Structured Review

Thermo Fisher trizol
Detection performance of mock leukocyte samples for EQA panels. A, <t>RNA</t> yields extracted by different methods. Error bars represent standard deviation. B, RNA yields extracted by <t>TRIzol</t> between EQA samples. C, Control gene copy number of each mock leukocyte sample. D, Differences in the slope of RT‐qPCR standard curve between different laboratory groups. 1, correct detection group; 2, quantitative incorrect group; 3, only qualitative incorrect group. Error bars represent standard deviation. ** P
Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 17271 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/trizol/product/Thermo Fisher
Average 99 stars, based on 17271 article reviews
Price from $9.99 to $1999.99
trizol - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary. External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary"

Article Title: External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary. External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary

Journal: Journal of Clinical Laboratory Analysis

doi: 10.1002/jcla.22894

Detection performance of mock leukocyte samples for EQA panels. A, RNA yields extracted by different methods. Error bars represent standard deviation. B, RNA yields extracted by TRIzol between EQA samples. C, Control gene copy number of each mock leukocyte sample. D, Differences in the slope of RT‐qPCR standard curve between different laboratory groups. 1, correct detection group; 2, quantitative incorrect group; 3, only qualitative incorrect group. Error bars represent standard deviation. ** P
Figure Legend Snippet: Detection performance of mock leukocyte samples for EQA panels. A, RNA yields extracted by different methods. Error bars represent standard deviation. B, RNA yields extracted by TRIzol between EQA samples. C, Control gene copy number of each mock leukocyte sample. D, Differences in the slope of RT‐qPCR standard curve between different laboratory groups. 1, correct detection group; 2, quantitative incorrect group; 3, only qualitative incorrect group. Error bars represent standard deviation. ** P

Techniques Used: Standard Deviation, Quantitative RT-PCR

2) Product Images from "Obesity induces pro-inflammatory B cells and impairs B cell function in old mice"

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice

Journal: Mechanisms of ageing and development

doi: 10.1016/j.mad.2017.01.004

The adipocytes secrete chemokines which may recruit B cells to the VAT. A. Adipocytes were isolated from the VAT, sonicated for cell disruption in the presence of TRIzol to separate the soluble fraction (used for RNA isolation) from lipids and cell debris. Results show qPCR values (2 − ΔΔ Ct ) of CXCL10, CCL2, CCL5 RNA expression. Mean comparisons between groups were performed by Student's t -test (two-tailed). B. VAT B cells were isolated from the SVF and resuspended in TRIzol. Results show qPCR values (2 − ΔΔ Ct ) of CXCR2, CCR2, CCR3 RNA expression. Results in B are from those 3 mice among the 6 in A from which we had enough B cells. Mean comparisons between groups were performed by Student's t-test (two-tailed). *p
Figure Legend Snippet: The adipocytes secrete chemokines which may recruit B cells to the VAT. A. Adipocytes were isolated from the VAT, sonicated for cell disruption in the presence of TRIzol to separate the soluble fraction (used for RNA isolation) from lipids and cell debris. Results show qPCR values (2 − ΔΔ Ct ) of CXCL10, CCL2, CCL5 RNA expression. Mean comparisons between groups were performed by Student's t -test (two-tailed). B. VAT B cells were isolated from the SVF and resuspended in TRIzol. Results show qPCR values (2 − ΔΔ Ct ) of CXCR2, CCR2, CCR3 RNA expression. Results in B are from those 3 mice among the 6 in A from which we had enough B cells. Mean comparisons between groups were performed by Student's t-test (two-tailed). *p

Techniques Used: Isolation, Sonication, Real-time Polymerase Chain Reaction, RNA Expression, Two Tailed Test, Mouse Assay

3) Product Images from "A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels"

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1008401

A posterior program of gene expression is acutely down-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 52 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Significant down-regulation of gene expression begins at day 1 post- β-catenin-1 RNAi. Mean z-score of gene expression counts for 52 genes in 1(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D.**p
Figure Legend Snippet: A posterior program of gene expression is acutely down-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 52 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Significant down-regulation of gene expression begins at day 1 post- β-catenin-1 RNAi. Mean z-score of gene expression counts for 52 genes in 1(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D.**p

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay

A posterior program of gene expression is down-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 66 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post first RNAi injection. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Left: Validation of β-catenin-1 RNAi-dependent down-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Right: Genes down-regulated after β-catenin-1 RNAi are expressed in the posterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. Scale bars, 200μm.
Figure Legend Snippet: A posterior program of gene expression is down-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 66 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post first RNAi injection. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Left: Validation of β-catenin-1 RNAi-dependent down-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Right: Genes down-regulated after β-catenin-1 RNAi are expressed in the posterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. Scale bars, 200μm.

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay, Injection, Fluorescence In Situ Hybridization

An anterior program of gene expression is acutely up-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) 56 genes are up-regulated early after β-catenin-1 RNAi in planarian tails. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Up-regulation of gene expression begins by day 2 post- β-catenin-1 RNAi. Mean z-score of gene expression counts is plotted for 56 genes up-regulated in 2(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D. *p
Figure Legend Snippet: An anterior program of gene expression is acutely up-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) 56 genes are up-regulated early after β-catenin-1 RNAi in planarian tails. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Up-regulation of gene expression begins by day 2 post- β-catenin-1 RNAi. Mean z-score of gene expression counts is plotted for 56 genes up-regulated in 2(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D. *p

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay

An anterior program of gene expression is up-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) 92 genes are up-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as a z-score for indicated time-points post-RNAi initiation. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Top: Validation of β-catenin-1 RNAi dependent up-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Bottom: Genes up-regulated after β-catenin-1 RNAi are expressed in the anterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. All scale bars, 200μm.
Figure Legend Snippet: An anterior program of gene expression is up-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) 92 genes are up-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as a z-score for indicated time-points post-RNAi initiation. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Top: Validation of β-catenin-1 RNAi dependent up-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Bottom: Genes up-regulated after β-catenin-1 RNAi are expressed in the anterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. All scale bars, 200μm.

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay, Injection, Fluorescence In Situ Hybridization

4) Product Images from "Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord"

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord

Journal: Neuroscience

doi: 10.1016/j.neuroscience.2018.09.034

Schematic illustration representing the spinal cord slice procedure used to collect tissues for analysis. Following complete transection at cord level T8-T9, animals were allowed to recover from injury for a period of at least 28 days. Animals were sacrificed, the cord below the injury removed, and embedded for slicing. Longitudinal slices were made from the ventral surface of the cord and progressed in 300 μm increments. Slices of gray matter that contained concentrations of ChAT:GFP labeling were collected as motor neuron enriched slices (MNSlice). After removal of GFP containing neurons, the next most 300 μm dorsal slice was collected as interneuron enriched (INSlice). These slices were immediately placed in TriZol reagent and homogenized for total RNA extraction.
Figure Legend Snippet: Schematic illustration representing the spinal cord slice procedure used to collect tissues for analysis. Following complete transection at cord level T8-T9, animals were allowed to recover from injury for a period of at least 28 days. Animals were sacrificed, the cord below the injury removed, and embedded for slicing. Longitudinal slices were made from the ventral surface of the cord and progressed in 300 μm increments. Slices of gray matter that contained concentrations of ChAT:GFP labeling were collected as motor neuron enriched slices (MNSlice). After removal of GFP containing neurons, the next most 300 μm dorsal slice was collected as interneuron enriched (INSlice). These slices were immediately placed in TriZol reagent and homogenized for total RNA extraction.

Techniques Used: Labeling, RNA Extraction

5) Product Images from "A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels"

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1008401

A posterior program of gene expression is acutely down-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 52 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Significant down-regulation of gene expression begins at day 1 post- β-catenin-1 RNAi. Mean z-score of gene expression counts for 52 genes in 1(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D.**p
Figure Legend Snippet: A posterior program of gene expression is acutely down-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 52 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Significant down-regulation of gene expression begins at day 1 post- β-catenin-1 RNAi. Mean z-score of gene expression counts for 52 genes in 1(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D.**p

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay

A posterior program of gene expression is down-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 66 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post first RNAi injection. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Left: Validation of β-catenin-1 RNAi-dependent down-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Right: Genes down-regulated after β-catenin-1 RNAi are expressed in the posterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. Scale bars, 200μm.
Figure Legend Snippet: A posterior program of gene expression is down-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) A cluster of 66 genes is down-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as z-scores for indicated timepoints post first RNAi injection. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Left: Validation of β-catenin-1 RNAi-dependent down-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Right: Genes down-regulated after β-catenin-1 RNAi are expressed in the posterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. Scale bars, 200μm.

