trizol reagent  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Name:
    TRIzol Reagent
    Description:
    TRIzol Reagent is a complete, ready-to-use reagent for the isolation of high-quality total RNA or the simultaneous isolation of RNA, DNA, and protein from a variety of biological samples. This monophasic solution of phenol and guanidine isothiocyanate is designed to isolate separate fractions of RNA, DNA, and proteins from cell and tissue samples of human, animal, plant, yeast, or bacterial origin, within one hour.Key features of TRIzol Reagent include:• Permits the isolation of RNA, DNA, and protein from the same sample• Offers superior lysis capability, even with difficult sample types• Optimized formulations and protocols for tissues, cells, serum, virus, and bacteriaReliably purify RNA from multiple sample volumes and sourcesTRIzol Reagent performs well with small quantities of tissue (50–100 mg) and cells (5 × 106), as well as with large quantities of tissue (≥1 g) and cells (>107), and comes with prototcols for purification from samples of human, animal, plant, or bacterial origin. TRIzol Reagent maintains the integrity of the RNA due to highly effective inhibition of RNase activity while disrupting cells and dissolving cell components during sample homogenization. The simplicity of the TRIzol Reagent method allows simultaneous processing of a large number of samples. The entire procedure can be completed in 1 hour. Total RNA isolated by TRIzol Reagent is free of protein and DNA contamination.Formulated for isolation of multiple molecular targetsTRIzol Reagent allows you to perform sequential precipitation of RNA, DNA, and proteins from a single sample. After homogenizing the sample with TRIzol Reagent, chloroform is added, and the homogenate is allowed to separate into a clear upper aqueous layer (containing RNA), and interphase and red lower organic layers (containing the DNA and proteins). RNA is precipitated from the aqueous layer with isopropanol. DNA is precipitated from the interphase/organic layer with ethanol. Protein is precipitated from the phenol-ethanol supernatant by isopropanol precipitation. The precipitated RNA, DNA, or protein is washed to remove impurities, and then resuspended for use in downstream applications.
    Catalog Number:
    15596018
    Price:
    None
    Applications:
    DNA & RNA Purification & Analysis|RNAi, Epigenetics & Non-Coding RNA Research|RNA Extraction|Total RNA Isolation|Total RNA from Animal Cells & Tissues|Total RNA from Bacterial Samples|Total RNA from Plant Cells|Total RNA from Yeast|miRNA Isolation|miRNA & Non-Coding RNA Analysis
    Size:
    200 mL
    Category:
    Kits and Assays, DNA⁄RNA Purification Kits & Reagents, DNA⁄RNA Purification Reagents
    Quantity:
    1
    Buy from Supplier


    Structured Review

    Thermo Fisher trizol reagent
    H19 activates the β-catenin pathway by acting as a competing endogenous <t>RNA</t> sponge for miR-141 in colorectal cancer. (A) H19 was overexpressed by transfection with the pcDNA3.1-H19 plasmid, and luciferase experiments with Top-Luc Flash reporter and pRL-TK (as an internal control) were performed to analyze the Wnt/β-catenin pathway. (B) Western blotting assessed the level of β-catenin in SW480 and HCT116 cells after indicated treatments. (C) The expression of the downstream genes of the Wnt/β-catenin pathway (c-myc, CCND1 and CD44) was analyzed qRT-PCR. (D) SW480 cells were treated with exosomes (10 µg/mL) derived from CAFs or NFs for 48 h, and Western blotting analyzed the protein level of β-catenin. (E) Immunohistochemistry analysis of β-catenin levels in two xenograft tumor tissues in Figure 4 and Figure 6 . Scale bar, 50 μm. (F) Immunoprecipitation using anti-AGO2 antibody (lane 3) or IgG (lane 2) followed by Western blot analysis. Immunoprecipitated RNA was isolated by <t>TRIzol</t> reagent, and the level of H19 was analyzed by qRT-PCR. (G) The putative binding sites between H19 and miR-141 were predicted. (H) HEK293T cells were co-transfected with luciferase plasmids (psicheck2 vector, psicheck2-H19-wt, psicheck2-H19-mut) and miR-141 mimics or mimic controls, and dual-luciferase reporter gene assays were performed. (I) The mRNA levels of β-catenin were analyzed by qRT-PCR. The SW480 cells were transfected with empty vector (pcDNA3.1), H19-overexpressing plasmids (pcDNA3.1-H19), miR-NC (mimic control) or miR-141 (mimic), and mRNA levels of β-catenin were analyzed by qRT-PCR. (J) The protein levels of β-catenin were analyzed by Western blotting in SW480 cells transfected with plasmids overexpressing H19 (pcDNA3.1-H19), an empty vector (pcDNA3.1), miR-NC (mimic control) or miR-141 (mimic). (K) Representative immunostaining graphs of β-catenin expression in H19-high and H19-low CRC tissues. Scale bar, 200 μm. (L) Correlation between relative H19 level and β-catenin immunostaining scores in CRC tissues with linear regression lines. Data are shown as the means ± SD from three independent experiments. Error bars, SD. *P
    TRIzol Reagent is a complete, ready-to-use reagent for the isolation of high-quality total RNA or the simultaneous isolation of RNA, DNA, and protein from a variety of biological samples. This monophasic solution of phenol and guanidine isothiocyanate is designed to isolate separate fractions of RNA, DNA, and proteins from cell and tissue samples of human, animal, plant, yeast, or bacterial origin, within one hour.Key features of TRIzol Reagent include:• Permits the isolation of RNA, DNA, and protein from the same sample• Offers superior lysis capability, even with difficult sample types• Optimized formulations and protocols for tissues, cells, serum, virus, and bacteriaReliably purify RNA from multiple sample volumes and sourcesTRIzol Reagent performs well with small quantities of tissue (50–100 mg) and cells (5 × 106), as well as with large quantities of tissue (≥1 g) and cells (>107), and comes with prototcols for purification from samples of human, animal, plant, or bacterial origin. TRIzol Reagent maintains the integrity of the RNA due to highly effective inhibition of RNase activity while disrupting cells and dissolving cell components during sample homogenization. The simplicity of the TRIzol Reagent method allows simultaneous processing of a large number of samples. The entire procedure can be completed in 1 hour. Total RNA isolated by TRIzol Reagent is free of protein and DNA contamination.Formulated for isolation of multiple molecular targetsTRIzol Reagent allows you to perform sequential precipitation of RNA, DNA, and proteins from a single sample. After homogenizing the sample with TRIzol Reagent, chloroform is added, and the homogenate is allowed to separate into a clear upper aqueous layer (containing RNA), and interphase and red lower organic layers (containing the DNA and proteins). RNA is precipitated from the aqueous layer with isopropanol. DNA is precipitated from the interphase/organic layer with ethanol. Protein is precipitated from the phenol-ethanol supernatant by isopropanol precipitation. The precipitated RNA, DNA, or protein is washed to remove impurities, and then resuspended for use in downstream applications.
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2019-09
    89/100 stars

    Images

    1) Product Images from "Carcinoma-associated fibroblasts promote the stemness and chemoresistance of colorectal cancer by transferring exosomal lncRNA H19"

    Article Title: Carcinoma-associated fibroblasts promote the stemness and chemoresistance of colorectal cancer by transferring exosomal lncRNA H19

    Journal: Theranostics

    doi: 10.7150/thno.25541

    H19 activates the β-catenin pathway by acting as a competing endogenous RNA sponge for miR-141 in colorectal cancer. (A) H19 was overexpressed by transfection with the pcDNA3.1-H19 plasmid, and luciferase experiments with Top-Luc Flash reporter and pRL-TK (as an internal control) were performed to analyze the Wnt/β-catenin pathway. (B) Western blotting assessed the level of β-catenin in SW480 and HCT116 cells after indicated treatments. (C) The expression of the downstream genes of the Wnt/β-catenin pathway (c-myc, CCND1 and CD44) was analyzed qRT-PCR. (D) SW480 cells were treated with exosomes (10 µg/mL) derived from CAFs or NFs for 48 h, and Western blotting analyzed the protein level of β-catenin. (E) Immunohistochemistry analysis of β-catenin levels in two xenograft tumor tissues in Figure 4 and Figure 6 . Scale bar, 50 μm. (F) Immunoprecipitation using anti-AGO2 antibody (lane 3) or IgG (lane 2) followed by Western blot analysis. Immunoprecipitated RNA was isolated by TRIzol reagent, and the level of H19 was analyzed by qRT-PCR. (G) The putative binding sites between H19 and miR-141 were predicted. (H) HEK293T cells were co-transfected with luciferase plasmids (psicheck2 vector, psicheck2-H19-wt, psicheck2-H19-mut) and miR-141 mimics or mimic controls, and dual-luciferase reporter gene assays were performed. (I) The mRNA levels of β-catenin were analyzed by qRT-PCR. The SW480 cells were transfected with empty vector (pcDNA3.1), H19-overexpressing plasmids (pcDNA3.1-H19), miR-NC (mimic control) or miR-141 (mimic), and mRNA levels of β-catenin were analyzed by qRT-PCR. (J) The protein levels of β-catenin were analyzed by Western blotting in SW480 cells transfected with plasmids overexpressing H19 (pcDNA3.1-H19), an empty vector (pcDNA3.1), miR-NC (mimic control) or miR-141 (mimic). (K) Representative immunostaining graphs of β-catenin expression in H19-high and H19-low CRC tissues. Scale bar, 200 μm. (L) Correlation between relative H19 level and β-catenin immunostaining scores in CRC tissues with linear regression lines. Data are shown as the means ± SD from three independent experiments. Error bars, SD. *P
    Figure Legend Snippet: H19 activates the β-catenin pathway by acting as a competing endogenous RNA sponge for miR-141 in colorectal cancer. (A) H19 was overexpressed by transfection with the pcDNA3.1-H19 plasmid, and luciferase experiments with Top-Luc Flash reporter and pRL-TK (as an internal control) were performed to analyze the Wnt/β-catenin pathway. (B) Western blotting assessed the level of β-catenin in SW480 and HCT116 cells after indicated treatments. (C) The expression of the downstream genes of the Wnt/β-catenin pathway (c-myc, CCND1 and CD44) was analyzed qRT-PCR. (D) SW480 cells were treated with exosomes (10 µg/mL) derived from CAFs or NFs for 48 h, and Western blotting analyzed the protein level of β-catenin. (E) Immunohistochemistry analysis of β-catenin levels in two xenograft tumor tissues in Figure 4 and Figure 6 . Scale bar, 50 μm. (F) Immunoprecipitation using anti-AGO2 antibody (lane 3) or IgG (lane 2) followed by Western blot analysis. Immunoprecipitated RNA was isolated by TRIzol reagent, and the level of H19 was analyzed by qRT-PCR. (G) The putative binding sites between H19 and miR-141 were predicted. (H) HEK293T cells were co-transfected with luciferase plasmids (psicheck2 vector, psicheck2-H19-wt, psicheck2-H19-mut) and miR-141 mimics or mimic controls, and dual-luciferase reporter gene assays were performed. (I) The mRNA levels of β-catenin were analyzed by qRT-PCR. The SW480 cells were transfected with empty vector (pcDNA3.1), H19-overexpressing plasmids (pcDNA3.1-H19), miR-NC (mimic control) or miR-141 (mimic), and mRNA levels of β-catenin were analyzed by qRT-PCR. (J) The protein levels of β-catenin were analyzed by Western blotting in SW480 cells transfected with plasmids overexpressing H19 (pcDNA3.1-H19), an empty vector (pcDNA3.1), miR-NC (mimic control) or miR-141 (mimic). (K) Representative immunostaining graphs of β-catenin expression in H19-high and H19-low CRC tissues. Scale bar, 200 μm. (L) Correlation between relative H19 level and β-catenin immunostaining scores in CRC tissues with linear regression lines. Data are shown as the means ± SD from three independent experiments. Error bars, SD. *P

    Techniques Used: Transfection, Plasmid Preparation, Luciferase, Western Blot, Expressing, Quantitative RT-PCR, Derivative Assay, Immunohistochemistry, Immunoprecipitation, Isolation, Binding Assay, Immunostaining

    2) Product Images from "SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction"

    Article Title: SOCS3 treatment prevents the development of alopecia areata by inhibiting CD8+ T cell-mediated autoimmune destruction

    Journal: Oncotarget

    doi: 10.18632/oncotarget.16504

    SOCS3 level is downregulated in human and mouse with AA (A) Heat map representation of qPCR array data about the expression levels of 84 genes involved in AA progression. Total RNA was extracted from human HF homogenates using Trizol reagent. The reverse transcription for mRNA was carried out using cDNA conversion kit. QPCR for assaying 84 genes expression was performed using a standard protocol from the SYBR Green Real-Time PCR Mix. The GAPDH expression was used as an internal control. Among them, the expression levels of SOCS3, Fas and Hes1 are significantly dysregulated in human AA tissues. * p
    Figure Legend Snippet: SOCS3 level is downregulated in human and mouse with AA (A) Heat map representation of qPCR array data about the expression levels of 84 genes involved in AA progression. Total RNA was extracted from human HF homogenates using Trizol reagent. The reverse transcription for mRNA was carried out using cDNA conversion kit. QPCR for assaying 84 genes expression was performed using a standard protocol from the SYBR Green Real-Time PCR Mix. The GAPDH expression was used as an internal control. Among them, the expression levels of SOCS3, Fas and Hes1 are significantly dysregulated in human AA tissues. * p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay

    3) Product Images from "In Vitro Ischemia Triggers a Transcriptional Response to Down-Regulate Synaptic Proteins in Hippocampal Neurons"

    Article Title: In Vitro Ischemia Triggers a Transcriptional Response to Down-Regulate Synaptic Proteins in Hippocampal Neurons

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0099958

    OGD induces changes in the mRNA levels of transcripts encoding synaptic proteins. Total RNA was extracted with TriZol 7 µg of total RNA and specific primers for each selected gene. Fold change in mRNA levels was normalized to Gapdh and Actb. Quantitative PCR analysis showed that genes encoding proteins associated with AMPAR trafficking ( A ) and pre- and post-synaptic compartments ( B ), as well as subunits of the AMPA and NMDA receptors ( C ) were mostly down-regulated (with the exception of Sypl2, which had increased expression levels) after OGD, at least at one of the time points analyzed after OGD. Bars represent the mean ± SEM of 5 independent experiments, performed in distinct preparations. * p
    Figure Legend Snippet: OGD induces changes in the mRNA levels of transcripts encoding synaptic proteins. Total RNA was extracted with TriZol 7 µg of total RNA and specific primers for each selected gene. Fold change in mRNA levels was normalized to Gapdh and Actb. Quantitative PCR analysis showed that genes encoding proteins associated with AMPAR trafficking ( A ) and pre- and post-synaptic compartments ( B ), as well as subunits of the AMPA and NMDA receptors ( C ) were mostly down-regulated (with the exception of Sypl2, which had increased expression levels) after OGD, at least at one of the time points analyzed after OGD. Bars represent the mean ± SEM of 5 independent experiments, performed in distinct preparations. * p

