immunization with KLH-linked synthetic peptide corresponding to aa 119–132 of ORF57 protein and followed by on-column affinity purification ( ; ) is used for this protocol, together with rabbit IgG isotype (ThermoFisher Scientific, cat. no. 02–6102) used in parallel as an antibody negative control. .. Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence.

    Binding Assay:

    Article Title: The mammalian ribo-interactome reveals ribosome functional diversity and heterogeneity
    Article Snippet: The fragmented total RNA and ribosome protected fragments were then purified using Zymo RNA Clean & Concentrator 5 columns using a protocol in which 100 uL sample, 200 uL RNA binding buffer, and 450 uL 100% ethanol were used for binding (see above). .. Samples were eluted with 8.5 uL nuclease free water and incubated with 1.5 uL of 0.5 ug/uL Universal miRNA Cloning Linker (NEB, catalog no. S1315S) and denatured at 80°C for 90 seconds.

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: For the binding assay, 1 μM SL3ESS3R was mixed with increasing concentrations of UP1 to make the molar ratios 0, 0.25, 0.5, and 0.75. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Sample Prep:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: The sample preparation steps were similar to those sample preparation steps published previously ( ). .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    In Vitro:

    Article Title: Acetylation of cytidine in messenger RNA promotes translation efficiency
    Article Snippet: .. Briefly, 100 ng of in vitro transcribed RNA was heated with 0.2 pmols of a preadenylated linker (Cat#S1315S, NEB) at 80°C for 2 min and then was cooled to room temperature for 5 min. .. Reactions to ligate the linker to the RNA were prepared using truncated T4 RNA ligase 2 (NEB) and were incubated for 2 hours at 24°C with gentle agitation.

    CTG Assay:

    Article Title: Parvovirus Expresses a Small Noncoding RNA That Plays an Essential Role in Virus Replication
    Article Snippet: .. A 5′-adenylated and 3′-blocked oligodeoxyribonucleotide microRNA (miRNA) cloning adaptor (5′ rApp CTG TAG GCA CCA TCA AT–NH2 3′; S1315; NEB) was ligated to the 3′ OH of the noncoding RNA using T4 RNA ligase 2 (M0351; NEB) by following the manufacturer's instructions. .. The cDNA was synthesized using a reverse primer (5′-ATT GAT GGT GCC TAC AG-3′) complementary to the adaptor sequence and MMLV reverse transcriptase (Invitrogen).

    High Throughput Screening Assay:

    Article Title: Rules of RNA specificity of hnRNP A1 revealed by global and quantitative analysis of its affinity distribution
    Article Snippet: After separating the UP1–SL3ESS3R complex and the substrate, the unbound substrates were collected for high-throughput sequencing. .. Following separation of unbound and UP1 bound SL3ESS3 variants, the unbound RNAs were ligated to a 17-nt adapter, 5′-rAppCTGTAGGCACCATCAAT-NH2-3′ (NEB S1315S; New England Biolabs) by T4 RNA ligase 2 (NEB M0242S; New England Biolabs), and gel purification was used to remove the unreacted sequences.

    Staining:

    Article Title: CLIP-seq to identify KSHV ORF57-binding RNA in host B cells
    Article Snippet: Protein A beads (EMD Millipore, cat. no. 16–125) RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, ThermoFisher Scientific, cat. no. EN0551) Recombinant Shrimp Alkaline Phosphatase (rSAP, 1000U/ml, New England Biolabs, cat. no. M0371S) Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049) Proteinase K buffer (1× IP buffer supplemented with 1% SDS) Phase Lock Gel Light, 1.5 ml tubes (VWR, cat. no. 10052–164) 3M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351-035-721EA) 70–75% (v/v) ethanol 100% (v/v) ethanol Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067–1513) Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S) 50% PEG8000 (New England BioLabs, from the T4 RNA Ligase II kit) RNaseOUT (ThermoFisher Scientific, cat. no. 10777–019) T4 RNA Ligase 2, truncated KQ (200,000 units/ml, New England Biolabs, cat. no. M0373L) Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168) Agencourt AMPure XP - PCR Purification beads (Beckman Coulter, cat. no. ) dNTP Mix, 10 mM each (Bioline, cat. no. BIO-39044) SuperScript III First-Strand Synthesis System (ThermoFisher Scientific, cat. no. 18080–051) CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S) Reverse transcription primer (IDT custom synthesis) [5’-(Phos)-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC-(SpC18)-CACTCA-(SpC18)-TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG-3’] riboPCR_F primer (5’-AATGATACGGCGACCACCGAGATCTACAC-3’, IDT custom synthesis) Indexed primers (5’-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA-CGTGTGCTCTTCCG-3’) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. .. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis) DNA Clean & Concentrator-5 Kit (Zymo Research, cat. no. D4003) 1N NaOH 5M NaCl 5× SSC (0.75M NaCl, 0.075M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA]) Hyb buffer (5× SSC + 0.05% Tween-20) E-Gel EX Agarose Gels, 2% (ThermoFisher Scientific, cat. no. G4020–02) Novex® TBE Gels, 10%, 12 well (ThermoFisher Scientific, cat. no. EC62752BOX) 6 × DNA loading buffer (ThermoFisher Scientific, cat. no. R0611) TrackIt™ 10 bp DNA Ladder (ThermoFisher Scientific, cat. no. 10488–019) SYBR® Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO, ThermoFisher Scientific, cat. no. S-11494) Costar Spin-X Centrifuge Tube Filters (Cole-Parmer, cat. no. WU-01937–38) Gel elution buffer (0.3 M sodium acetate pH 5.2, 0.1% SDS) Herracell CO2 incubator (ThermoFisher Scientific) Universal 320R centrifuge (Hettich) Microcentrifuge 5424R (Eppendorf) Thermomixer R (Eppendorf) IX70 inverted phase-contrast microscope (Olympus) VortexGenie2 (Scientific Industries) Sonic Dismembrator (Model 100, ThermoFisher Scientific) UV Crosslinker (VWR) Qubit Fluorometer (ThermoFisher Scientific) Magnetic stand (MPC-S, ThermoFisher Scientific) Agilent Bioanalyzer 2100 (Agilent Technologies) Veriti 96-Well Thermal Cycler (ThermoFisher Scientific) MiSeq and HiSeq 2500 Ultra-High-Throughput Sequencing Systems (Illumina)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs oligodeoxyribonucleotide microrna
    Oligodeoxyribonucleotide Microrna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/oligodeoxyribonucleotide microrna/product/New England Biolabs
    Average 90 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    oligodeoxyribonucleotide microrna - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results