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay, Injection, Fluorescence In Situ Hybridization

An anterior program of gene expression is acutely up-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) 56 genes are up-regulated early after β-catenin-1 RNAi in planarian tails. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Up-regulation of gene expression begins by day 2 post- β-catenin-1 RNAi. Mean z-score of gene expression counts is plotted for 56 genes up-regulated in 2(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D. *p
Figure Legend Snippet: An anterior program of gene expression is acutely up-regulated after β-catenin-1 inhibition in planarians. (A) Experimental scheme for RNA sequencing. Schmidtea mediterranea adults were fed once with control or β-catenin-1 dsRNA. Tails were collected in trizol 1, 2, 4, and 6 days after feeding for RNA sequencing. Red box indicates tissue collected. (B) 56 genes are up-regulated early after β-catenin-1 RNAi in planarian tails. Heatmap displaying gene expression counts as z-scores for indicated timepoints post-RNAi feeding. *indicates annotation by best BLAST hit. Gene list provided in S2 Table . (C) Up-regulation of gene expression begins by day 2 post- β-catenin-1 RNAi. Mean z-score of gene expression counts is plotted for 56 genes up-regulated in 2(B) at indicated time points post-RNAi feeding. Data is plotted as mean ± S.D. *p

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay

An anterior program of gene expression is up-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) 92 genes are up-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as a z-score for indicated time-points post-RNAi initiation. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Top: Validation of β-catenin-1 RNAi dependent up-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Bottom: Genes up-regulated after β-catenin-1 RNAi are expressed in the anterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. All scale bars, 200μm.
Figure Legend Snippet: An anterior program of gene expression is up-regulated after β-catenin-1 inhibition in acoels. (A) Experimental scheme for RNA sequencing. Hofstenia miamia were injected once a day for three consecutive days with control or β-catenin-1 dsRNA. Tails were collected in trizol at 3, 7, and 14 days after the first injection for RNA sequencing. Red box indicates tissue collected. (B) 92 genes are up-regulated early after β-catenin-1 RNAi. Heatmap displaying gene expression counts as a z-score for indicated time-points post-RNAi initiation. *indicates annotation by best BLAST hit. Gene list provided in S5 Table . (C) Top: Validation of β-catenin-1 RNAi dependent up-regulation of gene expression. FISH for indicated transcripts at day 9 post-RNAi initiation in homeostasis. Images are presented in grayscale with color inverted. Bottom: Genes up-regulated after β-catenin-1 RNAi are expressed in the anterior. FISH for indicated transcripts in two week old hatchlings. Transcript ID provided in parentheses. Images are presented in grayscale with color inverted. All scale bars, 200μm.

Techniques Used: Expressing, Inhibition, RNA Sequencing Assay, Injection, Fluorescence In Situ Hybridization

6) Product Images from "Stem cell transplantation impairs dendritic cell trafficking and herpesvirus immunity"

Article Title: Stem cell transplantation impairs dendritic cell trafficking and herpesvirus immunity

Journal: JCI Insight

doi: 10.1172/jci.insight.130210

APCs from lungs of BMT mice are potent in priming both Th1 and Th17 responses in vitro. ( A ) Single-cell suspensions were prepared by collagenase digestion of whole lungs of non-BMT ( n = 5) or BMT ( n = 5) mice at 7 dpi with MHV-68. Cells were then stimulated with PMA and ionomycin for 4 hours before antibody staining. Percent of CD4 + T cells (i.e., CD45 + CD90.2 + CD3 + CD4 + ) that express IFN-γ (Th1 cells), and percent of CD4 + T cells that express IL-17A (Th17 cells) were determined by flow cytometry. ( B and C ) APCs enriched by CD11c + microbeads and pooled from lung Single-cell suspensions of 5 BMT or non-BMT mice at 3 dpi were cocultured with pooled CD4 + T cells from 10 BMT mouse lungs at 10 dpi at a 1:10 ratio in the presence of 0.125 MOI of MHV-68 ( n = 5 each). ( B ) The concentration of IFN-γ or IL-17A in the supernatant of coculture at 4 days was determined by ELISA (mean ± SEM, n = 5). ( C ) Cocultured cells were pelleted at 4 days after coculture, and total RNA was isolated by TRIzol. The expression of a pro-Th1 cytokine ( IL12A ) or pro-Th17 cytokines ( IL6 and IL23A ) were determined by real-time RT-PCR (mean ± SEM, n = 5). Symbols represent individual data points from unique mice. * P
Figure Legend Snippet: APCs from lungs of BMT mice are potent in priming both Th1 and Th17 responses in vitro. ( A ) Single-cell suspensions were prepared by collagenase digestion of whole lungs of non-BMT ( n = 5) or BMT ( n = 5) mice at 7 dpi with MHV-68. Cells were then stimulated with PMA and ionomycin for 4 hours before antibody staining. Percent of CD4 + T cells (i.e., CD45 + CD90.2 + CD3 + CD4 + ) that express IFN-γ (Th1 cells), and percent of CD4 + T cells that express IL-17A (Th17 cells) were determined by flow cytometry. ( B and C ) APCs enriched by CD11c + microbeads and pooled from lung Single-cell suspensions of 5 BMT or non-BMT mice at 3 dpi were cocultured with pooled CD4 + T cells from 10 BMT mouse lungs at 10 dpi at a 1:10 ratio in the presence of 0.125 MOI of MHV-68 ( n = 5 each). ( B ) The concentration of IFN-γ or IL-17A in the supernatant of coculture at 4 days was determined by ELISA (mean ± SEM, n = 5). ( C ) Cocultured cells were pelleted at 4 days after coculture, and total RNA was isolated by TRIzol. The expression of a pro-Th1 cytokine ( IL12A ) or pro-Th17 cytokines ( IL6 and IL23A ) were determined by real-time RT-PCR (mean ± SEM, n = 5). Symbols represent individual data points from unique mice. * P

Techniques Used: Mouse Assay, In Vitro, Staining, Flow Cytometry, Cytometry, Concentration Assay, Enzyme-linked Immunosorbent Assay, Isolation, Expressing, Quantitative RT-PCR

7) Product Images from "Attenuation of Astroglial Reactivity by Interleukin-10"

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10

Journal: The Journal of Neuroscience

doi: 10.1523/JNEUROSCI.16-09-02945.1996

Semiquantitative RT-PCR analyses for TNF mRNA in the adult mouse brain. Brain tissue surrounding the corticectomy site was dissected out (∼20 mg wet weight), placed in Trizol (Gibco), and total RNA extracted as per the manufacturer’s instructions. RNA samples were then subjected to RT-PCR as described in the text. A and B demonstrate that TNFα signals increase rapidly after injury; this increase can be attenuated by IL-10. p values refer to Student’s t test comparisons between IL-10 and PBS controls. In A and B , each bar is mean ± SEM of four or five samples. Values are in PhosphorImager units; the difference in the PhosphorImager scale for A , B , and C is attributable to the different background in each case, each panel representing a separate gel. In C , the linearity of the PCR reaction at 26 cycles is confirmed using ANA-1 cells, a mouse macrophage cell line. In D , the PCR reaction products are shown using samples collected at 24 hr after injury. The 701 bp TNFα cDNA product is indicated by the arrow ; + lanes at each end of the gel represent ANA-1 samples, which were used as positive controls for RT-PCR.
Figure Legend Snippet: Semiquantitative RT-PCR analyses for TNF mRNA in the adult mouse brain. Brain tissue surrounding the corticectomy site was dissected out (∼20 mg wet weight), placed in Trizol (Gibco), and total RNA extracted as per the manufacturer’s instructions. RNA samples were then subjected to RT-PCR as described in the text. A and B demonstrate that TNFα signals increase rapidly after injury; this increase can be attenuated by IL-10. p values refer to Student’s t test comparisons between IL-10 and PBS controls. In A and B , each bar is mean ± SEM of four or five samples. Values are in PhosphorImager units; the difference in the PhosphorImager scale for A , B , and C is attributable to the different background in each case, each panel representing a separate gel. In C , the linearity of the PCR reaction at 26 cycles is confirmed using ANA-1 cells, a mouse macrophage cell line. In D , the PCR reaction products are shown using samples collected at 24 hr after injury. The 701 bp TNFα cDNA product is indicated by the arrow ; + lanes at each end of the gel represent ANA-1 samples, which were used as positive controls for RT-PCR.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

Related Articles

Amplification:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). .. For amplification of the transcripts corresponding to Borrelia flaB gene, the following PCR primer set was utilized: flaBF-5′ttcaatcaggtaacggcaca 3′ and flaBR-5′gacgcttgagaccctgaaag 3′.