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    OGD increases REST expression in mature hippocampal neurons. ( A ) Quantitative PCR analysis showed the OGD insult induced a marked increase in Nrse (Rest) mRNA. Total RNA was extracted with TriZol 7 h and 24 h after the OGD insult. Quantitative PCR analysis was performed using cDNA prepared from 1 µg of total RNA and specific primers for each selected gene. Fold change in mRNA levels was normalized to Gapdh and Actb. Bars represent the mean ± SEM of three independent experiments, performed in distinct preparations. *Significantly different from control (* p
    Figure Legend Snippet: OGD increases REST expression in mature hippocampal neurons. ( A ) Quantitative PCR analysis showed the OGD insult induced a marked increase in Nrse (Rest) mRNA. Total RNA was extracted with TriZol 7 h and 24 h after the OGD insult. Quantitative PCR analysis was performed using cDNA prepared from 1 µg of total RNA and specific primers for each selected gene. Fold change in mRNA levels was normalized to Gapdh and Actb. Bars represent the mean ± SEM of three independent experiments, performed in distinct preparations. *Significantly different from control (* p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    4) Product Images from "Expression of heat shock proteins and heat shock protein messenger ribonucleic acid in human prostate carcinoma in vitro and in tumors in vivo"

    Article Title: Expression of heat shock proteins and heat shock protein messenger ribonucleic acid in human prostate carcinoma in vitro and in tumors in vivo

    Journal:

    doi: 10.1379/CSC-44R.1

    (A) Fold expression of 27 HSP family genes assayed 2 hours after heat shock in the 5 prostatic cell lines in vitro. Cells were cultured at 37°C and then treated by heat shock (43°C, 1 hour) followed by 2 hours recovery at 37°C. Control cells remained untreated and cultured in a 37°C incubator. Cells were harvested in TRIzol reagent before gene expression analysis as above. HSP gene expression levels have been normalized by dChip to be comparable with each other. Relative gene expression profiles of the HSP genes after heat were shown as folds of expression levels from their corresponding, non–heat shocked controls. Asterisks indicate that some bars for fold expressions were broken to fit the Y-axis scale. Experiments were repeated twice with reproducible results. (B) Expression of androgen receptor messenger ribonucleic acid (mRNA) in PC-3, DU-145, LNCap, CA-HPV-10, and PZ-HPV-7 cells was determined as above (A). (C) Expression of estrogen receptor-related genes in PC-3, DU-145, LNCap, CA-HPV-10, and PZ-HPV-7 cells was determined as in (A)
    Figure Legend Snippet: (A) Fold expression of 27 HSP family genes assayed 2 hours after heat shock in the 5 prostatic cell lines in vitro. Cells were cultured at 37°C and then treated by heat shock (43°C, 1 hour) followed by 2 hours recovery at 37°C. Control cells remained untreated and cultured in a 37°C incubator. Cells were harvested in TRIzol reagent before gene expression analysis as above. HSP gene expression levels have been normalized by dChip to be comparable with each other. Relative gene expression profiles of the HSP genes after heat were shown as folds of expression levels from their corresponding, non–heat shocked controls. Asterisks indicate that some bars for fold expressions were broken to fit the Y-axis scale. Experiments were repeated twice with reproducible results. (B) Expression of androgen receptor messenger ribonucleic acid (mRNA) in PC-3, DU-145, LNCap, CA-HPV-10, and PZ-HPV-7 cells was determined as above (A). (C) Expression of estrogen receptor-related genes in PC-3, DU-145, LNCap, CA-HPV-10, and PZ-HPV-7 cells was determined as in (A)

    Techniques Used: Expressing, In Vitro, Cell Culture

    Constitutive expression of 27 HSP genes at 37°C in the 5 prostate-derived cell lines growing in tissue culture. Cells were grown to confluence at 37°C and harvested in TRIzol reagent for total RNA isolation before microarray analysis as in Materials and Methods. Expression levels of the HSP genes listed in have been normalized by dChip to be comparable with each other. PC, PC-3; DU, DU-145; LN, LNCap; CA, CA-HPV-10; PZ, PZ-HPV-7. Asterisks indicate that some bars for expression levels have to be broken to fit the Y-axis scale. Experiments were repeated twice with reproducible results
    Figure Legend Snippet: Constitutive expression of 27 HSP genes at 37°C in the 5 prostate-derived cell lines growing in tissue culture. Cells were grown to confluence at 37°C and harvested in TRIzol reagent for total RNA isolation before microarray analysis as in Materials and Methods. Expression levels of the HSP genes listed in have been normalized by dChip to be comparable with each other. PC, PC-3; DU, DU-145; LN, LNCap; CA, CA-HPV-10; PZ, PZ-HPV-7. Asterisks indicate that some bars for expression levels have to be broken to fit the Y-axis scale. Experiments were repeated twice with reproducible results

    Techniques Used: Expressing, Derivative Assay, Isolation, Microarray

    5) Product Images from "DOX-Vit D, a Novel Doxorubicin Delivery Approach, Inhibits Human Osteosarcoma Cell Proliferation by Inducing Apoptosis While Inhibiting Akt and mTOR Signaling Pathways"

    Article Title: DOX-Vit D, a Novel Doxorubicin Delivery Approach, Inhibits Human Osteosarcoma Cell Proliferation by Inducing Apoptosis While Inhibiting Akt and mTOR Signaling Pathways

    Journal: Pharmaceutics

    doi: 10.3390/pharmaceutics10030144

    Effect of DOX and DOX-Vit D on the oxidative stress. MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D. Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of ( A ) NQO-1 and ( B ) HO-1 were quantified using real time-PCR and normalized to a β-actin housekeeping gene. ( C ) MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D then, cells were incubated with DCF-DA (10 μM) for 1 h. DCF formation was measured fluorometrically using excitation/emission wavelengths of 484/535 nm. The results are presented as the mean ± SEM ( n = 6). + p
    Figure Legend Snippet: Effect of DOX and DOX-Vit D on the oxidative stress. MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D. Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of ( A ) NQO-1 and ( B ) HO-1 were quantified using real time-PCR and normalized to a β-actin housekeeping gene. ( C ) MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D then, cells were incubated with DCF-DA (10 μM) for 1 h. DCF formation was measured fluorometrically using excitation/emission wavelengths of 484/535 nm. The results are presented as the mean ± SEM ( n = 6). + p

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction, Incubation

    Effect of DOX and DOX-Vit D on the expression of DR-4. MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D. Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA level of DR-4 was quantified using real time-PCR and normalized to a β-actin housekeeping gene. The results are presented as the mean ± SEM ( n = 6). + p
    Figure Legend Snippet: Effect of DOX and DOX-Vit D on the expression of DR-4. MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D. Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA level of DR-4 was quantified using real time-PCR and normalized to a β-actin housekeeping gene. The results are presented as the mean ± SEM ( n = 6). + p

    Techniques Used: Expressing, Isolation, Real-time Polymerase Chain Reaction

    Effect of DOX and DOX-Vit D on proapoptotic genes. MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D. Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of ( A ) Caspase-3, ( B ) p53 and ( C ) BCLxs were quantified using real time-PCR and normalized to a β-actin housekeeping gene. The results are presented as the mean ± SEM ( n = 6). + p
    Figure Legend Snippet: Effect of DOX and DOX-Vit D on proapoptotic genes. MG63 cells were treated for 24 h with 10 µM DOX and DOX-Vit D. Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of ( A ) Caspase-3, ( B ) p53 and ( C ) BCLxs were quantified using real time-PCR and normalized to a β-actin housekeeping gene. The results are presented as the mean ± SEM ( n = 6). + p

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction

    6) Product Images from "MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis"

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis

    Journal: Arthritis Research & Therapy

    doi: 10.1186/ar2079

    MLN51 expression in dendritic cells (DCs) and its effect on the proliferation of immature DCs. (a) MLN51 expression is upregulated only in immature bone marrow-derived dendritic cells (BmDCs) in contrast with bone marrow progenitor cells or mature BmDCs. Total RNA was extracted from each sample with Trizol reagent. RT-PCR was performed with mouse MLN51 primers. (b) BC-1 cells (10 6 ) were transfected with 4 μg of mMLN51 siRNA (siRNA(+)) or control siRNA (siRNA(-)). The transfected cells were harvested every day and assessed for their proliferation over a period of 4 days. The results are means ± SD obtained from single experiments performed in triplicate cultures. (c) Total RNA was extracted each day from the transfected BC-1 cell cultures. mMLN51 was assessed in each sample by RT-PCR as described previously with primers. Results in (a) and (c) are representative of three separate experiments.
    Figure Legend Snippet: MLN51 expression in dendritic cells (DCs) and its effect on the proliferation of immature DCs. (a) MLN51 expression is upregulated only in immature bone marrow-derived dendritic cells (BmDCs) in contrast with bone marrow progenitor cells or mature BmDCs. Total RNA was extracted from each sample with Trizol reagent. RT-PCR was performed with mouse MLN51 primers. (b) BC-1 cells (10 6 ) were transfected with 4 μg of mMLN51 siRNA (siRNA(+)) or control siRNA (siRNA(-)). The transfected cells were harvested every day and assessed for their proliferation over a period of 4 days. The results are means ± SD obtained from single experiments performed in triplicate cultures. (c) Total RNA was extracted each day from the transfected BC-1 cell cultures. mMLN51 was assessed in each sample by RT-PCR as described previously with primers. Results in (a) and (c) are representative of three separate experiments.

    Techniques Used: Expressing, Derivative Assay, Reverse Transcription Polymerase Chain Reaction, Transfection

    MLN51 expression is upregulated in rheumatoid arthritis FLSs compared with osteoarthritis FLSs. (a) Total RNA sample (1 μg) was extracted from three rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLSs) and one osteoarthritis (OA) FLS with Trizol reagent. RT-PCR was performed with 5 ng of cDNA as a template and MLN51 -specific or GAPDH-specific primers. The band for OA FLSs resulted from one (2–43) of the three OA FLSs. (b) Western blot analysis of MLN51 in FLS samples. RA FLSs (2–18, 2–36 and 2–38) and OA FLSs (2–43, 2–46 and 2–47) isolated from each patient were seeded at 5 × 10 4 cells per well in a six-well plate. FLSs grown in high-glucose DMEM supplemented with 10% FBS were harvested, separated by 10% SDS-PAGE, transferred to a nitrocellulose membrane and then proved with anti-hMLN51 rabbit serum (1:1,000 dilution) and horseradish peroxidase-conjugated anti-rabbit IgG (1:5,000 dilution). Data in (a) and (b) are representative of three or four separate experiments.
    Figure Legend Snippet: MLN51 expression is upregulated in rheumatoid arthritis FLSs compared with osteoarthritis FLSs. (a) Total RNA sample (1 μg) was extracted from three rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLSs) and one osteoarthritis (OA) FLS with Trizol reagent. RT-PCR was performed with 5 ng of cDNA as a template and MLN51 -specific or GAPDH-specific primers. The band for OA FLSs resulted from one (2–43) of the three OA FLSs. (b) Western blot analysis of MLN51 in FLS samples. RA FLSs (2–18, 2–36 and 2–38) and OA FLSs (2–43, 2–46 and 2–47) isolated from each patient were seeded at 5 × 10 4 cells per well in a six-well plate. FLSs grown in high-glucose DMEM supplemented with 10% FBS were harvested, separated by 10% SDS-PAGE, transferred to a nitrocellulose membrane and then proved with anti-hMLN51 rabbit serum (1:1,000 dilution) and horseradish peroxidase-conjugated anti-rabbit IgG (1:5,000 dilution). Data in (a) and (b) are representative of three or four separate experiments.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Isolation, SDS Page

    7) Product Images from "Distinct TLR adjuvants differentially stimulate systemic and local innate immune responses in nonhuman primates"

    Article Title: Distinct TLR adjuvants differentially stimulate systemic and local innate immune responses in nonhuman primates

    Journal:

    doi: 10.1182/blood-2011-10-388579

    Ligands for TLR-4 and TLR-9 induce prolonged pro-inflammatory gene transcription in draining LNs. RNA was isolated from the LN whole-cell population cryopreserved with TRIzol reagent on days 1 and 3 after TLR-L injection, and were analyzed by low-density
    Figure Legend Snippet: Ligands for TLR-4 and TLR-9 induce prolonged pro-inflammatory gene transcription in draining LNs. RNA was isolated from the LN whole-cell population cryopreserved with TRIzol reagent on days 1 and 3 after TLR-L injection, and were analyzed by low-density

    Techniques Used: Isolation, Injection

    Signatures of inflammatory gene transcripts in PBMCs after TLR adjuvant injection. RNA was isolated from PBMCs cryopreserved with TRIzol reagent at 3 hours and 1, 3, 6, and 14 days after TLR-L injection and analyzed by low-density array quantitative real-time
    Figure Legend Snippet: Signatures of inflammatory gene transcripts in PBMCs after TLR adjuvant injection. RNA was isolated from PBMCs cryopreserved with TRIzol reagent at 3 hours and 1, 3, 6, and 14 days after TLR-L injection and analyzed by low-density array quantitative real-time

    Techniques Used: Injection, Isolation

    8) Product Images from "Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism"

    Article Title: Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism

    Journal: Journal of Biomedicine and Biotechnology

    doi: 10.1155/2012/593195

    Effect of camel milk on apoptotic and oxidative stress markers Caspase-3 (a), DR4 (b), and HO-1 (c) mRNA levels in MCF7 cells. MCF7 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3, DR4, and HO-1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on apoptotic and oxidative stress markers Caspase-3 (a), DR4 (b), and HO-1 (c) mRNA levels in MCF7 cells. MCF7 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3, DR4, and HO-1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of camel milk on apoptotic markers Caspase-3 (a), p53 (b), BcL2 (c), and DR4 (d) mRNA levels in HepG2 cells. HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of Caspase-3, p53, BcL2, and DR4 were quantified using RT-PCR normalized to β -actin housekeeping gene as described in Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on apoptotic markers Caspase-3 (a), p53 (b), BcL2 (c), and DR4 (d) mRNA levels in HepG2 cells. HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of Caspase-3, p53, BcL2, and DR4 were quantified using RT-PCR normalized to β -actin housekeeping gene as described in Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of MAPKs inhibitors on camel milk mediated induction of caspase-3 mRNA levels in HepG2 cells. HepG2 cells were pre-treated with for 2 h with JNK inhibitor, SP600125, p38 inhibitor, SB203580, and ERK inhibitor, U0126, before the addition of camel milk (10 mg/mL) for additional 6 h. Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of MAPKs inhibitors on camel milk mediated induction of caspase-3 mRNA levels in HepG2 cells. HepG2 cells were pre-treated with for 2 h with JNK inhibitor, SP600125, p38 inhibitor, SB203580, and ERK inhibitor, U0126, before the addition of camel milk (10 mg/mL) for additional 6 h. Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of camel milk on oxidative stress markers HO-1 (a) and NQO1 (b) mRNA levels, and ROS (c) production in HepG2 cells. (a) and (b) HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of HO-1 and NQO1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on oxidative stress markers HO-1 (a) and NQO1 (b) mRNA levels, and ROS (c) production in HepG2 cells. (a) and (b) HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of HO-1 and NQO1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    9) Product Images from "Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells"