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Article Snippet: Total RNA was isolated using Trizol (Gibco, Grand Island, NY) (Balasingam et al., unpublished observations) from samples resected from around the corticectomy site (∼20 mg wet weight). .. One microgram RNA was reverse-transcribed and amplified in a single-step process ( ) with the following modifications: 200 μ m deoxynucleoside triphosphates (dNTPs), 1 μ m primers, 2 m m MgCl2 , 2 U of AMV RT (Gibco), 1 U of Taq polymerase (Gibco), 33 U RNA Guard (Pharmacia Biotech, Piscataway, NJ), 1× PCR buffer (Gibco), and 0.5 μCi/ml [α-32 P]deoxycytidine triphosphate (ICN Biochemicals, Costa Mesa, CA) in a total reaction volume of 50 μl.

Synthesized:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). .. Fed larvae were pooled in groups of three ticks, ground under liquid nitrogen and suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). cDNA was synthesized using the iScript RT-PCR kit (BIORAD, CA) and analyzed by PCR for the expression of the following tick genes: salp25D , tick actin, salp9pac, salp25B, salp16, lrp (encoding for the predicted salivary protein ) and trx (encoding for the predicted salivary protein ) genes using the primers listed: 25DF-5′cctttccccaacttcacc3′ and 25DR-5′gtccatggttgttcggag3′; tick actin F-5′ggcgacgtagcag 3′ and tick actin R-5′ggtatcgtgctcgactc 3′; and salp9pacF-5′catggggttgactgag 3′ and salp9pacR 5′tacctttattaag; salp25BF-5′cctgaagaagacc 3′ and salp25BR 5′ gtgttgcaatattc 3′; salp16F-5′ ctgaagttctttattctcttc 3′ and salp16R 5gcagggtccttcttcggg 3′; lrpF- 5′cccctgcacaag 3′ and lrpR-5′ gagatcagggcatcg 3′; and trxpF-5′ gttcggaaagcaag 3′ and trxpR-5′ gttccaacggatgtcg 3′.

Article Title: Increased intracellular pH is necessary for adult epithelial and embryonic stem cell differentiation
Article Snippet: Quantitative RT-PCR experiments RNA was extracted from mESCs maintained in the absence or presence of LIF2i for 72 h using TRIzol (Ambion) according to the manufacturer’s protocol with the following modifications: 800 µl TRIzol was added to cells, 2 µl glycoblue (AM9515; Ambion) was added to visualize the RNA pellet, and the pellet was rinsed in 75% EtOH. .. RNA purity was assessed on a Nanodrop spectrometer. cDNA was synthesized using a Superscript III kit (18080093; Invitrogen) from 2 mg RNA and diluted 1:1 before being added to the PCR reaction.

Quantitative RT-PCR:

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: Paragraph title: Quantitative real-time PCR (qRT-PCR) ... Total RNA was isolated in 1mL Trizol (Life Technologies, Carlsbad, CA) as per manufacturer's instructions.

Article Title: External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary. External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary
Article Snippet: Total RNA was extracted by TRIzol reagent and spin column, quantified using NanoDrop 2000c (Thermo Fisher). .. Using the one‐step or two‐step RT‐qPCR method, qualitative and quantitative detection of PML‐RARα FG and CG was performed by the manufacturer's instructions on ABI 7500 Instrument (Applied Biosystems).

Article Title: Increased intracellular pH is necessary for adult epithelial and embryonic stem cell differentiation
Article Snippet: .. Quantitative RT-PCR experiments RNA was extracted from mESCs maintained in the absence or presence of LIF2i for 72 h using TRIzol (Ambion) according to the manufacturer’s protocol with the following modifications: 800 µl TRIzol was added to cells, 2 µl glycoblue (AM9515; Ambion) was added to visualize the RNA pellet, and the pellet was rinsed in 75% EtOH. .. RNA purity was assessed on a Nanodrop spectrometer. cDNA was synthesized using a Superscript III kit (18080093; Invitrogen) from 2 mg RNA and diluted 1:1 before being added to the PCR reaction.

Real-time Polymerase Chain Reaction:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). .. Quantitative PCR was performed using the iQ Syber Green Supermix (Biorad, CA) on a MJ cycler (MJ Research, CA).

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: Paragraph title: Quantitative real-time PCR (qRT-PCR) ... Total RNA was isolated in 1mL Trizol (Life Technologies, Carlsbad, CA) as per manufacturer's instructions.

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Paragraph title: Real-time qPCR and ChIP-qPCR. ... Total RNA was isolated the following day with TRIzol (Invitrogen).

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord
Article Snippet: Paragraph title: Quantitative PCR ... Total RNA was isolated from spinal cord slices using Trizol according to the protocol provided by the manufacturer (Invitrogen). cDNA was generated from 500 ng total RNA primed with a mixture of oligo-dT and random hexamers that was reverse transcribed in a 20 µl reaction containing a final concentration of 2.5 ng/μl random hexamers, 2.5 μM oligo-dT, 40 U of RNAseOUT RNase inhibitor, and 200 U of SuperScript III reverse transcriptase.

Article Title: Increased intracellular pH is necessary for adult epithelial and embryonic stem cell differentiation
Article Snippet: Quantitative RT-PCR experiments RNA was extracted from mESCs maintained in the absence or presence of LIF2i for 72 h using TRIzol (Ambion) according to the manufacturer’s protocol with the following modifications: 800 µl TRIzol was added to cells, 2 µl glycoblue (AM9515; Ambion) was added to visualize the RNA pellet, and the pellet was rinsed in 75% EtOH. .. Quantitative PCR was performed with SYBR Greener (quantitative PCR SuperMix for ABI prism; 11760; Invitrogen) according to the manufacturer’s protocol on a Real-Time PCR Viaa7 instrument (Applied Biosystems).

Incubation:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: B cells were isolated from the spleens or from the SVF of young and old mice after a 20 min incubation at 4°C with anti-CD19 Microbeads (Miltenyi Biotec), according to the MiniMacs protocol (20 μl Microbeads + 80 μl PBS, for 107 cells). .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction.

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Total RNA was isolated the following day with TRIzol (Invitrogen). .. For chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR), cells were cross-linked for 10 min at 37°C with 1% formaldehyde, washed, and collected in phosphate-buffered saline, followed by a 10-min incubation on ice with 200 μl of lysis buffer (1% SDS, 5 mM EDTA, and 50 mM Tris [pH 8.0] plus one protease inhibitor cocktail tablet and 20 mM NEM).

Expressing:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). .. Fed larvae were pooled in groups of three ticks, ground under liquid nitrogen and suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). cDNA was synthesized using the iScript RT-PCR kit (BIORAD, CA) and analyzed by PCR for the expression of the following tick genes: salp25D , tick actin, salp9pac, salp25B, salp16, lrp (encoding for the predicted salivary protein ) and trx (encoding for the predicted salivary protein ) genes using the primers listed: 25DF-5′cctttccccaacttcacc3′ and 25DR-5′gtccatggttgttcggag3′; tick actin F-5′ggcgacgtagcag 3′ and tick actin R-5′ggtatcgtgctcgactc 3′; and salp9pacF-5′catggggttgactgag 3′ and salp9pacR 5′tacctttattaag; salp25BF-5′cctgaagaagacc 3′ and salp25BR 5′ gtgttgcaatattc 3′; salp16F-5′ ctgaagttctttattctcttc 3′ and salp16R 5gcagggtccttcttcggg 3′; lrpF- 5′cccctgcacaag 3′ and lrpR-5′ gagatcagggcatcg 3′; and trxpF-5′ gttcggaaagcaag 3′ and trxpR-5′ gttccaacggatgtcg 3′.

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: HEK 293 Flp-In Trex cell lines were treated for 24 h with 0.1 nM tetracycline to induce wild-type or K119R mSF-1 expression. .. Total RNA was isolated the following day with TRIzol (Invitrogen).

Article Title: Dysferlin Deficiency Shows Compensatory Induction of Rab27A/Slp2a That May Contribute to Inflammatory Onset
Article Snippet: Paragraph title: mRNA Expression Profiling ... RNA was extracted from ten dysferlin deficient, nine fukutin-related protein (FKRP) mutation positive samples, eleven normal volunteers, and seven ALS muscle biopsy samples using the Trizol (Invitrogen Carsland, CA) method followed by further purification on RNeasy columns.

Modification:

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord
Article Snippet: Total RNA was isolated from spinal cord slices using Trizol according to the protocol provided by the manufacturer (Invitrogen). cDNA was generated from 500 ng total RNA primed with a mixture of oligo-dT and random hexamers that was reverse transcribed in a 20 µl reaction containing a final concentration of 2.5 ng/μl random hexamers, 2.5 μM oligo-dT, 40 U of RNAseOUT RNase inhibitor, and 200 U of SuperScript III reverse transcriptase. .. We designed or modified, and independently validated primer sets for use in absolute quantitation of copy number for 50 distinct genes of interest from the mouse (see ).

Concentration Assay:

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord
Article Snippet: .. Total RNA was isolated from spinal cord slices using Trizol according to the protocol provided by the manufacturer (Invitrogen). cDNA was generated from 500 ng total RNA primed with a mixture of oligo-dT and random hexamers that was reverse transcribed in a 20 µl reaction containing a final concentration of 2.5 ng/μl random hexamers, 2.5 μM oligo-dT, 40 U of RNAseOUT RNase inhibitor, and 200 U of SuperScript III reverse transcriptase. .. Following heat inactivation of the enzyme, samples were diluted 5X in ultrapure water (final volume 100 μl) and used as template in qPCR analyses.

Protease Inhibitor:

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Total RNA was isolated the following day with TRIzol (Invitrogen). .. For chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR), cells were cross-linked for 10 min at 37°C with 1% formaldehyde, washed, and collected in phosphate-buffered saline, followed by a 10-min incubation on ice with 200 μl of lysis buffer (1% SDS, 5 mM EDTA, and 50 mM Tris [pH 8.0] plus one protease inhibitor cocktail tablet and 20 mM NEM).

Infection:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The microinjected-nymphs or larvae were allowed to feed on naïve, B. burgdorferi -infected C3H/HeN mice. .. The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA).

Reverse Transcription Polymerase Chain Reaction:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: Paragraph title: Tick RNA isolation and RT-PCR ... The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA).

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Article Snippet: The oligonucleotide primers used for RT-PCR of TNF-α were forward primer 5′-AGCACAGAAAGCATGATCCG and reverse primer 5′-TGAAACCTCAGTAACCAGAG (Sheldon Biotechnology, Montreal, Quebec, Canada) ( ). .. Total RNA was isolated using Trizol (Gibco, Grand Island, NY) (Balasingam et al., unpublished observations) from samples resected from around the corticectomy site (∼20 mg wet weight).

Generated:

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord
Article Snippet: .. Total RNA was isolated from spinal cord slices using Trizol according to the protocol provided by the manufacturer (Invitrogen). cDNA was generated from 500 ng total RNA primed with a mixture of oligo-dT and random hexamers that was reverse transcribed in a 20 µl reaction containing a final concentration of 2.5 ng/μl random hexamers, 2.5 μM oligo-dT, 40 U of RNAseOUT RNase inhibitor, and 200 U of SuperScript III reverse transcriptase. .. Following heat inactivation of the enzyme, samples were diluted 5X in ultrapure water (final volume 100 μl) and used as template in qPCR analyses.

Sequencing:

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Article Snippet: The expected PCR product is of 701 bp and represents the entire coding sequence for murine TNF-α. .. Total RNA was isolated using Trizol (Gibco, Grand Island, NY) (Balasingam et al., unpublished observations) from samples resected from around the corticectomy site (∼20 mg wet weight).

Sonication:

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Total RNA was isolated the following day with TRIzol (Invitrogen). .. Lysates were sonicated three times for 15 s each time, using an output control setting of 4 with a Branson Sonifier 250, and then centrifuged for 10 min at 13,000 rpm.

RNA Sequencing Assay:

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: .. RNA sequencing library preparation Total RNA was isolated using Trizol (Life Technologies) from five to six pooled tails, in biological triplicate. .. Libraries were prepared using the Kapa Stranded mRNA-Seq Kit Illumina Platform (KapaBiosystems) and sequenced on an Illumina Hi-Seq2000.

RNA HS Assay:

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: Total RNA was isolated in 1mL Trizol (Life Technologies, Carlsbad, CA) as per manufacturer's instructions. .. Following RNA purification and resuspension in MilliQ H2 O, concentrations for each sample were determined using the Qubit RNA HS Assay Kit (Life Technologies).

Magnetic Beads:

Article Title: Antibody cross-reactivity accounts for widespread appearance of m1A in 5’UTRs
Article Snippet: Total RNA from HEK293T cells (n = 2 biological replicates) or whole mouse brain (n = 6 biological replicates) was extracted using TRIzol (ThermoFisher) and treated with RNase-free DNase I (Promega). .. Poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs).

Mutagenesis:

Article Title: Dysferlin Deficiency Shows Compensatory Induction of Rab27A/Slp2a That May Contribute to Inflammatory Onset
Article Snippet: .. RNA was extracted from ten dysferlin deficient, nine fukutin-related protein (FKRP) mutation positive samples, eleven normal volunteers, and seven ALS muscle biopsy samples using the Trizol (Invitrogen Carsland, CA) method followed by further purification on RNeasy columns. .. Isolated RNA from each individual sample was used to prepare biotinylated cRNA target according to manufacture protocols (Affymetrix, CA).

Isolation:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction. .. Splenic B cells were cultured in complete medium (RPMI 1640, supplemented with 10% FCS, 10 μg/ml gentamicin, 2 × 10−5 M 2-ME, and 2 mM L-glutamine).

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: .. The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). .. Fed larvae were pooled in groups of three ticks, ground under liquid nitrogen and suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). cDNA was synthesized using the iScript RT-PCR kit (BIORAD, CA) and analyzed by PCR for the expression of the following tick genes: salp25D , tick actin, salp9pac, salp25B, salp16, lrp (encoding for the predicted salivary protein ) and trx (encoding for the predicted salivary protein ) genes using the primers listed: 25DF-5′cctttccccaacttcacc3′ and 25DR-5′gtccatggttgttcggag3′; tick actin F-5′ggcgacgtagcag 3′ and tick actin R-5′ggtatcgtgctcgactc 3′; and salp9pacF-5′catggggttgactgag 3′ and salp9pacR 5′tacctttattaag; salp25BF-5′cctgaagaagacc 3′ and salp25BR 5′ gtgttgcaatattc 3′; salp16F-5′ ctgaagttctttattctcttc 3′ and salp16R 5gcagggtccttcttcggg 3′; lrpF- 5′cccctgcacaag 3′ and lrpR-5′ gagatcagggcatcg 3′; and trxpF-5′ gttcggaaagcaag 3′ and trxpR-5′ gttccaacggatgtcg 3′.

Article Title: Antibody cross-reactivity accounts for widespread appearance of m1A in 5’UTRs
Article Snippet: Total RNA from HEK293T cells (n = 2 biological replicates) or whole mouse brain (n = 6 biological replicates) was extracted using TRIzol (ThermoFisher) and treated with RNase-free DNase I (Promega). .. Poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs).

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: .. Total RNA was isolated in 1mL Trizol (Life Technologies, Carlsbad, CA) as per manufacturer's instructions. ..