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0050935

    HuR antagonizes the downregulation of COX-2 expression caused by miR-16 in hepatoma cell lines. WRL68 cell extracts (500 µg per lane) were immunoprecipitated with HuR or IgG antibodies. Bound RNA was harvested with TRIzol reagent, reverse transcriptased, and PCR amplified with COX-2 ( A ) or miR-16 primers ( B ). PCR products were visualized by electrophoresis in SYBR Safe DNA gel stain agarose gels. The abundance of the transcripts present in WRL68 cells after HuR immunoprecipitation was assessed, and fold differences were plotted. Input, total mRNA in cell extract; unbound, unbound mRNA after immunoprecipitation with HuR antibody; bound, bound mRNA after immunoprecipitation with HuR antibody; and control, bound mRNA after immunoprecipitation with IgG antiboby. ( C–D ) WRL68 and Hep3B cell lines were transfected with miR-16 or In-miR-16 (50 nM). COX-2 and HuR protein levels were analyzed by Western Blot. ( E–F ) WRL68 and Hep3B cell lines were cotransfected with miR-16 (50 nM) and pcDNA3-HuR-GFP expression vector (4 µg). COX-2 and HuR protein levels were analyzed by Western Blot. Data are reported as means±SD of three independent experiments. *p
    Figure Legend Snippet: HuR antagonizes the downregulation of COX-2 expression caused by miR-16 in hepatoma cell lines. WRL68 cell extracts (500 µg per lane) were immunoprecipitated with HuR or IgG antibodies. Bound RNA was harvested with TRIzol reagent, reverse transcriptased, and PCR amplified with COX-2 ( A ) or miR-16 primers ( B ). PCR products were visualized by electrophoresis in SYBR Safe DNA gel stain agarose gels. The abundance of the transcripts present in WRL68 cells after HuR immunoprecipitation was assessed, and fold differences were plotted. Input, total mRNA in cell extract; unbound, unbound mRNA after immunoprecipitation with HuR antibody; bound, bound mRNA after immunoprecipitation with HuR antibody; and control, bound mRNA after immunoprecipitation with IgG antiboby. ( C–D ) WRL68 and Hep3B cell lines were transfected with miR-16 or In-miR-16 (50 nM). COX-2 and HuR protein levels were analyzed by Western Blot. ( E–F ) WRL68 and Hep3B cell lines were cotransfected with miR-16 (50 nM) and pcDNA3-HuR-GFP expression vector (4 µg). COX-2 and HuR protein levels were analyzed by Western Blot. Data are reported as means±SD of three independent experiments. *p

    Techniques Used: Expressing, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Electrophoresis, Staining, Transfection, Western Blot, Plasmid Preparation

    miR-16 binds COX-2 mRNA and inhibits its translation. ( A ) WRL68 cell extracts (500 µg per lane) were immunoprecipitated with Ago-2 or IgG antibodies. Bound RNA was harvested with TRIzol reagent, reverse transcriptased, and PCR amplified with COX-2 primers. PCR products were visualized by electrophoresis in SYBR Safe DNA gel stain agarose gels. The presence of COX-2 mRNA in WRL68 cell transfected with miR-16 or Lipofectamine after Ago2 immunoprecipitation was assessed, and fold differences were plotted. Input, total mRNA in cell extract; and control, bound mRNA after immunoprecipitation with IgG antiboby. ( B ) Scheme of pGL3-empty, pGL3-seed and pGL3-mut reporter vectors. In pGL3-seed, the putative binding site of miR-16 on COX-2 mRNA 3′-UTR region (as detected by RNAhybrid software) was introduced downstream luciferase gene. In pGL3-mut this region was mutated in order to avoid the binding between miR-16 and Luc mRNA. ( C–D ) A luciferase assay was carried out on HuH-7 and HepG2 cell lines using pGL3-seed and pGL3-mut reporter vectors. Firefly luciferase activity was evaluated 48 h after co-transfection with pGL3-empty/seed/mut (750 ng), miR-16 (50 nM), In-miR-16 (50 nM) and miR-NC (50 nM) as indicated. Data were normalized against renilla luciferase activity (all samples were co-transfected with 50 ng pRL vector and refer to the positive control, pGL3 empty vector). Data are reported as means±SD of three independent experiments. *p
    Figure Legend Snippet: miR-16 binds COX-2 mRNA and inhibits its translation. ( A ) WRL68 cell extracts (500 µg per lane) were immunoprecipitated with Ago-2 or IgG antibodies. Bound RNA was harvested with TRIzol reagent, reverse transcriptased, and PCR amplified with COX-2 primers. PCR products were visualized by electrophoresis in SYBR Safe DNA gel stain agarose gels. The presence of COX-2 mRNA in WRL68 cell transfected with miR-16 or Lipofectamine after Ago2 immunoprecipitation was assessed, and fold differences were plotted. Input, total mRNA in cell extract; and control, bound mRNA after immunoprecipitation with IgG antiboby. ( B ) Scheme of pGL3-empty, pGL3-seed and pGL3-mut reporter vectors. In pGL3-seed, the putative binding site of miR-16 on COX-2 mRNA 3′-UTR region (as detected by RNAhybrid software) was introduced downstream luciferase gene. In pGL3-mut this region was mutated in order to avoid the binding between miR-16 and Luc mRNA. ( C–D ) A luciferase assay was carried out on HuH-7 and HepG2 cell lines using pGL3-seed and pGL3-mut reporter vectors. Firefly luciferase activity was evaluated 48 h after co-transfection with pGL3-empty/seed/mut (750 ng), miR-16 (50 nM), In-miR-16 (50 nM) and miR-NC (50 nM) as indicated. Data were normalized against renilla luciferase activity (all samples were co-transfected with 50 ng pRL vector and refer to the positive control, pGL3 empty vector). Data are reported as means±SD of three independent experiments. *p

    Techniques Used: Immunoprecipitation, Polymerase Chain Reaction, Amplification, Electrophoresis, Staining, Transfection, Binding Assay, Software, Luciferase, Activity Assay, Cotransfection, Plasmid Preparation, Positive Control

    Effect of miR-16 on COX-2 mRNA and protein stability. Hep3B cells were transfected with 50 nM miR-16 or miR-NC, or 30 nM siCOX-2. 5 µg/ml actinomycin-D (Act D) or 10 µg/ml cycloheximide (CHX) were added after transfection. ( A–B ) COX-2 protein was analyzed by Western blot at different time after actinomycin-D treatment. Corresponding densitometry analysis is shown and the relative expression of each sample is related to sample at 0 h as 1. ( C ) mRNA COX-2 levels were analyzed by real time PCR. COX-2 mRNA amounts were calculated as relative expression and normalized to the expression of 36b4 mRNA. Values represent fold change relative to sample at 0 h. ( D–E ) COX-2 protein levels were analyzed by Western blot in the presence or absence of cycloheximide. Corresponding densitometric analysis is shown and the relative expression of each sample is related to the value at 0 h as 1. F) Hep3B cells were transfected with 50 nM miR-16, miR-16 inhibitor (In-miR-16) or lipofectamine and permeabilized with digitonine to obtain soluble and pellet fractions enriched in PB as described in Methods. RNA was isolated from each fraction with Trizol reagent, reverse transcriptased, and PCR amplified with COX-2, Xrn1 and actin primers. Input, RNA extracted from cells prior to fractionation. PCR products were visualized by electrophoresis in SYBR Safe DNA gel stain agarose gels. G) The presence of COX-2 mRNA in soluble and PB fractions was assessed and fold differences were plotted. Data are reported as means±SD of three independent experiments. **p
    Figure Legend Snippet: Effect of miR-16 on COX-2 mRNA and protein stability. Hep3B cells were transfected with 50 nM miR-16 or miR-NC, or 30 nM siCOX-2. 5 µg/ml actinomycin-D (Act D) or 10 µg/ml cycloheximide (CHX) were added after transfection. ( A–B ) COX-2 protein was analyzed by Western blot at different time after actinomycin-D treatment. Corresponding densitometry analysis is shown and the relative expression of each sample is related to sample at 0 h as 1. ( C ) mRNA COX-2 levels were analyzed by real time PCR. COX-2 mRNA amounts were calculated as relative expression and normalized to the expression of 36b4 mRNA. Values represent fold change relative to sample at 0 h. ( D–E ) COX-2 protein levels were analyzed by Western blot in the presence or absence of cycloheximide. Corresponding densitometric analysis is shown and the relative expression of each sample is related to the value at 0 h as 1. F) Hep3B cells were transfected with 50 nM miR-16, miR-16 inhibitor (In-miR-16) or lipofectamine and permeabilized with digitonine to obtain soluble and pellet fractions enriched in PB as described in Methods. RNA was isolated from each fraction with Trizol reagent, reverse transcriptased, and PCR amplified with COX-2, Xrn1 and actin primers. Input, RNA extracted from cells prior to fractionation. PCR products were visualized by electrophoresis in SYBR Safe DNA gel stain agarose gels. G) The presence of COX-2 mRNA in soluble and PB fractions was assessed and fold differences were plotted. Data are reported as means±SD of three independent experiments. **p

    Techniques Used: Transfection, Activated Clotting Time Assay, Western Blot, Expressing, Real-time Polymerase Chain Reaction, Isolation, Polymerase Chain Reaction, Amplification, Fractionation, Electrophoresis, Staining

    10) Product Images from "Local leptin production in osteoarthritis subchondral osteoblasts may be responsible for their abnormal phenotypic expression"

    Article Title: Local leptin production in osteoarthritis subchondral osteoblasts may be responsible for their abnormal phenotypic expression

    Journal: Arthritis Research & Therapy

    doi: 10.1186/ar2925

    Production of leptin receptors (OB-Rb) in normal and OA osteoblasts . The expression of leptin receptors was first determined by qPCR. A ) Confluent Ob were lized in TRIzol and RNA extracted as described in Material and Methods. RNA was reversed transcribed followed by PCR amplification of 100 ng cDNA as described in Figure 1 using OB-Rb and GAPDH primers. Results are the mean ± SEM of n = 7 normal and n = 19 OA Ob preparations, P
    Figure Legend Snippet: Production of leptin receptors (OB-Rb) in normal and OA osteoblasts . The expression of leptin receptors was first determined by qPCR. A ) Confluent Ob were lized in TRIzol and RNA extracted as described in Material and Methods. RNA was reversed transcribed followed by PCR amplification of 100 ng cDNA as described in Figure 1 using OB-Rb and GAPDH primers. Results are the mean ± SEM of n = 7 normal and n = 19 OA Ob preparations, P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification

    Production of leptin in normal and OA osteoblasts . The expression of leptin was first determined by qPCR. Confluent osteoblasts (Ob) were lized in TRIzol and RNA extracted as described in Material and methods. RNA (1 μg) was reversed transcribed followed by qPCR amplification of 100 ng cDNA using specific primers for leptin and GAPDH. The data were processed with the GeneAmp 5700 SDS software and given as threshold cycle (Ct), corresponding to the PCR cycle at which an increase in reporter fluorescence above baseline signal can first be detected. The Ct was converted to the number of molecules and the values for each sample calculated as the ratio of the number of molecules of the target gene/number of molecules of GAPDH. A ) Quantification of leptin mRNA using Lep1 and Lep2 primers. Results are given as the mean value of markers relative to GAPDH ± SEM of n = 4 OA preparations. B ) Quantification of leptin mRNA levels in normal and OA Ob using Lep1 primers. Results are the mean ± SEM of n = 5 normal and n = 15 OA individual Ob preparations. C ) OA Ob were exposed to increasing doses of leptin and lepin mRNA levels were determined using Lep1 primers. Results are the mean ± SEM of n = 4 preparations. The protein production of leptin was next detected using a very selective ELISA. Conditioned-media of confluent normal and OA Ob incubated in HAM's F12/DMEM media containing 0.5% FBS for their last 48 hours of culture were recuperated and stored at -80°C. D ) Aliquots were taken to measure leptin using a very sensitive ELISA. Results are the mean ± SEM of n = 5 normal and n = 6 OA individual Ob preparations.
    Figure Legend Snippet: Production of leptin in normal and OA osteoblasts . The expression of leptin was first determined by qPCR. Confluent osteoblasts (Ob) were lized in TRIzol and RNA extracted as described in Material and methods. RNA (1 μg) was reversed transcribed followed by qPCR amplification of 100 ng cDNA using specific primers for leptin and GAPDH. The data were processed with the GeneAmp 5700 SDS software and given as threshold cycle (Ct), corresponding to the PCR cycle at which an increase in reporter fluorescence above baseline signal can first be detected. The Ct was converted to the number of molecules and the values for each sample calculated as the ratio of the number of molecules of the target gene/number of molecules of GAPDH. A ) Quantification of leptin mRNA using Lep1 and Lep2 primers. Results are given as the mean value of markers relative to GAPDH ± SEM of n = 4 OA preparations. B ) Quantification of leptin mRNA levels in normal and OA Ob using Lep1 primers. Results are the mean ± SEM of n = 5 normal and n = 15 OA individual Ob preparations. C ) OA Ob were exposed to increasing doses of leptin and lepin mRNA levels were determined using Lep1 primers. Results are the mean ± SEM of n = 4 preparations. The protein production of leptin was next detected using a very selective ELISA. Conditioned-media of confluent normal and OA Ob incubated in HAM's F12/DMEM media containing 0.5% FBS for their last 48 hours of culture were recuperated and stored at -80°C. D ) Aliquots were taken to measure leptin using a very sensitive ELISA. Results are the mean ± SEM of n = 5 normal and n = 6 OA individual Ob preparations.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Amplification, Software, Polymerase Chain Reaction, Fluorescence, Enzyme-linked Immunosorbent Assay, Incubation

    11) Product Images from "Oxidized phospholipids stimulate production of stem cell factor via NRF2-dependent mechanisms"

    Article Title: Oxidized phospholipids stimulate production of stem cell factor via NRF2-dependent mechanisms

    Journal: Angiogenesis

    doi: 10.1007/s10456-017-9590-5

    Induction of SCF by OxPAPC depends on the transcription factor NRF2. a , b , c and d HUVECs were transfected with siRNAs targeting ATF4 ( a ), PERK ( b ), NRF2 ( c ), or KEAP ( d ). Twenty-four hours after transfection cells were stimulated with OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were analyzed by qRT-PCR in total RNA prepared using Trizol reagent and normalized to β2-microglobulin mRNA. e Protein kinase CK2 inhibitor TBB attenuates induction of SCF by OxPAPC. Cells were pretreated with TBB (20 µM, 30 min) and thereafter stimulated with OxPAPC (100 µg/ml, 6 h); SCF mRNA was quantified as described above. f miR-155 potentiates induction of SCF by OxPAPC. HUVECs were transfected with the RNA oligonucleotide mimicking miR-155 for 24 h and stimulated by OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were quantified by qRT-PCR. g Steady-state levels of SCF mRNA are decreased in aortas of NRF2 − / − mice. Total RNA was prepared from aortas of 6 months old NRF2 − / − or wild-type mice and analyzed by qRT-PCR method. The levels of NRF2 mRNA were normalized to β2-microglobulin mRNA
    Figure Legend Snippet: Induction of SCF by OxPAPC depends on the transcription factor NRF2. a , b , c and d HUVECs were transfected with siRNAs targeting ATF4 ( a ), PERK ( b ), NRF2 ( c ), or KEAP ( d ). Twenty-four hours after transfection cells were stimulated with OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were analyzed by qRT-PCR in total RNA prepared using Trizol reagent and normalized to β2-microglobulin mRNA. e Protein kinase CK2 inhibitor TBB attenuates induction of SCF by OxPAPC. Cells were pretreated with TBB (20 µM, 30 min) and thereafter stimulated with OxPAPC (100 µg/ml, 6 h); SCF mRNA was quantified as described above. f miR-155 potentiates induction of SCF by OxPAPC. HUVECs were transfected with the RNA oligonucleotide mimicking miR-155 for 24 h and stimulated by OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were quantified by qRT-PCR. g Steady-state levels of SCF mRNA are decreased in aortas of NRF2 − / − mice. Total RNA was prepared from aortas of 6 months old NRF2 − / − or wild-type mice and analyzed by qRT-PCR method. The levels of NRF2 mRNA were normalized to β2-microglobulin mRNA

    Techniques Used: Transfection, Quantitative RT-PCR, Mouse Assay

    SCF mRNA is induced in endothelial and monocytic cells by OxPLs and PGA2 in a time- and concentration-dependent manner a Endothelial cells were stimulated with OxPAPC (100 µg/ml, 6 h). Total RNA was extracted using Trizol reagent and analyzed by microarray hybridization (HCAEC; three independent experiments and hybridizations) or qRT-PCR (HAEC, HUVEC; quadruplicate samples from one representative experiment out of three). Levels of SCF mRNA were normalized to β2-microglobulin mRNA. b HUVECs were stimulated with OxPAPC (100 µg/ml) for indicated time periods, followed by analysis of SCF mRNA. c HUVECs were treated with indicated concentrations of OxPAPC for 6 h. qRT-PCR was used for SCF mRNA quantification. d , e Levels of SCF mRNA were analyzed in aortas of aged (12 months old) wild type and ApoE − / − mice ( d ) or in aortas of wild type and ApoE − / − young animals fed for 8 weeks either with chow (6.5% fat) or high-fat diet (15% fat) ( e ). Total RNA was prepared from homogenized aortas using Trizol reagent. SCF mRNA expression was analyzed by qRT-PCR and normalized to β2-microglobulin mRNA levels
    Figure Legend Snippet: SCF mRNA is induced in endothelial and monocytic cells by OxPLs and PGA2 in a time- and concentration-dependent manner a Endothelial cells were stimulated with OxPAPC (100 µg/ml, 6 h). Total RNA was extracted using Trizol reagent and analyzed by microarray hybridization (HCAEC; three independent experiments and hybridizations) or qRT-PCR (HAEC, HUVEC; quadruplicate samples from one representative experiment out of three). Levels of SCF mRNA were normalized to β2-microglobulin mRNA. b HUVECs were stimulated with OxPAPC (100 µg/ml) for indicated time periods, followed by analysis of SCF mRNA. c HUVECs were treated with indicated concentrations of OxPAPC for 6 h. qRT-PCR was used for SCF mRNA quantification. d , e Levels of SCF mRNA were analyzed in aortas of aged (12 months old) wild type and ApoE − / − mice ( d ) or in aortas of wild type and ApoE − / − young animals fed for 8 weeks either with chow (6.5% fat) or high-fat diet (15% fat) ( e ). Total RNA was prepared from homogenized aortas using Trizol reagent. SCF mRNA expression was analyzed by qRT-PCR and normalized to β2-microglobulin mRNA levels

    Techniques Used: Concentration Assay, Microarray, Hybridization, Quantitative RT-PCR, Mouse Assay, Expressing

    12) Product Images from "Oleanolic Acid Exerts Osteoprotective Effects and Modulates Vitamin D Metabolism"

    Article Title: Oleanolic Acid Exerts Osteoprotective Effects and Modulates Vitamin D Metabolism

    Journal: Nutrients

    doi: 10.3390/nu10020247

    Effects of OA on CYP27B1 and CYP24A1 mRNA, protein expressions, and promoter activities in HKC-8 cells. The expression levels of ( A ) CYP27B1 mRNA; ( B ) CYP24A1 mRNA; ( C ) CYP27B1 protein; ( D ) CYP24A1 protein as well as the promoter activities of ( E ) CYP27B1 and ( F ) CYP24A1 in HKC-8 cells were studied. HKC-8 cells were treated with vehicle (0.1% ethanol), 10 −7 M PTH (1–34, human), 10 −5 M Foskolin or 10 −8 M 1,25(OH) 2 D 3 , and 10 −9 M–10 −5 M OA for 24 h. Cells were harvested by Trizol reagent at indicated time for RT-PCR and real-time PCR analysis ( A , B ). Relative gene expression was normalized by GAPDH. Total protein was extracted by lysis buffer and separated by SDS-PAGE and immunoblotted with anti-CYP27B1 ( C , E ), anti-CYP24A1 ( D , E ) antibody and normalized with β-actin expression. Promoter activities ( F , G ) were measured by dual luciferase assay and data were normalized against a thymidine kinase (TK) reporter construct. Results are presented as mean ± SEM ( n = 3) and analyzed by one-way ANOVA followed by Tukey’s multiple comparison test. * p
    Figure Legend Snippet: Effects of OA on CYP27B1 and CYP24A1 mRNA, protein expressions, and promoter activities in HKC-8 cells. The expression levels of ( A ) CYP27B1 mRNA; ( B ) CYP24A1 mRNA; ( C ) CYP27B1 protein; ( D ) CYP24A1 protein as well as the promoter activities of ( E ) CYP27B1 and ( F ) CYP24A1 in HKC-8 cells were studied. HKC-8 cells were treated with vehicle (0.1% ethanol), 10 −7 M PTH (1–34, human), 10 −5 M Foskolin or 10 −8 M 1,25(OH) 2 D 3 , and 10 −9 M–10 −5 M OA for 24 h. Cells were harvested by Trizol reagent at indicated time for RT-PCR and real-time PCR analysis ( A , B ). Relative gene expression was normalized by GAPDH. Total protein was extracted by lysis buffer and separated by SDS-PAGE and immunoblotted with anti-CYP27B1 ( C , E ), anti-CYP24A1 ( D , E ) antibody and normalized with β-actin expression. Promoter activities ( F , G ) were measured by dual luciferase assay and data were normalized against a thymidine kinase (TK) reporter construct. Results are presented as mean ± SEM ( n = 3) and analyzed by one-way ANOVA followed by Tukey’s multiple comparison test. * p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Lysis, SDS Page, Luciferase, Construct

    13) Product Images from "EBNA3C facilitates RASSF1A downregulation through ubiquitin-mediated degradation and promoter hypermethylation to drive B-cell proliferation"

    Article Title: EBNA3C facilitates RASSF1A downregulation through ubiquitin-mediated degradation and promoter hypermethylation to drive B-cell proliferation

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1007514

    EBNA3C down-regulated RASSF1A mRNA expression by enhancing RASSF1A promoter methylation. (A-D) RASSF1A mRNA expression was decreased in A-B) EBV positive cell lines and C-D) BJAB7, BJAB10, LCL1, and LCL2 cells. 5 million B-cells were collected and total RNA extracted via Trizol reagent. cDNAs were generated by reverse transcriptase kit and RASSF1A mRNA expression level was detected by real-time PCR. The mRNA expression of GAPDH was set as a control. Each sample was determined in triplicate. (E-F) Knock-down EBNA3C rescued RASSF1A mRNA expression. The mRNA expression of RASSF1A in EBNA3C knock-downed LCL1 cell lines or in sh-EBNA3C transfected BJAB10 cells was determined as described for A-D. (G-H) EBNA3C decreased the transcriptional activity of the RASSF1A promoter. 0.5 million Saos-2 and 293 cells were transfected with pGL4.2-R1A-promoter, pRL-TK and an increasing amount of Flag-tagged EBNA3C. Total amounts of plasmids were kept constant by co-transfecting with the vector. 36 h post-transfection, cells were harvested and lysed for dual-luciferase reporter assay according to the manufacturer’s instructions and the expression of Flag-tagged EBNA3C was detected by western blot. All assays were repeated at least three times for reproducibility. (I) The methylation levels of the RASSF1A promoter was specifically increased in BJAB7, BJAB10, LCL1, and LCL2 cells. 5 million BJAB, BJAB7, BJAB10, LCL1, and LCL2 cells were harvested and genomic DNA was extracted as described in materials and methods. 1 μg genomic DNA was used for bisulfite conversion and purification via the EZ DNA Methylation Gold Kit. 100 ng and 50 ng bisulfite-modified DNA was used in 15 μl methylation-specific PCR (MSP) reaction to amplify methylated (M) and unmethylated (U) DNA fragments. The relative density of methylated (M) and unmethylated (U) DNA fragments was measured using Image J software. The ratio of methylated (M) DNA fragments to unmethylated (U) DNA fragments of RASSF1A or c-Myc promoter in BJAB cells was set as the basic level separately. The methylation ratio was calculated by comparing the ratio of methylated (M) DNA fragments to unmethylated (U) DNA fragments of RASSF1A or c-Myc promoter in BJAB7, BJAB10, LCL1 and LCL2 cells to that in BJAB cells. Mean values and standard deviation of two independent experiment were presented. (J-K) Knockdown of EBNA3C decreased the methylation level of RASSF1A promoter. The methylation ratio of the RASSF1A and c-Myc promoter in LCL1-sh-EBN3C and sh-EBNA3C transfected BJAB10 cells were determined as described above. (L-N) RASSF1A mRNA, protein expression levels and methylation status were specifically increased in DAC-treated B cells. 5 million BJAB, BJAB7, BJAB10, LCL1, and LCL2 cells were treated with 5 μM DAC and the medium were refreshed every day. 5 days later, the cells were harvested and aliquoted into three fractions. The mRNA L) and protein M) expression levels of RASSF1A in DAC-treated B cells were detected by real-time PCR and western blot. The mRNA expression level of c-Myc and protein expression level of EBNA3C were determined simultaneously. N) The methylation status of RASSF1A and c-Myc were detected by methylation specific PCR.
    Figure Legend Snippet: EBNA3C down-regulated RASSF1A mRNA expression by enhancing RASSF1A promoter methylation. (A-D) RASSF1A mRNA expression was decreased in A-B) EBV positive cell lines and C-D) BJAB7, BJAB10, LCL1, and LCL2 cells. 5 million B-cells were collected and total RNA extracted via Trizol reagent. cDNAs were generated by reverse transcriptase kit and RASSF1A mRNA expression level was detected by real-time PCR. The mRNA expression of GAPDH was set as a control. Each sample was determined in triplicate. (E-F) Knock-down EBNA3C rescued RASSF1A mRNA expression. The mRNA expression of RASSF1A in EBNA3C knock-downed LCL1 cell lines or in sh-EBNA3C transfected BJAB10 cells was determined as described for A-D. (G-H) EBNA3C decreased the transcriptional activity of the RASSF1A promoter. 0.5 million Saos-2 and 293 cells were transfected with pGL4.2-R1A-promoter, pRL-TK and an increasing amount of Flag-tagged EBNA3C. Total amounts of plasmids were kept constant by co-transfecting with the vector. 36 h post-transfection, cells were harvested and lysed for dual-luciferase reporter assay according to the manufacturer’s instructions and the expression of Flag-tagged EBNA3C was detected by western blot. All assays were repeated at least three times for reproducibility. (I) The methylation levels of the RASSF1A promoter was specifically increased in BJAB7, BJAB10, LCL1, and LCL2 cells. 5 million BJAB, BJAB7, BJAB10, LCL1, and LCL2 cells were harvested and genomic DNA was extracted as described in materials and methods. 1 μg genomic DNA was used for bisulfite conversion and purification via the EZ DNA Methylation Gold Kit. 100 ng and 50 ng bisulfite-modified DNA was used in 15 μl methylation-specific PCR (MSP) reaction to amplify methylated (M) and unmethylated (U) DNA fragments. The relative density of methylated (M) and unmethylated (U) DNA fragments was measured using Image J software. The ratio of methylated (M) DNA fragments to unmethylated (U) DNA fragments of RASSF1A or c-Myc promoter in BJAB cells was set as the basic level separately. The methylation ratio was calculated by comparing the ratio of methylated (M) DNA fragments to unmethylated (U) DNA fragments of RASSF1A or c-Myc promoter in BJAB7, BJAB10, LCL1 and LCL2 cells to that in BJAB cells. Mean values and standard deviation of two independent experiment were presented. (J-K) Knockdown of EBNA3C decreased the methylation level of RASSF1A promoter. The methylation ratio of the RASSF1A and c-Myc promoter in LCL1-sh-EBN3C and sh-EBNA3C transfected BJAB10 cells were determined as described above. (L-N) RASSF1A mRNA, protein expression levels and methylation status were specifically increased in DAC-treated B cells. 5 million BJAB, BJAB7, BJAB10, LCL1, and LCL2 cells were treated with 5 μM DAC and the medium were refreshed every day. 5 days later, the cells were harvested and aliquoted into three fractions. The mRNA L) and protein M) expression levels of RASSF1A in DAC-treated B cells were detected by real-time PCR and western blot. The mRNA expression level of c-Myc and protein expression level of EBNA3C were determined simultaneously. N) The methylation status of RASSF1A and c-Myc were detected by methylation specific PCR.

    Techniques Used: Expressing, Methylation, Generated, Real-time Polymerase Chain Reaction, Transfection, Activity Assay, Plasmid Preparation, Luciferase, Reporter Assay, Western Blot, Purification, DNA Methylation Assay, Modification, Polymerase Chain Reaction, Software, Standard Deviation

    14) Product Images from "Intermittent Hypoxia Regulates Stem-like Characteristics and Differentiation of Neuroblastoma Cells"

    Article Title: Intermittent Hypoxia Regulates Stem-like Characteristics and Differentiation of Neuroblastoma Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0030905

    Regulation of HIF-1α expression in intermittent hypoxia-conditioned human neuroblastoma cells. Cells were grown under normoxic conditions (N) or exposed to 1% O 2 for 24 h (H). Intermittent hypoxia-conditioned cells were derived from NB1691 cells that were exposed to 10 cycles of hypoxia (1% O 2 , 24 h) and reoxygenation. ( A ) Real-time PCR. Total RNA was extracted from neuroblastoma cells using Trizol and cDNA was generated by reverse transcription. Real-time PCRs were done using primers specific to HIF-1α and β-actin. **P
    Figure Legend Snippet: Regulation of HIF-1α expression in intermittent hypoxia-conditioned human neuroblastoma cells. Cells were grown under normoxic conditions (N) or exposed to 1% O 2 for 24 h (H). Intermittent hypoxia-conditioned cells were derived from NB1691 cells that were exposed to 10 cycles of hypoxia (1% O 2 , 24 h) and reoxygenation. ( A ) Real-time PCR. Total RNA was extracted from neuroblastoma cells using Trizol and cDNA was generated by reverse transcription. Real-time PCRs were done using primers specific to HIF-1α and β-actin. **P

    Techniques Used: Expressing, Derivative Assay, Real-time Polymerase Chain Reaction, Generated

    Effects of intermittent hypoxia on VEGF, a hypoxia-response gene and cell survival. ( A ) Real-time PCR. Total RNA was extracted from normoxic (N), and intermittent hypoxia (IH) conditioned neuroblastoma cells using Trizol and cDNA was generated by reverse transcription. Real-time PCRs were done to measure VEGF gene transcript. **P
    Figure Legend Snippet: Effects of intermittent hypoxia on VEGF, a hypoxia-response gene and cell survival. ( A ) Real-time PCR. Total RNA was extracted from normoxic (N), and intermittent hypoxia (IH) conditioned neuroblastoma cells using Trizol and cDNA was generated by reverse transcription. Real-time PCRs were done to measure VEGF gene transcript. **P

    Techniques Used: Real-time Polymerase Chain Reaction, Generated

    15) Product Images from "Black ginseng extract ameliorates hypercholesterolemia in rats"

    Article Title: Black ginseng extract ameliorates hypercholesterolemia in rats

    Journal: Journal of Ginseng Research

    doi: 10.1016/j.jgr.2015.07.003

    Inhibition of acetyl-coenzyme A (CoA) acetyltransferase 2 (ACAT2), 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA), and sterol regulatory element-binding protein 2 (SERBP2) expressions at the messenger RNA level. For evaluating the expressions of these three cholesterol metabolic markers, total RNA was extracted from the liver tissue using TRIzol reagent following manufacturer's instructions. Reverse transcription was carried out in a thermocycler (Biometra). For evaluation of expression of genes, complementary DNA was analyzed by BIO-RAD CFX96 real-time system. (A–C) Significant decrease in these gene markers for cholesterol is observed. Bar graphs are representative of four independent experiments. Values are mean ± standard deviation. * p
    Figure Legend Snippet: Inhibition of acetyl-coenzyme A (CoA) acetyltransferase 2 (ACAT2), 3-hydroxy-3-methyl-glutaryl-CoA (HMG-CoA), and sterol regulatory element-binding protein 2 (SERBP2) expressions at the messenger RNA level. For evaluating the expressions of these three cholesterol metabolic markers, total RNA was extracted from the liver tissue using TRIzol reagent following manufacturer's instructions. Reverse transcription was carried out in a thermocycler (Biometra). For evaluation of expression of genes, complementary DNA was analyzed by BIO-RAD CFX96 real-time system. (A–C) Significant decrease in these gene markers for cholesterol is observed. Bar graphs are representative of four independent experiments. Values are mean ± standard deviation. * p