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: .. Total RNA was isolated the following day with TRIzol (Invitrogen). ..

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord
Article Snippet: .. Total RNA was isolated from spinal cord slices using Trizol according to the protocol provided by the manufacturer (Invitrogen). cDNA was generated from 500 ng total RNA primed with a mixture of oligo-dT and random hexamers that was reverse transcribed in a 20 µl reaction containing a final concentration of 2.5 ng/μl random hexamers, 2.5 μM oligo-dT, 40 U of RNAseOUT RNase inhibitor, and 200 U of SuperScript III reverse transcriptase. .. Following heat inactivation of the enzyme, samples were diluted 5X in ultrapure water (final volume 100 μl) and used as template in qPCR analyses.

Article Title: Dysferlin Deficiency Shows Compensatory Induction of Rab27A/Slp2a That May Contribute to Inflammatory Onset
Article Snippet: RNA was extracted from ten dysferlin deficient, nine fukutin-related protein (FKRP) mutation positive samples, eleven normal volunteers, and seven ALS muscle biopsy samples using the Trizol (Invitrogen Carsland, CA) method followed by further purification on RNeasy columns. .. Isolated RNA from each individual sample was used to prepare biotinylated cRNA target according to manufacture protocols (Affymetrix, CA).

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Article Snippet: .. Total RNA was isolated using Trizol (Gibco, Grand Island, NY) (Balasingam et al., unpublished observations) from samples resected from around the corticectomy site (∼20 mg wet weight). .. One microgram RNA was reverse-transcribed and amplified in a single-step process ( ) with the following modifications: 200 μ m deoxynucleoside triphosphates (dNTPs), 1 μ m primers, 2 m m MgCl2 , 2 U of AMV RT (Gibco), 1 U of Taq polymerase (Gibco), 33 U RNA Guard (Pharmacia Biotech, Piscataway, NJ), 1× PCR buffer (Gibco), and 0.5 μCi/ml [α-32 P]deoxycytidine triphosphate (ICN Biochemicals, Costa Mesa, CA) in a total reaction volume of 50 μl.

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: .. RNA sequencing library preparation Total RNA was isolated using Trizol (Life Technologies) from five to six pooled tails, in biological triplicate. .. Libraries were prepared using the Kapa Stranded mRNA-Seq Kit Illumina Platform (KapaBiosystems) and sequenced on an Illumina Hi-Seq2000.

Size-exclusion Chromatography:

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Article Snippet: Total RNA was isolated using Trizol (Gibco, Grand Island, NY) (Balasingam et al., unpublished observations) from samples resected from around the corticectomy site (∼20 mg wet weight). .. Samples were placed in a GENEAmp PCR system 9600 (Perkin-Elmer/Cetus, Norwalk, CT) at 50°C for 15 min followed sequentially by a cyclic phase at 94°C for 45 sec, 60°C for 45 sec, and then 72°C for 1.5 min for a total of 26 cycles.

Purification:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: At the end of the purification procedure, cells were 90–95% CD19-positive by cytofluorimetric analysis. .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction.

Article Title: A small set of conserved genes, including sp5 and Hox, are activated by Wnt signaling in the posterior of planarians and acoels
Article Snippet: Total RNA was isolated in 1mL Trizol (Life Technologies, Carlsbad, CA) as per manufacturer's instructions. .. Following RNA purification and resuspension in MilliQ H2 O, concentrations for each sample were determined using the Qubit RNA HS Assay Kit (Life Technologies).

Article Title: Dysferlin Deficiency Shows Compensatory Induction of Rab27A/Slp2a That May Contribute to Inflammatory Onset
Article Snippet: .. RNA was extracted from ten dysferlin deficient, nine fukutin-related protein (FKRP) mutation positive samples, eleven normal volunteers, and seven ALS muscle biopsy samples using the Trizol (Invitrogen Carsland, CA) method followed by further purification on RNeasy columns. .. Isolated RNA from each individual sample was used to prepare biotinylated cRNA target according to manufacture protocols (Affymetrix, CA).

Polymerase Chain Reaction:

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). .. Fed larvae were pooled in groups of three ticks, ground under liquid nitrogen and suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA). cDNA was synthesized using the iScript RT-PCR kit (BIORAD, CA) and analyzed by PCR for the expression of the following tick genes: salp25D , tick actin, salp9pac, salp25B, salp16, lrp (encoding for the predicted salivary protein ) and trx (encoding for the predicted salivary protein ) genes using the primers listed: 25DF-5′cctttccccaacttcacc3′ and 25DR-5′gtccatggttgttcggag3′; tick actin F-5′ggcgacgtagcag 3′ and tick actin R-5′ggtatcgtgctcgactc 3′; and salp9pacF-5′catggggttgactgag 3′ and salp9pacR 5′tacctttattaag; salp25BF-5′cctgaagaagacc 3′ and salp25BR 5′ gtgttgcaatattc 3′; salp16F-5′ ctgaagttctttattctcttc 3′ and salp16R 5gcagggtccttcttcggg 3′; lrpF- 5′cccctgcacaag 3′ and lrpR-5′ gagatcagggcatcg 3′; and trxpF-5′ gttcggaaagcaag 3′ and trxpR-5′ gttccaacggatgtcg 3′.

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Total RNA was isolated the following day with TRIzol (Invitrogen). .. For chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR), cells were cross-linked for 10 min at 37°C with 1% formaldehyde, washed, and collected in phosphate-buffered saline, followed by a 10-min incubation on ice with 200 μl of lysis buffer (1% SDS, 5 mM EDTA, and 50 mM Tris [pH 8.0] plus one protease inhibitor cocktail tablet and 20 mM NEM).

Article Title: Attenuation of Astroglial Reactivity by Interleukin-10
Article Snippet: The expected PCR product is of 701 bp and represents the entire coding sequence for murine TNF-α. .. Total RNA was isolated using Trizol (Gibco, Grand Island, NY) (Balasingam et al., unpublished observations) from samples resected from around the corticectomy site (∼20 mg wet weight).

Article Title: Increased intracellular pH is necessary for adult epithelial and embryonic stem cell differentiation
Article Snippet: Quantitative RT-PCR experiments RNA was extracted from mESCs maintained in the absence or presence of LIF2i for 72 h using TRIzol (Ambion) according to the manufacturer’s protocol with the following modifications: 800 µl TRIzol was added to cells, 2 µl glycoblue (AM9515; Ambion) was added to visualize the RNA pellet, and the pellet was rinsed in 75% EtOH. .. RNA purity was assessed on a Nanodrop spectrometer. cDNA was synthesized using a Superscript III kit (18080093; Invitrogen) from 2 mg RNA and diluted 1:1 before being added to the PCR reaction.

Protein Extraction:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction. .. Splenic B cells were cultured in complete medium (RPMI 1640, supplemented with 10% FCS, 10 μg/ml gentamicin, 2 × 10−5 M 2-ME, and 2 mM L-glutamine).

Construct:

Article Title: External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary. External quality assessment for PML‐RARα detection in acute promyelocytic leukemia: Findings and summary
Article Snippet: We constructed PML‐RARα FG EQA panel which consisted of limited positive and negative samples with different FGCN /CGCN ratio and MRD value (Table ). .. Total RNA was extracted by TRIzol reagent and spin column, quantified using NanoDrop 2000c (Thermo Fisher).

Lysis:

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Total RNA was isolated the following day with TRIzol (Invitrogen). .. For chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR), cells were cross-linked for 10 min at 37°C with 1% formaldehyde, washed, and collected in phosphate-buffered saline, followed by a 10-min incubation on ice with 200 μl of lysis buffer (1% SDS, 5 mM EDTA, and 50 mM Tris [pH 8.0] plus one protease inhibitor cocktail tablet and 20 mM NEM).

Mouse Assay:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: B cells were isolated from the spleens or from the SVF of young and old mice after a 20 min incubation at 4°C with anti-CD19 Microbeads (Miltenyi Biotec), according to the MiniMacs protocol (20 μl Microbeads + 80 μl PBS, for 107 cells). .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction.

Article Title: A Tick Antioxidant Facilitates the Lyme Disease Agent's Successful Migration from the Mammalian Host to the Arthropod Vector
Article Snippet: The microinjected-nymphs or larvae were allowed to feed on naïve, B. burgdorferi -infected C3H/HeN mice. .. The fed nymphs were dissected and salivary glands (in pools of three pairs) and midguts (in pools of 2) suspended in Trizol and RNA isolated according to the manufacturer’s protocol (Invitrogen, CA).

Article Title: Antibody cross-reactivity accounts for widespread appearance of m1A in 5’UTRs
Article Snippet: m1 A-miCLIP m1 A-miCLIP was performed as previously described , , briefly described below along with any modifications: C57BL/6 mice (8 weeks) were sacrificed by CO2 inhalation and cervical dislocation as approved by the Weill Cornell Medicine Institutional Animal Care and Use Committee (IACUC). .. Total RNA from HEK293T cells (n = 2 biological replicates) or whole mouse brain (n = 6 biological replicates) was extracted using TRIzol (ThermoFisher) and treated with RNase-free DNase I (Promega).

Chromatin Immunoprecipitation:

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Paragraph title: Real-time qPCR and ChIP-qPCR. ... Total RNA was isolated the following day with TRIzol (Invitrogen).

Software:

Article Title: Increased intracellular pH is necessary for adult epithelial and embryonic stem cell differentiation
Article Snippet: Quantitative RT-PCR experiments RNA was extracted from mESCs maintained in the absence or presence of LIF2i for 72 h using TRIzol (Ambion) according to the manufacturer’s protocol with the following modifications: 800 µl TRIzol was added to cells, 2 µl glycoblue (AM9515; Ambion) was added to visualize the RNA pellet, and the pellet was rinsed in 75% EtOH. .. Quantitative PCR analysis was done in the open source RStudio software using the ReadqPCR and NormqPCR ( ).

RNA Extraction:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction. .. Splenic B cells were cultured in complete medium (RPMI 1640, supplemented with 10% FCS, 10 μg/ml gentamicin, 2 × 10−5 M 2-ME, and 2 mM L-glutamine).

Selection:

Article Title: Antibody cross-reactivity accounts for widespread appearance of m1A in 5’UTRs
Article Snippet: Total RNA from HEK293T cells (n = 2 biological replicates) or whole mouse brain (n = 6 biological replicates) was extracted using TRIzol (ThermoFisher) and treated with RNase-free DNase I (Promega). .. Poly(A) RNA was isolated using one round of selection with oligo(dT)25 magnetic beads (New England Biolabs).

Quantitation Assay:

Article Title: Effects of chronic spinal cord injury on relationships among ion channel and receptor mRNAs in mouse lumbar spinal cord
Article Snippet: Total RNA was isolated from spinal cord slices using Trizol according to the protocol provided by the manufacturer (Invitrogen). cDNA was generated from 500 ng total RNA primed with a mixture of oligo-dT and random hexamers that was reverse transcribed in a 20 µl reaction containing a final concentration of 2.5 ng/μl random hexamers, 2.5 μM oligo-dT, 40 U of RNAseOUT RNase inhibitor, and 200 U of SuperScript III reverse transcriptase. .. We designed or modified, and independently validated primer sets for use in absolute quantitation of copy number for 50 distinct genes of interest from the mouse (see ).

Activation Assay:

Article Title: Obesity induces pro-inflammatory B cells and impairs B cell function in old mice
Article Snippet: .. After the isolation procedure was ended, cells were maintained in PBS for 3 h at 4°C to minimize potential effects of anti-CD19 antibodies on B cell activation, then resuspended in TRIzol (Ambion-LifeTechnologies) for RNA extraction or in M-PER (Mammalian Protein Extraction Reagent, Thermo Scientific) for protein extraction. .. Splenic B cells were cultured in complete medium (RPMI 1640, supplemented with 10% FCS, 10 μg/ml gentamicin, 2 × 10−5 M 2-ME, and 2 mM L-glutamine).

Immunoprecipitation:

Article Title: Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿Decreased Recognition of SUMO-Sensitive Target Genes following Modification of SF-1 (NR5A1) ▿ ‡
Article Snippet: Total RNA was isolated the following day with TRIzol (Invitrogen). .. For chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR), cells were cross-linked for 10 min at 37°C with 1% formaldehyde, washed, and collected in phosphate-buffered saline, followed by a 10-min incubation on ice with 200 μl of lysis buffer (1% SDS, 5 mM EDTA, and 50 mM Tris [pH 8.0] plus one protease inhibitor cocktail tablet and 20 mM NEM).

Staining:

Article Title: Dysferlin Deficiency Shows Compensatory Induction of Rab27A/Slp2a That May Contribute to Inflammatory Onset
Article Snippet: RNA was extracted from ten dysferlin deficient, nine fukutin-related protein (FKRP) mutation positive samples, eleven normal volunteers, and seven ALS muscle biopsy samples using the Trizol (Invitrogen Carsland, CA) method followed by further purification on RNeasy columns. .. The arrays were washed and stained on the Affymetrix Fluidics station 400, using instructions and reagents provided by Affymetrix.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher trizol reagent
    MHV-ExoN(-) evolved WT-like genomic <t>RNA</t> accumulation and increased resistance to multiple nucleoside analogues over the passage. (A) Cells were infected with the indicated viruses at MOI = 1 PFU/cell, and intracellular RNA was harvested using <t>TRIzol</t> at the indicated times postinfection. MHV genomic RNA was detected using SYBR green and primers directed to nsp10, and values were normalized to intracellular GAPDH. (B) Same data as in panel A normalized to the RNA level for each virus at 4 hpi. Data represent means and standard errors of results for n = 9 (3 triplicate experiments). (C to F) Sensitivity of passaged viruses to nucleoside analogues at MOI = 0.01 PFU/cell. Cells were treated with the indicated concentrations of 5-FU (C), RBV (D), AZC (E), or CMeA (F) for 30 min prior to infection, supernatants were harvested at 24 hpi, and titers were determined by plaque assay. Data represent changes in titer relative to untreated control results and are plotted as means and standard errors of results from n = 6 (two triplicate experiments). For panels C to F, the statistical significance of changes in the titer of MHV-ExoN(-) P3 relative to MHV-ExoN(-) P250 was determined using the Mann-Whitney test (*, P
    Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 62013 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 62013 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    95
    Thermo Fisher two step trizol
    miR-US22 is required for viral reactivation in latently infected CD34 + HPCs. A) CD34 + HPCs were infected with WT TB40E or ΔmiR-US22 TB40E for 48 hours, and FACS-isolated for viable CD34 + GFP + HPCs. Sorted cells were plated on stromal cell support for 12 days to establish viral latency. Viral reactivation was induced by co-culture on fibroblasts with cytokine stimulation for 21 days, and reactivation was measured by ELDA assay. The pre-reactivation control represents the amount of virus present in cell lysates at the end of latency prior to beginning reactivation. Reactivation data shown are from 2 independent experiments. Significance was calculated using paired t-test. B) CD34 + HPCs were infected and cultured to establish latency as described in A. After 12 days in latency culture (14dpi) <t>DNA</t> was extracted using a two-step <t>TRIZOL</t> method and viral genomes analyzed by qPCR using copies of HCMV UL141 per two copies of human β-globin . Significance was calculated using t-test for three replicate qPCR reactions. Data shown is from one representative experiment out of four independent HPC donors.
    Two Step Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/two step trizol/product/Thermo Fisher
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    two step trizol - by Bioz Stars, 2020-04
    95/100 stars
      Buy from Supplier

    96
    Thermo Fisher trizole reagent
    TRPV2 mRNA expression in BV-2 cells and the effect of CBD. RNA was extracted using <t>Trizole</t> reagent and RNA samples were reverse transcribed using the superscript reverse transcription with mouse actin as a normalizing gene. Data are means ± SEM
    Trizole Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizole reagent/product/Thermo Fisher
    Average 96 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    trizole reagent - by Bioz Stars, 2020-04
    96/100 stars
      Buy from Supplier