    Techniques Used: Inhibition, Binding Assay, Expressing, Standard Deviation

    16) Product Images from "Metformin Rescues the Myocardium from Doxorubicin-Induced Energy Starvation and Mitochondrial Damage in Rats"

    Article Title: Metformin Rescues the Myocardium from Doxorubicin-Induced Energy Starvation and Mitochondrial Damage in Rats

    Journal: Oxidative Medicine and Cellular Longevity

    doi: 10.1155/2012/434195

    MET reverses DOX-mediated changes in the levels of cardiac hypertrophic genes. Rats ( n = 10/treatment type) received normal saline, DOX in a total cumulative dose of 18 mg/kg, MET (50 or 500 mg/kg, p.o., daily), or DOX plus either dose of MET. 24 h after receiving the last dose of DOX, total RNA was isolated from rat cardiac tissue using TRIzol methods and quantified spectrophotometrically at 260 nm. The mRNA levels of α -MHC (a) and β -MHC genes (b) were quantified using RT-PCR and normalized to β -actin housekeeping gene. Values represent mean of fold change ± SEM ( n = 10). * P
    Figure Legend Snippet: MET reverses DOX-mediated changes in the levels of cardiac hypertrophic genes. Rats ( n = 10/treatment type) received normal saline, DOX in a total cumulative dose of 18 mg/kg, MET (50 or 500 mg/kg, p.o., daily), or DOX plus either dose of MET. 24 h after receiving the last dose of DOX, total RNA was isolated from rat cardiac tissue using TRIzol methods and quantified spectrophotometrically at 260 nm. The mRNA levels of α -MHC (a) and β -MHC genes (b) were quantified using RT-PCR and normalized to β -actin housekeeping gene. Values represent mean of fold change ± SEM ( n = 10). * P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    MET restores DOX-mediated changes in the levels of oxidative stress-related genes. Rats ( n = 10/treatment type) received normal saline, DOX in a total cumulative dose of 18 mg/kg, MET (50 or 500 mg/kg, p.o., daily), or DOX plus either dose of MET. 24 h after receiving the last dose of DOX, total RNA was isolated from rat cardiac tissue using TRIzol methods and quantified spectrophotometrically at 260 nm. The mRNA levels of GST α (a), HO-1 (b), CAT (c), and NQO1 (d) were quantified using RT-PCR and normalized to β -actin housekeeping gene. Values represent mean of fold change ± SEM ( n = 10). * P
    Figure Legend Snippet: MET restores DOX-mediated changes in the levels of oxidative stress-related genes. Rats ( n = 10/treatment type) received normal saline, DOX in a total cumulative dose of 18 mg/kg, MET (50 or 500 mg/kg, p.o., daily), or DOX plus either dose of MET. 24 h after receiving the last dose of DOX, total RNA was isolated from rat cardiac tissue using TRIzol methods and quantified spectrophotometrically at 260 nm. The mRNA levels of GST α (a), HO-1 (b), CAT (c), and NQO1 (d) were quantified using RT-PCR and normalized to β -actin housekeeping gene. Values represent mean of fold change ± SEM ( n = 10). * P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    17) Product Images from "Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors"

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0067982

    Inhibition of HCV1b attachment to DHHs by purified HSPG (A) and Heparin (B). The HCV1b was pre-incubated with varying amounts of HSPG or Heparin for 1 hr on ice prior to adding to day-11 DHHs in 12-well cell culture plates as described in materials and methods . After incubation on ice for 2 hrs, the unbound HCV was removed by washing cells with PBS for three times. The vRNA of the cell-bound HCV was extracted with Trizol reagent (Invitrogen). The levels of HCV1b vRNA were determined using the same real-time RT-qPCR method as in Fig. 1.
    Figure Legend Snippet: Inhibition of HCV1b attachment to DHHs by purified HSPG (A) and Heparin (B). The HCV1b was pre-incubated with varying amounts of HSPG or Heparin for 1 hr on ice prior to adding to day-11 DHHs in 12-well cell culture plates as described in materials and methods . After incubation on ice for 2 hrs, the unbound HCV was removed by washing cells with PBS for three times. The vRNA of the cell-bound HCV was extracted with Trizol reagent (Invitrogen). The levels of HCV1b vRNA were determined using the same real-time RT-qPCR method as in Fig. 1.

    Techniques Used: Inhibition, Purification, Incubation, Cell Culture, Quantitative RT-PCR

    Blockade of HCV1b cell attachment by apoE monoclonal antibody mAb23. DHHs at day-11 were incubated with HCV1b in the absence (Control) or presence of 10 µg/ml of normal mouse IgG1 (mIgG1) or increasing amounts of apoE mAb23 (0.4, 2, and 10 µg/ml) at 37°C for 2 hrs. The unbound HCV was removed by washing cells with 1x PBS for three times. The vRNA of the cell-bound HCV was extracted with Trizol reagent (Invitrogen). The levels of HCV vRNA were quantified by a real-time RT-PCR method using SuperScript® III Platinum® SYBR® Green One-Step qPCR Kit (Invitrogen). Reactions were run in a StepOnePlus real-time PCR system (Applied Biosystems) using the conditions provided by the qPCR kit. A house-keeping gene GAPDH was used as an internal control, which was quantified using Hu-GAPDH primer/probe mix containing vic-TAMRA (Applied Biosystems). The levels of HCV vRNA were calculated from the average data of three experiments upon normalization with the level of GAPDH.
    Figure Legend Snippet: Blockade of HCV1b cell attachment by apoE monoclonal antibody mAb23. DHHs at day-11 were incubated with HCV1b in the absence (Control) or presence of 10 µg/ml of normal mouse IgG1 (mIgG1) or increasing amounts of apoE mAb23 (0.4, 2, and 10 µg/ml) at 37°C for 2 hrs. The unbound HCV was removed by washing cells with 1x PBS for three times. The vRNA of the cell-bound HCV was extracted with Trizol reagent (Invitrogen). The levels of HCV vRNA were quantified by a real-time RT-PCR method using SuperScript® III Platinum® SYBR® Green One-Step qPCR Kit (Invitrogen). Reactions were run in a StepOnePlus real-time PCR system (Applied Biosystems) using the conditions provided by the qPCR kit. A house-keeping gene GAPDH was used as an internal control, which was quantified using Hu-GAPDH primer/probe mix containing vic-TAMRA (Applied Biosystems). The levels of HCV vRNA were calculated from the average data of three experiments upon normalization with the level of GAPDH.

    Techniques Used: Cell Attachment Assay, Incubation, Quantitative RT-PCR, SYBR Green Assay, Real-time Polymerase Chain Reaction

    Effect of heparinase treatment on HCV1b attachment to DHHs. The day-11 DHHs in 12-well cell culture plates were incubated with varying concentrations of heparinase I in a buffer containing 20 mM Tris-HCl (pH 6.8), 50 mM NaCl, 4 mM CaCl 2 and 0.01% bovine serum albumin at 37°C for 1 hr [18] . The heparinase-treated DHHs were then incubated with HCV1b on ice for 2 hrs. The unbound HCV was removed and the cells were washed with 1x PBS for three times. The HCV1b vRNA of the cell-bound HCV was extracted with Trizol reagent and quantified by RT-qPCR using the StepOnePlus real-time PCR system same as that in Fig. 1.
    Figure Legend Snippet: Effect of heparinase treatment on HCV1b attachment to DHHs. The day-11 DHHs in 12-well cell culture plates were incubated with varying concentrations of heparinase I in a buffer containing 20 mM Tris-HCl (pH 6.8), 50 mM NaCl, 4 mM CaCl 2 and 0.01% bovine serum albumin at 37°C for 1 hr [18] . The heparinase-treated DHHs were then incubated with HCV1b on ice for 2 hrs. The unbound HCV was removed and the cells were washed with 1x PBS for three times. The HCV1b vRNA of the cell-bound HCV was extracted with Trizol reagent and quantified by RT-qPCR using the StepOnePlus real-time PCR system same as that in Fig. 1.

    Techniques Used: Cell Culture, Incubation, Quantitative RT-PCR, Real-time Polymerase Chain Reaction

    Inhibition of HCV1b attachment to DHHs by apoE-derived or HSPG-binding peptide. The day-11 DHHs in 12-well cell culture plates were incubated with HCV1b in the absence or presence of increasing concentrations (0, 6.7, 20, and 60 µM) of peptides on ice for 2 hrs. Upon removal of unbound HCV1b by extensive washing with PBS, the vRNA of the cell-bound HCV1b was extracted with Trizol reagent. The levels of HCV1b vRNA were quantified by a real-time RT-qPCR method. A . Sequences of synthetic peptides. B . Inhibition of HCV1b cell attachment by a peptide derived from the apoE receptor-binding domain. C . Blockade of HCV1b cell attachment by an HSPG-binding peptide 6a-P. The relative levels of HCV1b vRNA are on average of three experiments were converted to percentage of control (%) considering the level of HCV vRNA in the absence of peptide 100%. The relative levels of HCV1b vRNA (y-axis) are plotted against concentrations of peptides (x-axis).
    Figure Legend Snippet: Inhibition of HCV1b attachment to DHHs by apoE-derived or HSPG-binding peptide. The day-11 DHHs in 12-well cell culture plates were incubated with HCV1b in the absence or presence of increasing concentrations (0, 6.7, 20, and 60 µM) of peptides on ice for 2 hrs. Upon removal of unbound HCV1b by extensive washing with PBS, the vRNA of the cell-bound HCV1b was extracted with Trizol reagent. The levels of HCV1b vRNA were quantified by a real-time RT-qPCR method. A . Sequences of synthetic peptides. B . Inhibition of HCV1b cell attachment by a peptide derived from the apoE receptor-binding domain. C . Blockade of HCV1b cell attachment by an HSPG-binding peptide 6a-P. The relative levels of HCV1b vRNA are on average of three experiments were converted to percentage of control (%) considering the level of HCV vRNA in the absence of peptide 100%. The relative levels of HCV1b vRNA (y-axis) are plotted against concentrations of peptides (x-axis).

    Techniques Used: Inhibition, Derivative Assay, Binding Assay, Cell Culture, Incubation, Quantitative RT-PCR, Cell Attachment Assay

    18) Product Images from "Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions"

    Article Title: Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0150528

    Electrophoresis of DNAs by Agilent 2200 TapeStation. DNAs (100 ng/lane) were electrophoresed on an Agilent 2200 TapeStation. The DNA integrity number (DIN) indicates the fragmentation of genomic DNA on a scale from 1 to 10. A high DIN indicates highly intact DNA, and a low DIN indicates strongly degraded DNA. Lane 1, Frozen-H1; lane 2, Frozen-H2; lane 3, Frozen-H3; lane 4, FFPE-H1; lane 5, FFPE-H2; lane 6, FFPE-H3; lane 7, Trizol-h1; lane 8, Trizol-h2; lane 9, Trizol-h4; lane 10, Trizol-h6; and lane 11, Trizol-h7.
    Figure Legend Snippet: Electrophoresis of DNAs by Agilent 2200 TapeStation. DNAs (100 ng/lane) were electrophoresed on an Agilent 2200 TapeStation. The DNA integrity number (DIN) indicates the fragmentation of genomic DNA on a scale from 1 to 10. A high DIN indicates highly intact DNA, and a low DIN indicates strongly degraded DNA. Lane 1, Frozen-H1; lane 2, Frozen-H2; lane 3, Frozen-H3; lane 4, FFPE-H1; lane 5, FFPE-H2; lane 6, FFPE-H3; lane 7, Trizol-h1; lane 8, Trizol-h2; lane 9, Trizol-h4; lane 10, Trizol-h6; and lane 11, Trizol-h7.

    Techniques Used: Electrophoresis, Formalin-fixed Paraffin-Embedded

    Quantification and qualification of Trizol-DNA. (A) Trizol-DNA was serially diluted with distilled water, and the concentration of each diluent was measured by NanoDrop (circles), BR-Qubit (squares), HS-Qubit (diamonds) and qPCR (triangles). The broken line indicates the expected NanoDrop value. The concentration (ng/μl) of each original DNA solution, as measured by NanoDrop, is shown at the top right: dilution ratio = 1. The detection limits of each measurement are described in Fig 1 . (B) Various lengths of the target sequence were amplified from Trizol-DNAs, and the amplified products were electrophoresed on an agarose gel. Lane 1, Frozen-H1; lane 2, Trizol-h1; lane 3, Trizol-h2; lane 4, Trizol-h3; lane 5, Trizol-h4; lane 6, Trizol-h5; lane 7, Trizol-h6; and lane 8, Trizol-h7.
    Figure Legend Snippet: Quantification and qualification of Trizol-DNA. (A) Trizol-DNA was serially diluted with distilled water, and the concentration of each diluent was measured by NanoDrop (circles), BR-Qubit (squares), HS-Qubit (diamonds) and qPCR (triangles). The broken line indicates the expected NanoDrop value. The concentration (ng/μl) of each original DNA solution, as measured by NanoDrop, is shown at the top right: dilution ratio = 1. The detection limits of each measurement are described in Fig 1 . (B) Various lengths of the target sequence were amplified from Trizol-DNAs, and the amplified products were electrophoresed on an agarose gel. Lane 1, Frozen-H1; lane 2, Trizol-h1; lane 3, Trizol-h2; lane 4, Trizol-h3; lane 5, Trizol-h4; lane 6, Trizol-h5; lane 7, Trizol-h6; and lane 8, Trizol-h7.