    Image Search Results


    MHV-ExoN(-) evolved WT-like genomic RNA accumulation and increased resistance to multiple nucleoside analogues over the passage. (A) Cells were infected with the indicated viruses at MOI = 1 PFU/cell, and intracellular RNA was harvested using TRIzol at the indicated times postinfection. MHV genomic RNA was detected using SYBR green and primers directed to nsp10, and values were normalized to intracellular GAPDH. (B) Same data as in panel A normalized to the RNA level for each virus at 4 hpi. Data represent means and standard errors of results for n = 9 (3 triplicate experiments). (C to F) Sensitivity of passaged viruses to nucleoside analogues at MOI = 0.01 PFU/cell. Cells were treated with the indicated concentrations of 5-FU (C), RBV (D), AZC (E), or CMeA (F) for 30 min prior to infection, supernatants were harvested at 24 hpi, and titers were determined by plaque assay. Data represent changes in titer relative to untreated control results and are plotted as means and standard errors of results from n = 6 (two triplicate experiments). For panels C to F, the statistical significance of changes in the titer of MHV-ExoN(-) P3 relative to MHV-ExoN(-) P250 was determined using the Mann-Whitney test (*, P

    Journal: mBio

    Article Title: Proofreading-Deficient Coronaviruses Adapt for Increased Fitness over Long-Term Passage without Reversion of Exoribonuclease-Inactivating Mutations

    doi: 10.1128/mBio.01503-17

    Figure Lengend Snippet: MHV-ExoN(-) evolved WT-like genomic RNA accumulation and increased resistance to multiple nucleoside analogues over the passage. (A) Cells were infected with the indicated viruses at MOI = 1 PFU/cell, and intracellular RNA was harvested using TRIzol at the indicated times postinfection. MHV genomic RNA was detected using SYBR green and primers directed to nsp10, and values were normalized to intracellular GAPDH. (B) Same data as in panel A normalized to the RNA level for each virus at 4 hpi. Data represent means and standard errors of results for n = 9 (3 triplicate experiments). (C to F) Sensitivity of passaged viruses to nucleoside analogues at MOI = 0.01 PFU/cell. Cells were treated with the indicated concentrations of 5-FU (C), RBV (D), AZC (E), or CMeA (F) for 30 min prior to infection, supernatants were harvested at 24 hpi, and titers were determined by plaque assay. Data represent changes in titer relative to untreated control results and are plotted as means and standard errors of results from n = 6 (two triplicate experiments). For panels C to F, the statistical significance of changes in the titer of MHV-ExoN(-) P3 relative to MHV-ExoN(-) P250 was determined using the Mann-Whitney test (*, P

    Article Snippet: For each passage, supernatants were harvested at 24 h. RNA was extracted from 100 μl of supernatant using 900 μl of TRIzol reagent and PureLink RNA minikit columns (Thermo Scientific, Waltham, MA), and 150 μl of supernatant was used to infect fresh cells in a 24-well plate (total MOI estimated at 1 PFU/cell).

    Techniques: Infection, SYBR Green Assay, Plaque Assay, MANN-WHITNEY

    Candidate miRNA levels are elevated in EVs of cHL patients compared with healthy controls. RT-PCR analysis of miR127-3p ( A ), miR155-5p ( B ), miR21-5p ( C ), let7a-5p ( D ), miR24-3p ( E ), and miR10b-5p ( F ) in plasma extracellular vesicles (EVs) of healthy individuals ( n = 9) and cHL patients ( n = 20) after size-exclusion chromatography (SEC) and total RNA isolation using TRIzol. For each individual sample, the mean Ct value of SEC fractions 9 and 10 was used. Boxes show the 25%–75% percentile; whiskers show the minimum-maximum; and lines represent the median. * P

    Journal: JCI Insight

    Article Title: Plasma vesicle miRNAs for therapy response monitoring in Hodgkin lymphoma patients

    doi: 10.1172/jci.insight.89631

    Figure Lengend Snippet: Candidate miRNA levels are elevated in EVs of cHL patients compared with healthy controls. RT-PCR analysis of miR127-3p ( A ), miR155-5p ( B ), miR21-5p ( C ), let7a-5p ( D ), miR24-3p ( E ), and miR10b-5p ( F ) in plasma extracellular vesicles (EVs) of healthy individuals ( n = 9) and cHL patients ( n = 20) after size-exclusion chromatography (SEC) and total RNA isolation using TRIzol. For each individual sample, the mean Ct value of SEC fractions 9 and 10 was used. Boxes show the 25%–75% percentile; whiskers show the minimum-maximum; and lines represent the median. * P

    Article Snippet: Total RNA was isolated using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s instructions, with some modifications.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Size-exclusion Chromatography, Isolation

    EV outperforms total plasma for monitoring treatment response and corresponds with TARC. ( A ) RT-PCR analysis of miR127-3p in total plasma of cHL patients ( n = 7) before and after treatment, after RNA isolation using TRIzol-LS. ( B ) RT-PCR analysis of miR127-3p in plasma extracellular vesicles (EVs) of the same cHL patients ( n = 7) as in A , after size-exclusion chromatography (SEC) and total RNA isolation. For each individual, the mean Ct value of SEC fractions 9 and 10 is used. Boxes show the 25%–75% percentile; whiskers show the minimum-maximum; and lines represent the median. ( C and D ) As in A and B , but for miR155-5p. ( E and F ) RT-PCR analysis of miR21-5p, miR155-5p, and miR127-3p in total plasma ( E ) and in plasma EVs ( F ) of an individual cHL patient with primary tumor before and after first-line treatment (gray symbols) and a cHL patient with relapsed disease before and after second-line treatment (black symbols). ( G – J ) RT-PCR analysis of miR127-3p ( G ), miR155-5p ( H ), miR21-5p ( I ), and let7a-5p ( J ) in plasma EVs of cHL patients before and after treatment ( n = 7). Each data point is the mean Ct value of the 2 consecutive SEC fractions 9 and 10. ( K ) Serum TARC levels in the same cHL patients as in G–J before and after treatment, as measured by ELISA. Data are shown as paired before and after therapy samples ( E–K ).

    Journal: JCI Insight

    Article Title: Plasma vesicle miRNAs for therapy response monitoring in Hodgkin lymphoma patients

    doi: 10.1172/jci.insight.89631

    Figure Lengend Snippet: EV outperforms total plasma for monitoring treatment response and corresponds with TARC. ( A ) RT-PCR analysis of miR127-3p in total plasma of cHL patients ( n = 7) before and after treatment, after RNA isolation using TRIzol-LS. ( B ) RT-PCR analysis of miR127-3p in plasma extracellular vesicles (EVs) of the same cHL patients ( n = 7) as in A , after size-exclusion chromatography (SEC) and total RNA isolation. For each individual, the mean Ct value of SEC fractions 9 and 10 is used. Boxes show the 25%–75% percentile; whiskers show the minimum-maximum; and lines represent the median. ( C and D ) As in A and B , but for miR155-5p. ( E and F ) RT-PCR analysis of miR21-5p, miR155-5p, and miR127-3p in total plasma ( E ) and in plasma EVs ( F ) of an individual cHL patient with primary tumor before and after first-line treatment (gray symbols) and a cHL patient with relapsed disease before and after second-line treatment (black symbols). ( G – J ) RT-PCR analysis of miR127-3p ( G ), miR155-5p ( H ), miR21-5p ( I ), and let7a-5p ( J ) in plasma EVs of cHL patients before and after treatment ( n = 7). Each data point is the mean Ct value of the 2 consecutive SEC fractions 9 and 10. ( K ) Serum TARC levels in the same cHL patients as in G–J before and after treatment, as measured by ELISA. Data are shown as paired before and after therapy samples ( E–K ).