    Techniques Used: Concentration Assay, Real-time Polymerase Chain Reaction, Sequencing, Amplification, Agarose Gel Electrophoresis

    19) Product Images from "A facile, branched DNA assay to quantitatively measure glucocorticoid receptor auto-regulation in T-cell acute lymphoblastic leukemia"

    Article Title: A facile, branched DNA assay to quantitatively measure glucocorticoid receptor auto-regulation in T-cell acute lymphoblastic leukemia

    Journal: Chinese Journal of Cancer

    doi: 10.5732/cjc.012.10044

    Measurements of GR transcript regulation in cell lines via the bDNA assay and QRT-PCR assays are correlated. A, cell samples were prepared from CEM-C7, CEM-C1, 697, and IM-9 cells treated for 18 h with 1 mol/L Dex or EtOH vehicle alone. CEM-7 is a glucocorticoid-sensitive T-cell ALL cell line and the CEM-C1 cell line was derived from CEM-C7 cells and they are resistant to steroid-mediated apoptosis. 697 is a pre-B-ALL cell line that is steroid-sensitive, whereas the IM-9 lymphoblastoid cell line is resistant to hormone-mediated apoptosis. Cells were lysed for the Quantigene assay using the manufacturer's lysis buffer and total cellular RNA samples were isolated from another aliquot of the culture for QRT-PCR using the Trizol® reagent. The average and SEM are shown for three separate experiments. The data are presented as the fold-change in GR transcript concentration as compared to the EtOH-treated control. For each cell line, there was no significant difference (via paired sample t-test) between QRT-PCR and QG 2.0 for the exon 5/6 measurements. The correlation between QRT-PCR and QG 2.0 when measuring the GC-mediated regulation of exon 1A3 transcripts (B) and exon 5/6 transcripts (C) was tested by calculating the correlation coefficient (R). Because the level of exon 1A3 transcripts was so much greater in CEM-C7 cells than in other cells, we mixed the higher expressing CEM-C7 cell extract with the lower expressing 697 cell extract to obtain points in the middle of the curve (B). The ratios of CEM-C7 extract to 697 extract was 1:1 (50% CEM-C7/50% 697) and 1:2 (33% CEM-C7/67% 697). NS denotes that the difference is not significant ( P > 0.05).
    Figure Legend Snippet: Measurements of GR transcript regulation in cell lines via the bDNA assay and QRT-PCR assays are correlated. A, cell samples were prepared from CEM-C7, CEM-C1, 697, and IM-9 cells treated for 18 h with 1 mol/L Dex or EtOH vehicle alone. CEM-7 is a glucocorticoid-sensitive T-cell ALL cell line and the CEM-C1 cell line was derived from CEM-C7 cells and they are resistant to steroid-mediated apoptosis. 697 is a pre-B-ALL cell line that is steroid-sensitive, whereas the IM-9 lymphoblastoid cell line is resistant to hormone-mediated apoptosis. Cells were lysed for the Quantigene assay using the manufacturer's lysis buffer and total cellular RNA samples were isolated from another aliquot of the culture for QRT-PCR using the Trizol® reagent. The average and SEM are shown for three separate experiments. The data are presented as the fold-change in GR transcript concentration as compared to the EtOH-treated control. For each cell line, there was no significant difference (via paired sample t-test) between QRT-PCR and QG 2.0 for the exon 5/6 measurements. The correlation between QRT-PCR and QG 2.0 when measuring the GC-mediated regulation of exon 1A3 transcripts (B) and exon 5/6 transcripts (C) was tested by calculating the correlation coefficient (R). Because the level of exon 1A3 transcripts was so much greater in CEM-C7 cells than in other cells, we mixed the higher expressing CEM-C7 cell extract with the lower expressing 697 cell extract to obtain points in the middle of the curve (B). The ratios of CEM-C7 extract to 697 extract was 1:1 (50% CEM-C7/50% 697) and 1:2 (33% CEM-C7/67% 697). NS denotes that the difference is not significant ( P > 0.05).

    Techniques Used: Quantitative RT-PCR, Derivative Assay, Lysis, Isolation, Concentration Assay, Gas Chromatography, Expressing

    In patient samples, the bDNA and QRT-PCR assays are correlated only when measuring exon 5/6 transcripts. A, cell samples were prepared from TALL1, TALL2, TALL3, and TALL4 cells treated with 1 µ.mol/L Dex or EtOH vehicle alone for 18 h. The cells were lysed for the Quantigene assay using the manufacturer's lysis buffer and total cellular RNA was isolated from another aliquot of the culture for QRT-PCR using the Trizol® reagent. Each measurement was completed only once because of the low yield of material obtained from fresh patient samples. The data are presented as the fold-change in GR transcript concentration as compared to the EtOH-treated control. The correlation between QRT-PCR and QG 2.0 when measuring the GC-mediated regulation of exon 1A3 transcripts (B) and exon 5/6 transcripts (C) was tested by calculating the correlation coefficient ( R ).
    Figure Legend Snippet: In patient samples, the bDNA and QRT-PCR assays are correlated only when measuring exon 5/6 transcripts. A, cell samples were prepared from TALL1, TALL2, TALL3, and TALL4 cells treated with 1 µ.mol/L Dex or EtOH vehicle alone for 18 h. The cells were lysed for the Quantigene assay using the manufacturer's lysis buffer and total cellular RNA was isolated from another aliquot of the culture for QRT-PCR using the Trizol® reagent. Each measurement was completed only once because of the low yield of material obtained from fresh patient samples. The data are presented as the fold-change in GR transcript concentration as compared to the EtOH-treated control. The correlation between QRT-PCR and QG 2.0 when measuring the GC-mediated regulation of exon 1A3 transcripts (B) and exon 5/6 transcripts (C) was tested by calculating the correlation coefficient ( R ).

    Techniques Used: Quantitative RT-PCR, Lysis, Isolation, Concentration Assay, Gas Chromatography

    20) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    Related Articles

    Amplification:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions.

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: For the elution of bound RNA, beads were resuspended in the lysis buffer described above, supplemented with 10 µg tRNA from Escherichia coli and 80 µg of proteinase K. The mixture was incubated at 50°C for 45 minutes. .. The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers. .. The PCR reaction was performed at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min, with the following primers; hCOX-2 forward 5′- ATCTACCCTCCTCAAGTCCC-3′and reverse 5′- TACCAGAAGGGCAGGATACAG-3′, actin forward 5′- GCTCACGGAGGCACCCCTGAA -3′and reverse 5′- CTGATAGGACATTGTTAGCAT -3′, miR-16 forward 5′- TAGCAGCACGTAAATATTGGCG -3′and the universal reverse primer provided in the NCode™ miRNA first-strand cDNA synthesis kit (Invitrogen), U6 snRNA forward 5′- CTTCGGCAGCACATATACT -3′and reverse 5′- AAAATATGGAACGCTTCACG -3′.

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions. .. Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions.

    Synthesized:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism
    Article Snippet: Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's instructions and quantified by measuring the absorbance at 260 nm. .. Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's instructions and quantified by measuring the absorbance at 260 nm.

    Article Title: Ginkgo biloba extract (EGb761) did not express estrogenic activity in an immature rat uterotrophic assay
    Article Snippet: Total RNA was extracted from uteruses and livers using Trizol Reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol and stored at -80°C until needed. .. First-strand complementary DNA (cDNA) was generated by reverse transcribing 1 μg of total RNA in a final volume of 20 μL containing 4 μL of 5× RT buffer, 9 U of avian myeloblastosis virus (AMV) reverse transcriptase, 20 U of the RNase inhibitor, 1 μL of 10 mM dNTPs, and 0.5 μg/mL of random hexamer.

    Article Title: The Ayurvedic Medicine Salacia oblonga Attenuates Diabetic Renal Fibrosis in Rats: Suppression of Angiotensin II/AT1 Signaling
    Article Snippet: Total RNA was prepared from the kidneys of individual rats or rat mesangial cells using TRIzol reagent (Invitrogen, Australia and Invitrogen, China). .. The relative levels of specific mRNAs were determined by reverse transcriptase polymerase chain reaction (RT-PCR), as described previously [ , , ].

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen).

    Quantitative RT-PCR:

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: The unbound HCV was removed, and the cells were washed three times with DPBS. .. The vRNA of the cell-bound HCV was extracted with Trizol Reagent (Invitrogen) and quantified by qRT-PCR using the StepOnePlus real-time PCR system. .. To determine whether heparin or GAGs inhibits HCV attachment to DHHs or Huh7.5 cells, infectious HCV reacted with different concentrations of heparin or GAGs in a final volume of 0.5 ml/well at 4°C (on ice) for 1 hr was added onto cells in 12-well plates at 4°C (on ice) for 2 hrs to allow binding.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: Paragraph title: HCV vRNA Extraction and Quantification by qRT-PCR ... Total RNAs were extracted from the HCV-infected cells using a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center).

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Paragraph title: RNA Preparation and Real-Time Quantitative RT-PCR ... Total RNA was extracted using the TRIzol reagent (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: The unbound HCV was removed, and the cells were washed three times with DPBS. .. The vRNA of the cell-bound HCV was extracted with Trizol Reagent (Invitrogen) and quantified by qRT-PCR using the StepOnePlus real-time PCR system. .. To determine whether heparin or GAGs inhibits HCV attachment to DHHs or Huh7.5 cells, infectious HCV reacted with different concentrations of heparin or GAGs in a final volume of 0.5 ml/well at 4°C (on ice) for 1 hr was added onto cells in 12-well plates at 4°C (on ice) for 2 hrs to allow binding.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: Total RNAs were extracted from the HCV-infected cells using a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center). .. Total RNAs were extracted from the HCV-infected cells using a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center).

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: Paragraph title: RNA Extraction and Quantitative Real-time PCR Analysis ... Total RNA from HCC cells or human biopsies was extracted by using TRIzol reagent (Invitrogen, Grand Island, NY, USA).

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. 0.5 μg (spinal cord), 1 μg (gastrocnemius) or 2 μg (liver, broadest dorsal muscle) of total RNA was reverse-transcribed using random hexamers and Transcription First Strand cDNA Synthesis Kit (Roche).

    Microarray:

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: Paragraph title: cDNA microarray analysis of rheumatoid arthritis fibroblast-like synoviocytes ... Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and purified by using the RNeasy total RNA isolation kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer's instructions.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: For each gene, the mean values were then calculated and a twofold difference was applied to select upregulated or downregulated genes in RA/OA FLSs or immature DC/bone marrow progenitors. .. To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. Total RNA (1 μg) was mixed with 50 μM oligo(dT)20 , and 10 mM dNTP mixture, heated at 65°C for 5 minutes, and placed on ice for at least 1 minute.

    Article Title: Hepatitis C Virus Induced miR200c Down Modulates FAP-1, a Negative Regulator of Src Signaling and Promotes Hepatic Fibrosis
    Article Snippet: Liver biopsy that were snap frozen obtained from HCV or control normal liver, were used to isolate RNA using Trizol reagent (Invitrogen, Carlsbad, CA) as per manufacturer's protocol. .. Resulting RNA was quantified by A260 and A280 readings using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington DE) and qualitatively assessed using a BioAnalyzer 2100 and RNANanoChip assay (Agilent Technologies, Palo Alto, CA).

    Incubation:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: In order to ensure that the cells were exposed to different morphotypes of A. fumigatus organisms (conidia or HF) during the incubation period, the cell culture was observed microscopically at the beginning and at the end of the exposure. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: The heparinase-treated DHHs were incubated with HCV1b on ice for 2 hrs. .. The vRNA of the cell-bound HCV was extracted with Trizol Reagent (Invitrogen) and quantified by qRT-PCR using the StepOnePlus real-time PCR system.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: The hESCs differentiated human hepatocytes (DHHs) or Huh-7.5 cells in 12-well cell culture plates were incubated with HCV1b or HCVcc in the absence or presence of indicated peptides at 4°C (on ice) for 2 hours (hrs). .. The virion RNA (vRNA) of cell-bound HCV was isolated with a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center).

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: For the elution of bound RNA, beads were resuspended in the lysis buffer described above, supplemented with 10 µg tRNA from Escherichia coli and 80 µg of proteinase K. The mixture was incubated at 50°C for 45 minutes. .. The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions.

    Article Title: Microscale Gene Expression Analysis of Tumor-Associated Macrophages
    Article Snippet: RNA isolation from a large number of cells: RNA was isolated from 2 million U937 cells or 1 million murine BMDMs using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. The RNA from fixed number of cells was isolated using Picopure RNA isolation kit according to the manufacturer’s instructions.

    Expressing:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Paragraph title: RNA isolation and analysis of defensin expression by RT-PCR ... Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: The Ayurvedic Medicine Salacia oblonga Attenuates Diabetic Renal Fibrosis in Rats: Suppression of Angiotensin II/AT1 Signaling
    Article Snippet: Paragraph title: 2.11. Gene Expression Analysis in Rat Kidney and Rat-Derived Mesangial Cells ... Total RNA was prepared from the kidneys of individual rats or rat mesangial cells using TRIzol reagent (Invitrogen, Australia and Invitrogen, China).

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. Real-time quantitative PCR was performed using the Roche Light Cycler 96 system and the FastStart Essential DNA Green Master Kit (Roche) together with the following primers: TfR1, 5′-TCG CTT ATA TTG GGC AGA CC-3′ (forward) and 5′-CCA TGT TTT GAC CAA TGC TG-3′ (reverse); HO1, 5′-TCT TGC CTG GCT CTC TTC TC-3′ (forward) and 5′- GTC GTG GTC AGT CAA CAT GG -3′ (reverse); 18 S ribosomal RNA (18S), 5′-CTG AGA AAC GGC TAC CAC ATC-3′ (forward) and 5′-CGC TCC CAA GAT CCA ACT AC-3′ (reverse).

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: For each gene, the mean values were then calculated and a twofold difference was applied to select upregulated or downregulated genes in RA/OA FLSs or immature DC/bone marrow progenitors. .. To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. Total RNA (1 μg) was mixed with 50 μM oligo(dT)20 , and 10 mM dNTP mixture, heated at 65°C for 5 minutes, and placed on ice for at least 1 minute.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Specific primers (Invitrogen, Grand Island, NY) were used for PCR amplification.

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. 0.5 μg (spinal cord), 1 μg (gastrocnemius) or 2 μg (liver, broadest dorsal muscle) of total RNA was reverse-transcribed using random hexamers and Transcription First Strand cDNA Synthesis Kit (Roche).

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions. .. Specific primers (Invitrogen) were used for PCR amplification.

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. RNA was separated electrophoretically on formaldehyde-agarose gels, transferred to Hybond-N+ membrane (Amersham Biosciences), and hybridized with C-terminal cDNA probes of murine Nox1, Nox2, and Nox4 according to the manufacturer's recommendations (NorthernMax; Ambion, Austin, Tex.). cDNA probes were synthesized using the RT-PCR method (Invitrogen) and sequenced before probing to Hybond-N+ membranes to confirm their sequence specificity.

    Countercurrent Chromatography:

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. RNA was separated electrophoretically on formaldehyde-agarose gels, transferred to Hybond-N+ membrane (Amersham Biosciences), and hybridized with C-terminal cDNA probes of murine Nox1, Nox2, and Nox4 according to the manufacturer's recommendations (NorthernMax; Ambion, Austin, Tex.). cDNA probes were synthesized using the RT-PCR method (Invitrogen) and sequenced before probing to Hybond-N+ membranes to confirm their sequence specificity.

    Transfection:

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: For each gene, the mean values were then calculated and a twofold difference was applied to select upregulated or downregulated genes in RA/OA FLSs or immature DC/bone marrow progenitors. .. To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. Total RNA (1 μg) was mixed with 50 μM oligo(dT)20 , and 10 mM dNTP mixture, heated at 65°C for 5 minutes, and placed on ice for at least 1 minute.

    Gas Chromatography:

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Specific primers (Invitrogen, Grand Island, NY) were used for PCR amplification.

    Concentration Assay:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Protease Inhibitor:

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: The immunoprecipitation was carried out in the lysis buffer (10 mM Tris/HCl, pH 8, 150 mM NaCl, 1% NP40, 0.1% azide, and protease inhibitor cocktail). .. The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers.

    Northern Blot:

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: Reverse transcription-PCR (RT-PCR) was performed as described by Cheng et al. ( ). .. For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. Human HepG2 hepatoma cells, human HL-60 promyelocytic leukemia cells, and murine MMC (SV40-transformed glomerular mesangial cells) were used as positive controls for Nox1, Nox2, and Nox4, respectively.

    Cell Culture:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: In order to ensure that the cells were exposed to different morphotypes of A. fumigatus organisms (conidia or HF) during the incubation period, the cell culture was observed microscopically at the beginning and at the end of the exposure. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: DHHs in a 12-well cell culture plate were washed with DPBS and then incubated with various concentrations of heparinase I in a buffer containing 20 mM Tris-HCl (pH 6.8), 50 mM NaCl, 4 mM CaCl2 and 0.01% bovine serum albumin at 37°C for 1 hr . .. The vRNA of the cell-bound HCV was extracted with Trizol Reagent (Invitrogen) and quantified by qRT-PCR using the StepOnePlus real-time PCR system.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: The hESCs differentiated human hepatocytes (DHHs) or Huh-7.5 cells in 12-well cell culture plates were incubated with HCV1b or HCVcc in the absence or presence of indicated peptides at 4°C (on ice) for 2 hours (hrs). .. The virion RNA (vRNA) of cell-bound HCV was isolated with a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Paragraph title: RNA isolation and analysis of defensin expression by RT-PCR ... Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Paragraph title: Reverse Transcription–Polymerase Chain Reaction (RT-PCR) ... Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions.

    Article Title: Ginkgo biloba extract (EGb761) did not express estrogenic activity in an immature rat uterotrophic assay
    Article Snippet: Paragraph title: RNA isolation and reverse transcription polymerase chain reaction (RT-PCR) ... Total RNA was extracted from uteruses and livers using Trizol Reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol and stored at -80°C until needed.

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Paragraph title: RT-PCR ... Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: Paragraph title: Semiquantitative RT-PCR ... To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions.

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: Paragraph title: RT-PCR and Northern blot analysis for NAD(P)H catalytic subunit homologs. ... For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen).

    Generated:

    Article Title: Hepatitis C Virus Induced miR200c Down Modulates FAP-1, a Negative Regulator of Src Signaling and Promotes Hepatic Fibrosis
    Article Snippet: Liver biopsy that were snap frozen obtained from HCV or control normal liver, were used to isolate RNA using Trizol reagent (Invitrogen, Carlsbad, CA) as per manufacturer's protocol. .. Resulting RNA was quantified by A260 and A280 readings using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington DE) and qualitatively assessed using a BioAnalyzer 2100 and RNANanoChip assay (Agilent Technologies, Palo Alto, CA).

    Inhibition:

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: Paragraph title: Inhibition of HCV Attachment by Heparin and GAGs ... The virion RNA (vRNA) of cell-bound HCV was isolated with a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center).

    Polymerase Chain Reaction:

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions.

    Article Title: Ginkgo biloba extract (EGb761) did not express estrogenic activity in an immature rat uterotrophic assay
    Article Snippet: Total RNA was extracted from uteruses and livers using Trizol Reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol and stored at -80°C until needed. .. First-strand complementary DNA (cDNA) was generated by reverse transcribing 1 μg of total RNA in a final volume of 20 μL containing 4 μL of 5× RT buffer, 9 U of avian myeloblastosis virus (AMV) reverse transcriptase, 20 U of the RNase inhibitor, 1 μL of 10 mM dNTPs, and 0.5 μg/mL of random hexamer.

    Article Title: The Ayurvedic Medicine Salacia oblonga Attenuates Diabetic Renal Fibrosis in Rats: Suppression of Angiotensin II/AT1 Signaling
    Article Snippet: Total RNA was prepared from the kidneys of individual rats or rat mesangial cells using TRIzol reagent (Invitrogen, Australia and Invitrogen, China). .. Total RNA was prepared from the kidneys of individual rats or rat mesangial cells using TRIzol reagent (Invitrogen, Australia and Invitrogen, China).

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: For the elution of bound RNA, beads were resuspended in the lysis buffer described above, supplemented with 10 µg tRNA from Escherichia coli and 80 µg of proteinase K. The mixture was incubated at 50°C for 45 minutes. .. The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers. .. The PCR reaction was performed at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min, with the following primers; hCOX-2 forward 5′- ATCTACCCTCCTCAAGTCCC-3′and reverse 5′- TACCAGAAGGGCAGGATACAG-3′, actin forward 5′- GCTCACGGAGGCACCCCTGAA -3′and reverse 5′- CTGATAGGACATTGTTAGCAT -3′, miR-16 forward 5′- TAGCAGCACGTAAATATTGGCG -3′and the universal reverse primer provided in the NCode™ miRNA first-strand cDNA synthesis kit (Invitrogen), U6 snRNA forward 5′- CTTCGGCAGCACATATACT -3′and reverse 5′- AAAATATGGAACGCTTCACG -3′.

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions. .. Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. Then 10 × RT buffer (25 mM MgCl2 , 0.1 M dithiothreitol, RNaseOUT™ (40 U)) and 1 μl of SuperScript™ III reverse transcriptase (200 U/μl; Invitrogen) were added, and the mixture was incubated at 42°C for 1 hour.

    Binding Assay:

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: To determine whether heparin or GAGs inhibits HCV attachment to DHHs or Huh7.5 cells, infectious HCV reacted with different concentrations of heparin or GAGs in a final volume of 0.5 ml/well at 4°C (on ice) for 1 hr was added onto cells in 12-well plates at 4°C (on ice) for 2 hrs to allow binding. .. The virion RNA (vRNA) of cell-bound HCV was isolated with a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center).

    Article Title: Ginkgo biloba extract (EGb761) did not express estrogenic activity in an immature rat uterotrophic assay
    Article Snippet: Total RNA was extracted from uteruses and livers using Trizol Reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol and stored at -80°C until needed. .. PCR was conducted with 2 μL of first-strand cDNA in a final volume of 20 μL, which contained 1 μL up- and 1 μL down-specific primer and PCR premix (Bioneer, Daejeon, Korea) dissolved in 16 μL 0.1% diethyl pyrocarbonate (DEPC) distilled water.

    Cellular Antioxidant Activity Assay:

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Specific primers (Invitrogen, Grand Island, NY) were used for PCR amplification.

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. 0.5 μg (spinal cord), 1 μg (gastrocnemius) or 2 μg (liver, broadest dorsal muscle) of total RNA was reverse-transcribed using random hexamers and Transcription First Strand cDNA Synthesis Kit (Roche).

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions. .. Specific primers (Invitrogen) were used for PCR amplification.

    Molecular Weight:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. The RNA concentration was measured by spectroscopy, and the integrity of RNA was assessed on an agarose gel. cDNA was synthesized from 1 μg of purified RNA, using 50 nM of Oligo dT, 16 mer, (Operon Biotechnologies SP230), 30 units of AMV Reverse Transcriptase (Promega M5108) and RNA-se free H2 0 in a reaction volume of 25 μl, according to the manufacturer's recommendations.

    Isolation:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: The medium was discarded, the wells were briefly washed with PBS solution, and TRIzol reagent was added to the cells. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. RNA was precipitated with ethanol and resuspended in diethyl pyrocarbonate H2 0.

    Article Title: Apolipoprotein E Mediates Attachment of Clinical Hepatitis C Virus to Hepatocytes by Binding to Cell Surface Heparan Sulfate Proteoglycan Receptors
    Article Snippet: The unbound HCV was removed by aspiration and washing cells with PBS three times. .. The virion RNA (vRNA) of cell-bound HCV was isolated with a Trizol Reagent (Invitrogen) or RNAzol Reagent (Molecular Research Center). .. The levels of HCV vRNA were determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) method.

    Article Title: Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism
    Article Snippet: The fluorescence was directly measured using excitation and emission wavelengths of 485 and 535 nm, respectively, using POLARstar Omega, BMG LabTech (Offenburg, Germany). .. Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's instructions and quantified by measuring the absorbance at 260 nm. .. RNA quality was determined by measuring the 260/280 ratio.

    Article Title: Ginkgo biloba extract (EGb761) did not express estrogenic activity in an immature rat uterotrophic assay
    Article Snippet: Paragraph title: RNA isolation and reverse transcription polymerase chain reaction (RT-PCR) ... Total RNA was extracted from uteruses and livers using Trizol Reagent (Gibco BRL, Grand Island, NY, USA) according to the manufacturer’s protocol and stored at -80°C until needed.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: Two types of immunologic cDNA microarray chip, namely HI380 and MI380 (Creagene Inc., Seoul, Korea) described previously [ ], were used in this study (MI380 microarray data were not shown in the present report. .. Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and purified by using the RNeasy total RNA isolation kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer's instructions. .. The gene expression profile of human RAFLSs and mouse BmDCs were analyzed with the HI380 and MI380 microarray chips, consisting of 384 human and mouse cDNA clones, respectively.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: For each gene, the mean values were then calculated and a twofold difference was applied to select upregulated or downregulated genes in RA/OA FLSs or immature DC/bone marrow progenitors. .. To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. Total RNA (1 μg) was mixed with 50 μM oligo(dT)20 , and 10 mM dNTP mixture, heated at 65°C for 5 minutes, and placed on ice for at least 1 minute.

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: Reverse transcription-PCR (RT-PCR) was performed as described by Cheng et al. ( ). .. For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. Human HepG2 hepatoma cells, human HL-60 promyelocytic leukemia cells, and murine MMC (SV40-transformed glomerular mesangial cells) were used as positive controls for Nox1, Nox2, and Nox4, respectively.

    Article Title: Microscale Gene Expression Analysis of Tumor-Associated Macrophages
    Article Snippet: The cells were finally cultured in DMEM media supplemented with 10% FBS, 20% L-929-cell conditioned media, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mM L-glutamine for next seven days to differentiate into macrophages. .. RNA isolation from a large number of cells: RNA was isolated from 2 million U937 cells or 1 million murine BMDMs using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. .. RNA was isolated using chloroform-isopropanol method as reported earlier .

    Labeling:

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and purified by using the RNeasy total RNA isolation kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer's instructions. .. Total RNA (20 μg) was reverse-transcribed in the presence of Cy-3-conjugated or Cy-5-conjugated dUTP (Amersham Pharmacia Biotech, Piscataway, NJ, USA), using SuperScript II and oligo(dT)18 primer (Invitrogen) in a reaction volume of 20 μl in accordance with the method suggested by the manufacturer.

    Purification:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: For the elution of bound RNA, beads were resuspended in the lysis buffer described above, supplemented with 10 µg tRNA from Escherichia coli and 80 µg of proteinase K. The mixture was incubated at 50°C for 45 minutes. .. The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers. .. The PCR reaction was performed at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min, with the following primers; hCOX-2 forward 5′- ATCTACCCTCCTCAAGTCCC-3′and reverse 5′- TACCAGAAGGGCAGGATACAG-3′, actin forward 5′- GCTCACGGAGGCACCCCTGAA -3′and reverse 5′- CTGATAGGACATTGTTAGCAT -3′, miR-16 forward 5′- TAGCAGCACGTAAATATTGGCG -3′and the universal reverse primer provided in the NCode™ miRNA first-strand cDNA synthesis kit (Invitrogen), U6 snRNA forward 5′- CTTCGGCAGCACATATACT -3′and reverse 5′- AAAATATGGAACGCTTCACG -3′.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: Two types of immunologic cDNA microarray chip, namely HI380 and MI380 (Creagene Inc., Seoul, Korea) described previously [ ], were used in this study (MI380 microarray data were not shown in the present report. .. Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and purified by using the RNeasy total RNA isolation kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer's instructions. .. The gene expression profile of human RAFLSs and mouse BmDCs were analyzed with the HI380 and MI380 microarray chips, consisting of 384 human and mouse cDNA clones, respectively.

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: For each gene, the mean values were then calculated and a twofold difference was applied to select upregulated or downregulated genes in RA/OA FLSs or immature DC/bone marrow progenitors. .. To confirm the upregulation or downregulation of the selected gene (MLN51 ) on the microarray analysis and the expression of MLN51 after siRNA transfection, total RNAs were extracted from RA FLSs with Trizol reagent (Invitrogen) and purified with an RNeasy total RNA isolation kit (Qiagen) in accordance with the manufacturer's instructions. .. Total RNA (1 μg) was mixed with 50 μM oligo(dT)20 , and 10 mM dNTP mixture, heated at 65°C for 5 minutes, and placed on ice for at least 1 minute.

    Sequencing:

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen).

    Spectroscopy:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Lysis:

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: For the elution of bound RNA, beads were resuspended in the lysis buffer described above, supplemented with 10 µg tRNA from Escherichia coli and 80 µg of proteinase K. The mixture was incubated at 50°C for 45 minutes. .. The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers.

    Activated Clotting Time Assay:

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Specific primers (Invitrogen, Grand Island, NY) were used for PCR amplification.

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. 0.5 μg (spinal cord), 1 μg (gastrocnemius) or 2 μg (liver, broadest dorsal muscle) of total RNA was reverse-transcribed using random hexamers and Transcription First Strand cDNA Synthesis Kit (Roche).

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. RNA was separated electrophoretically on formaldehyde-agarose gels, transferred to Hybond-N+ membrane (Amersham Biosciences), and hybridized with C-terminal cDNA probes of murine Nox1, Nox2, and Nox4 according to the manufacturer's recommendations (NorthernMax; Ambion, Austin, Tex.). cDNA probes were synthesized using the RT-PCR method (Invitrogen) and sequenced before probing to Hybond-N+ membranes to confirm their sequence specificity.

    Chromatin Immunoprecipitation:

    Article Title: MLN51 and GM-CSF involvement in the proliferation of fibroblast-like synoviocytes in the pathogenesis of rheumatoid arthritis
    Article Snippet: Two types of immunologic cDNA microarray chip, namely HI380 and MI380 (Creagene Inc., Seoul, Korea) described previously [ ], were used in this study (MI380 microarray data were not shown in the present report. .. Total RNA was extracted with Trizol reagent (Invitrogen, Carlsbad, CA, USA) and purified by using the RNeasy total RNA isolation kit (Qiagen, Valencia, CA, USA) in accordance with the manufacturer's instructions.

    Software:

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. Real-time quantitative PCR was performed using the Roche Light Cycler 96 system and the FastStart Essential DNA Green Master Kit (Roche) together with the following primers: TfR1, 5′-TCG CTT ATA TTG GGC AGA CC-3′ (forward) and 5′-CCA TGT TTT GAC CAA TGC TG-3′ (reverse); HO1, 5′-TCT TGC CTG GCT CTC TTC TC-3′ (forward) and 5′- GTC GTG GTC AGT CAA CAT GG -3′ (reverse); 18 S ribosomal RNA (18S), 5′-CTG AGA AAC GGC TAC CAC ATC-3′ (forward) and 5′-CGC TCC CAA GAT CCA ACT AC-3′ (reverse).

    Electrophoresis:

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers. .. The PCR reaction was performed at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min, with the following primers; hCOX-2 forward 5′- ATCTACCCTCCTCAAGTCCC-3′and reverse 5′- TACCAGAAGGGCAGGATACAG-3′, actin forward 5′- GCTCACGGAGGCACCCCTGAA -3′and reverse 5′- CTGATAGGACATTGTTAGCAT -3′, miR-16 forward 5′- TAGCAGCACGTAAATATTGGCG -3′and the universal reverse primer provided in the NCode™ miRNA first-strand cDNA synthesis kit (Invitrogen), U6 snRNA forward 5′- CTTCGGCAGCACATATACT -3′and reverse 5′- AAAATATGGAACGCTTCACG -3′.

    RNA Extraction:

    Article Title: Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism
    Article Snippet: Paragraph title: 2.6. RNA Extraction and cDNA Synthesis ... Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer's instructions and quantified by measuring the absorbance at 260 nm.

    Article Title: Dysregulation of Lipid Metabolism in Mkp-1 Deficient Mice during Gram-Negative Sepsis
    Article Snippet: Paragraph title: 4.4. Liver RNA Extraction ... Total RNA was extracted from frozen liver tissues using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA), solubilized in UltraPure RNase/DNase-free water (Thermo Fisher Scientific), and quantified by using NanoDrop ND-1000 spectrophotometer (Marshall Scientific, Hampton, NH, USA).