    Article Snippet: Total RNA was isolated using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s instructions, with some modifications.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Size-exclusion Chromatography, Enzyme-linked Immunosorbent Assay

    Small RNA distribution and recovery in EV fractions 9 and 10. ( A and B ) RNA distribution of miR142-3p, let7a-5p, and vtRNA1-1 ( A ) and miR92a-3p, miR21-5p, and miR451-5p ( B ) in 26 fractions upon size-exclusion chromatography (SEC) of 1.5 ml healthy donor plasma. Total RNA was isolated with TRIzol followed by RT-PCR. Data are depicted as raw Ct values; error bars represent SEM from PCR duplicates. ( C ) Fold enrichment of vtRNA1-1, let7a-5p, and miR142-3p in plasma extracellular vesicles (EVs) (fractions 9 and 10) compared with protein/HDL (fractions 20 and 21). Data are shown as the mean of 2 donors; dots indicate individual samples. ( D ) Fold enrichment of miR92a-3p, miR21-5p, and miR451-5p in protein/HDL (fractions 20 and 21) compared with plasma EVs (fractions 9 and 10). Data are shown as the mean of 2 donors; dots indicate individual samples. ( E ) Fold enrichment of vtRNA1-1 in tumor EV (tEV; fractions 9 and 10) compared with protein/HDL (fractions 20 and 21) after SEC of 1.5 ml B cell culture supernatant. ( F ) SEC of 1.5 ml healthy donor plasma after spike in with 50 μl tumor cell line–derived exosomes. Shown is the fold increase of EBV-miR BHRF1-3 and BART2-5p in EV (fractions 9 and 10) compared with protein/HDL (fractions 20 and 21). Data are shown as the mean of the 2 consecutive SEC fractions; dots represent individual fractions ( E and F ).

    Journal: JCI Insight

    Article Title: Plasma vesicle miRNAs for therapy response monitoring in Hodgkin lymphoma patients

    doi: 10.1172/jci.insight.89631

    Figure Lengend Snippet: Small RNA distribution and recovery in EV fractions 9 and 10. ( A and B ) RNA distribution of miR142-3p, let7a-5p, and vtRNA1-1 ( A ) and miR92a-3p, miR21-5p, and miR451-5p ( B ) in 26 fractions upon size-exclusion chromatography (SEC) of 1.5 ml healthy donor plasma. Total RNA was isolated with TRIzol followed by RT-PCR. Data are depicted as raw Ct values; error bars represent SEM from PCR duplicates. ( C ) Fold enrichment of vtRNA1-1, let7a-5p, and miR142-3p in plasma extracellular vesicles (EVs) (fractions 9 and 10) compared with protein/HDL (fractions 20 and 21). Data are shown as the mean of 2 donors; dots indicate individual samples. ( D ) Fold enrichment of miR92a-3p, miR21-5p, and miR451-5p in protein/HDL (fractions 20 and 21) compared with plasma EVs (fractions 9 and 10). Data are shown as the mean of 2 donors; dots indicate individual samples. ( E ) Fold enrichment of vtRNA1-1 in tumor EV (tEV; fractions 9 and 10) compared with protein/HDL (fractions 20 and 21) after SEC of 1.5 ml B cell culture supernatant. ( F ) SEC of 1.5 ml healthy donor plasma after spike in with 50 μl tumor cell line–derived exosomes. Shown is the fold increase of EBV-miR BHRF1-3 and BART2-5p in EV (fractions 9 and 10) compared with protein/HDL (fractions 20 and 21). Data are shown as the mean of the 2 consecutive SEC fractions; dots represent individual fractions ( E and F ).

    Article Snippet: Total RNA was isolated using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s instructions, with some modifications.

    Techniques: Size-exclusion Chromatography, Isolation, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Cell Culture, Derivative Assay

    miR127-3p EV outperforms total plasma in distinguishing cHL patients from controls. ( A ) RT-PCR analysis of miR127-3p in total plasma of healthy controls ( n = 7) and cHL patients ( n = 8) after RNA isolation using TRIzol-LS. ( B ) RT-PCR analysis of miR127-3p in extracellular vesicle (EV) fractions of the same healthy individuals and cHL patients as in A after size-exclusion chromatography (SEC) and total RNA isolation. For each individual, the mean Ct value of SEC fractions 9 and 10 is used. ( A and B ) Boxes show the 25%–75% percentile; whiskers show the minimum-maximum; and lines represent the median. ** P

    Journal: JCI Insight

    Article Title: Plasma vesicle miRNAs for therapy response monitoring in Hodgkin lymphoma patients

    doi: 10.1172/jci.insight.89631

    Figure Lengend Snippet: miR127-3p EV outperforms total plasma in distinguishing cHL patients from controls. ( A ) RT-PCR analysis of miR127-3p in total plasma of healthy controls ( n = 7) and cHL patients ( n = 8) after RNA isolation using TRIzol-LS. ( B ) RT-PCR analysis of miR127-3p in extracellular vesicle (EV) fractions of the same healthy individuals and cHL patients as in A after size-exclusion chromatography (SEC) and total RNA isolation. For each individual, the mean Ct value of SEC fractions 9 and 10 is used. ( A and B ) Boxes show the 25%–75% percentile; whiskers show the minimum-maximum; and lines represent the median. ** P

    Article Snippet: Total RNA was isolated using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s instructions, with some modifications.

    Techniques: Reverse Transcription Polymerase Chain Reaction, Isolation, Size-exclusion Chromatography

    miR-US22 is required for viral reactivation in latently infected CD34 + HPCs. A) CD34 + HPCs were infected with WT TB40E or ΔmiR-US22 TB40E for 48 hours, and FACS-isolated for viable CD34 + GFP + HPCs. Sorted cells were plated on stromal cell support for 12 days to establish viral latency. Viral reactivation was induced by co-culture on fibroblasts with cytokine stimulation for 21 days, and reactivation was measured by ELDA assay. The pre-reactivation control represents the amount of virus present in cell lysates at the end of latency prior to beginning reactivation. Reactivation data shown are from 2 independent experiments. Significance was calculated using paired t-test. B) CD34 + HPCs were infected and cultured to establish latency as described in A. After 12 days in latency culture (14dpi) DNA was extracted using a two-step TRIZOL method and viral genomes analyzed by qPCR using copies of HCMV UL141 per two copies of human β-globin . Significance was calculated using t-test for three replicate qPCR reactions. Data shown is from one representative experiment out of four independent HPC donors.

    Journal: PLoS Pathogens

    Article Title: HCMV miR-US22 down-regulation of EGR-1 regulates CD34+ hematopoietic progenitor cell proliferation and viral reactivationPPATHOGENS-D-19-00882

    doi: 10.1371/journal.ppat.1007854

    Figure Lengend Snippet: miR-US22 is required for viral reactivation in latently infected CD34 + HPCs. A) CD34 + HPCs were infected with WT TB40E or ΔmiR-US22 TB40E for 48 hours, and FACS-isolated for viable CD34 + GFP + HPCs. Sorted cells were plated on stromal cell support for 12 days to establish viral latency. Viral reactivation was induced by co-culture on fibroblasts with cytokine stimulation for 21 days, and reactivation was measured by ELDA assay. The pre-reactivation control represents the amount of virus present in cell lysates at the end of latency prior to beginning reactivation. Reactivation data shown are from 2 independent experiments. Significance was calculated using paired t-test. B) CD34 + HPCs were infected and cultured to establish latency as described in A. After 12 days in latency culture (14dpi) DNA was extracted using a two-step TRIZOL method and viral genomes analyzed by qPCR using copies of HCMV UL141 per two copies of human β-globin . Significance was calculated using t-test for three replicate qPCR reactions. Data shown is from one representative experiment out of four independent HPC donors.

    Article Snippet: Quantitative PCR for viral genomes DNA from CD34+ HPCs was extracted using the two-step TRIZOL (ThermoFisher) method according to the manufacturer’s directions.

    Techniques: Infection, FACS, Isolation, Co-Culture Assay, Cell Culture, Real-time Polymerase Chain Reaction

    TRPV2 mRNA expression in BV-2 cells and the effect of CBD. RNA was extracted using Trizole reagent and RNA samples were reverse transcribed using the superscript reverse transcription with mouse actin as a normalizing gene. Data are means ± SEM

    Journal: British Journal of Pharmacology

    Article Title: Cannabidiol enhances microglial phagocytosis via transient receptor potential (TRP) channel activation

    doi: 10.1111/bph.12615

    Figure Lengend Snippet: TRPV2 mRNA expression in BV-2 cells and the effect of CBD. RNA was extracted using Trizole reagent and RNA samples were reverse transcribed using the superscript reverse transcription with mouse actin as a normalizing gene. Data are means ± SEM

    Article Snippet: RNA was extracted from BV-2 cells using Trizole reagent and RNA samples were reverse transcribed using the superscript Reverse Transcription (Thermo Fisher Scientific).

    Techniques: Expressing