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: Paragraph title: RNA Extraction and Quantitative Real-time PCR Analysis ... Total RNA from HCC cells or human biopsies was extracted by using TRIzol reagent (Invitrogen, Grand Island, NY, USA).

    Article Title: DOX-Vit D, a Novel Doxorubicin Delivery Approach, Inhibits Human Osteosarcoma Cell Proliferation by Inducing Apoptosis While Inhibiting Akt and mTOR Signaling Pathways
    Article Snippet: Paragraph title: 2.5. RNA Extraction and cDNA Synthesis ... Total RNA was extracted using TRIzol reagent (Invitrogen® , Carlsbad, CA, USA) as described previously [ ].

    Agarose Gel Electrophoresis:

    Article Title: Inducible expression of beta defensins by human respiratory epithelial cells exposed to Aspergillus fumigatus organisms
    Article Snippet: Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions. .. Total RNA was isolated with TRIzol Reagent (Invitrogen, Cat N 15596-026) according to the manufacturer's instructions.

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions. .. The primers used in this study were as follows: human p27 (forward, 5′-ACC CGC CCG AGG AGG AAG ATG T -3′; reverse, 5′-GCG CGG GGG CCT GTA GTA GAA C -3′), human FOXO1 (forward, 5′-AAC CTG GCA TTA CAG TTG GCC -3′; reverse, 5′-AAA TGC AGG AGG CAT GAC TAC GT -3′), human ETS2 (forward, 5′-AGC GTC ACC TAC TGC TCT GTC A -3′; reverse, 5′-CCG TTG CAC ATC CAG CAA -3′), and human β-actin (forward, 5′-CTC CAT CCT GGC CTC GCT GT -3′; reverse, 5′-GCT GTC ACC TTC ACC GTT CC -3′).

    Spectrophotometry:

    Article Title: Dysregulation of Lipid Metabolism in Mkp-1 Deficient Mice during Gram-Negative Sepsis
    Article Snippet: In brief, the liver lipid levels were scored as: grade 0 for < 5% hepatocytes without lipid droplets; grade 1 for 5–33% of hepatocytes containing visible lipid droplets; grade 2 for fatty hepatocytes occupying 33–66% of the hepatic parenchyma; or grade 3 for > 66% hepatocytes containing lipid droplets. .. Total RNA was extracted from frozen liver tissues using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA), solubilized in UltraPure RNase/DNase-free water (Thermo Fisher Scientific), and quantified by using NanoDrop ND-1000 spectrophotometer (Marshall Scientific, Hampton, NH, USA). .. For RNA-seq analyses, 1 µg total RNA was used as starting material.

    Immunoprecipitation:

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: Paragraph title: Immunoprecipitation and PCR Analysis ... The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers.

    CTG Assay:

    Article Title: NF-κB p65 Overexpression Promotes Bladder Cancer Cell Migration via FBW7-Mediated Degradation of RhoGDIα Protein
    Article Snippet: Total RNA was extracted by using the TRIzol reagent (Invitrogen, Grand Island, NY) as described in the manufacturer's instructions. .. Specific primers (Invitrogen, Grand Island, NY) were used for PCR amplification.

    Article Title: Mice Overexpressing Both Non-Mutated Human SOD1 and Mutated SOD1G93A Genes: A Competent Experimental Model for Studying Iron Metabolism in Amyotrophic Lateral Sclerosis
    Article Snippet: Total RNA was extracted using the TRIzol reagent (Invitrogen). .. 0.5 μg (spinal cord), 1 μg (gastrocnemius) or 2 μg (liver, broadest dorsal muscle) of total RNA was reverse-transcribed using random hexamers and Transcription First Strand cDNA Synthesis Kit (Roche).

    Article Title: ATG7 Overexpression Is Crucial for Tumorigenic Growth of Bladder Cancer In Vitro and In Vivo by Targeting the ETS2/miRNA196b/FOXO1/p27 Axis
    Article Snippet: Total RNA was extracted using TRIzol reagent (Invitrogen) as described in the manufacturer’s instructions. .. Specific primers (Invitrogen) were used for PCR amplification.

    Article Title: The NAD(P)H Oxidase Homolog Nox4 Modulates Insulin-Stimulated Generation of H2O2 and Plays an Integral Role in Insulin Signal Transduction
    Article Snippet: For Northern analysis, total RNA was isolated from differentiated 3T3-L1 adipocytes using the TRIzol reagent (Invitrogen). .. RNA was separated electrophoretically on formaldehyde-agarose gels, transferred to Hybond-N+ membrane (Amersham Biosciences), and hybridized with C-terminal cDNA probes of murine Nox1, Nox2, and Nox4 according to the manufacturer's recommendations (NorthernMax; Ambion, Austin, Tex.). cDNA probes were synthesized using the RT-PCR method (Invitrogen) and sequenced before probing to Hybond-N+ membranes to confirm their sequence specificity.

    Staining:

    Article Title: Cyclooxygenase-2 Is a Target of MicroRNA-16 in Human Hepatoma Cells
    Article Snippet: The RNA was purified using TRIzol reagent (Invitrogen, Carlsbad, CA), reverse transcriptased and PCR amplified with COX-2, miR-16, U6 or actin primers. .. The PCR reaction was performed at 95°C for 5 min, followed by 30 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min, with the following primers; hCOX-2 forward 5′- ATCTACCCTCCTCAAGTCCC-3′and reverse 5′- TACCAGAAGGGCAGGATACAG-3′, actin forward 5′- GCTCACGGAGGCACCCCTGAA -3′and reverse 5′- CTGATAGGACATTGTTAGCAT -3′, miR-16 forward 5′- TAGCAGCACGTAAATATTGGCG -3′and the universal reverse primer provided in the NCode™ miRNA first-strand cDNA synthesis kit (Invitrogen), U6 snRNA forward 5′- CTTCGGCAGCACATATACT -3′and reverse 5′- AAAATATGGAACGCTTCACG -3′.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    Thermo Fisher trizol reagent
    Differentially expressed genes in Mkp-1 +/+ and Mkp-1 −/− mice before and following E. coli infection. Mkp-1 +/+ and Mkp-1 −/− mice were either infected i.v. with E. coli at a dose of 2.5 × 10 7 CFU/g of body weight or injected with PBS (controls). Mice were euthanized after 24 h, and total <t>RNA</t> was isolated from the livers of four mice using <t>Trizol</t> for RNA-seq analyses. Volcano plots show the extent of differentially expressed gene (adjusted p value
    Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2019-09
    89/100 stars
      Buy from Supplier

    99
    Thermo Fisher trizol ls reagent
    Characterization of HBV DNA and <t>RNA</t> in sera of CHB patients. (A and B) Analyses of serum viral DNA from CHB patients by Southern blotting. Viral DNA was extracted from serum samples obtained from forty-five chronic hepatitis B patients (20% of input sample used for protein A/G agarose beads pulldown) and subjected to Southern blot analysis. Alternatively, these samples were first incubated with protein A/G agarose beads, and then viral DNA in the pulldown mixtures was analyzed by Southern blotting. Serum samples selected for further examining are marked with arrows, and samples with SS DNA detection are labeled with asterisks. (C) Protein A/G agarose bead pulldown of viral particles. Sera (25 μl each) from CHB patients 37, 38, 14, and 35 (M1, mixture one) or from patients 17, 21, 42, and 44 (M2, mixture two) were pooled and incubated with protein A/G agarose beads. Viral DNA in input sera, protein A/G bead pulldown mixtures (beads), and the remaining supernatants (sup.) were extracted and subjected to Southern blot analysis. (D) Northern blot detection of serum viral RNA from patients 37, 38, 14, 35, 17, 21, 42, and 44. Total RNA were extracted from serum samples by <t>TRIzol</t> reagent and treated with DNase I before Northern blot analysis. (E to G) Southern blot analyses of viral DNA from selected samples. Viral DNA was separated by electrophoresis through TAE or alkaline agarose gels, followed by Southern blot detection with the indicated riboprobes.
    Trizol Ls Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 318 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol ls reagent/product/Thermo Fisher
    Average 99 stars, based on 318 article reviews
    Price from $9.99 to $1999.99
    trizol ls reagent - by Bioz Stars, 2019-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Differentially expressed genes in Mkp-1 +/+ and Mkp-1 −/− mice before and following E. coli infection. Mkp-1 +/+ and Mkp-1 −/− mice were either infected i.v. with E. coli at a dose of 2.5 × 10 7 CFU/g of body weight or injected with PBS (controls). Mice were euthanized after 24 h, and total RNA was isolated from the livers of four mice using Trizol for RNA-seq analyses. Volcano plots show the extent of differentially expressed gene (adjusted p value

    Journal: International Journal of Molecular Sciences

    Article Title: Dysregulation of Lipid Metabolism in Mkp-1 Deficient Mice during Gram-Negative Sepsis

    doi: 10.3390/ijms19123904

    Figure Lengend Snippet: Differentially expressed genes in Mkp-1 +/+ and Mkp-1 −/− mice before and following E. coli infection. Mkp-1 +/+ and Mkp-1 −/− mice were either infected i.v. with E. coli at a dose of 2.5 × 10 7 CFU/g of body weight or injected with PBS (controls). Mice were euthanized after 24 h, and total RNA was isolated from the livers of four mice using Trizol for RNA-seq analyses. Volcano plots show the extent of differentially expressed gene (adjusted p value

    Article Snippet: Total RNA was extracted from frozen liver tissues using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA), solubilized in UltraPure RNase/DNase-free water (Thermo Fisher Scientific), and quantified by using NanoDrop ND-1000 spectrophotometer (Marshall Scientific, Hampton, NH, USA).

    Techniques: Mouse Assay, Infection, Injection, Isolation, RNA Sequencing Assay

    Liver mRNA expression levels of Cd36 in control and E. coli -infected mice. Control and E. coli -infected mice (2.5 × 10 7 CFU/g of body weight, i.v.) were euthanized 24 h post infection. Total RNA was isolated from the livers using Trizol. Cd36 mRNA levels were assessed via qRT-PCR. Expression in un-infected Mkp-1 +/+ mice was set as 1. Values represent means ± S.E. from 4–7 animals in each group. The results were analyzed by two-way ANOVA. Groups marked with distinct letters above the bars indicate significant differences ( p

    Journal: International Journal of Molecular Sciences

    Article Title: Dysregulation of Lipid Metabolism in Mkp-1 Deficient Mice during Gram-Negative Sepsis

    doi: 10.3390/ijms19123904

    Figure Lengend Snippet: Liver mRNA expression levels of Cd36 in control and E. coli -infected mice. Control and E. coli -infected mice (2.5 × 10 7 CFU/g of body weight, i.v.) were euthanized 24 h post infection. Total RNA was isolated from the livers using Trizol. Cd36 mRNA levels were assessed via qRT-PCR. Expression in un-infected Mkp-1 +/+ mice was set as 1. Values represent means ± S.E. from 4–7 animals in each group. The results were analyzed by two-way ANOVA. Groups marked with distinct letters above the bars indicate significant differences ( p

    Article Snippet: Total RNA was extracted from frozen liver tissues using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA), solubilized in UltraPure RNase/DNase-free water (Thermo Fisher Scientific), and quantified by using NanoDrop ND-1000 spectrophotometer (Marshall Scientific, Hampton, NH, USA).

    Techniques: Expressing, Infection, Mouse Assay, Isolation, Quantitative RT-PCR

    Hepatic mRNA expression of lipogenesis genes before and after E. coli infection. Mkp-1 +/+ and Mkp-1 −/− mice were either infected i.v. with E. coli at a dose of 2.5 × 10 7 CFU/g of body weight or injected with PBS. Mice were euthanized after 24 h, and total RNA was isolated from the livers using Trizol. mRNA expression for different genes was assessed based on the RNA-seq data set, or quantified via qRT-PCR. Expression in un-infected Mkp-1 +/+ mice was set as 1. Values represent means ± S.E. from 4 animals for RNA-seq and 4–7 animals for qRT-PCR in each group. ( A ) Expression levels of lipogenic regulator genes based on RNA-seq; ( B ) Expression levels of Mtor and Pparg based on qRT-PCR; ( C ) Expression levels of lipogenic genes based on RNA-seq. Values in the graphs were compared by two-way ANOVA. Groups marked with distinct letters above the bars indicate significant differences ( p

    Journal: International Journal of Molecular Sciences

    Article Title: Dysregulation of Lipid Metabolism in Mkp-1 Deficient Mice during Gram-Negative Sepsis

    doi: 10.3390/ijms19123904

    Figure Lengend Snippet: Hepatic mRNA expression of lipogenesis genes before and after E. coli infection. Mkp-1 +/+ and Mkp-1 −/− mice were either infected i.v. with E. coli at a dose of 2.5 × 10 7 CFU/g of body weight or injected with PBS. Mice were euthanized after 24 h, and total RNA was isolated from the livers using Trizol. mRNA expression for different genes was assessed based on the RNA-seq data set, or quantified via qRT-PCR. Expression in un-infected Mkp-1 +/+ mice was set as 1. Values represent means ± S.E. from 4 animals for RNA-seq and 4–7 animals for qRT-PCR in each group. ( A ) Expression levels of lipogenic regulator genes based on RNA-seq; ( B ) Expression levels of Mtor and Pparg based on qRT-PCR; ( C ) Expression levels of lipogenic genes based on RNA-seq. Values in the graphs were compared by two-way ANOVA. Groups marked with distinct letters above the bars indicate significant differences ( p

    Article Snippet: Total RNA was extracted from frozen liver tissues using Trizol reagent (Thermo Fisher Scientific, Waltham, MA, USA), solubilized in UltraPure RNase/DNase-free water (Thermo Fisher Scientific), and quantified by using NanoDrop ND-1000 spectrophotometer (Marshall Scientific, Hampton, NH, USA).

    Techniques: Expressing, Infection, Mouse Assay, Injection, Isolation, RNA Sequencing Assay, Quantitative RT-PCR

    Estrogen doesn’t modulate steady state mRNA message of MDR-1 but decreases protein level In this experiment, the control (vehicle only) and estrogen treated animals’ ovaries were removed and placed in TRizol for RNA extraction. RNA was then used to make complementary DNA. Quantitative Real-Time Polymerase Chain Reaction was performed using (ERβ) as a control that indicated the mice did actually receive the appropriate dosing. All samples were standardized to β-actin mRNA. The immunoblots were done by using whole ovary lysates of control and estrogen treated mice. Dosages of 1 μg and 10 μg were significantly decreased compared to controls. BCRP did not show a difference with our qPCR data, but we attempted to do immunoblotting without success due to unsuitable antibodies

    Journal: Contraception and Reproductive Medicine

    Article Title: Ovarian hormones modulate multidrug resistance transporters in the ovary

    doi: 10.1186/s40834-018-0076-7

    Figure Lengend Snippet: Estrogen doesn’t modulate steady state mRNA message of MDR-1 but decreases protein level In this experiment, the control (vehicle only) and estrogen treated animals’ ovaries were removed and placed in TRizol for RNA extraction. RNA was then used to make complementary DNA. Quantitative Real-Time Polymerase Chain Reaction was performed using (ERβ) as a control that indicated the mice did actually receive the appropriate dosing. All samples were standardized to β-actin mRNA. The immunoblots were done by using whole ovary lysates of control and estrogen treated mice. Dosages of 1 μg and 10 μg were significantly decreased compared to controls. BCRP did not show a difference with our qPCR data, but we attempted to do immunoblotting without success due to unsuitable antibodies

    Article Snippet: Total RNA was extracted from whole mouse ovaries (n = 3) using TRIzol reagent (ThermoFisher Scientific Waltham, MA) in accordance with manufacturer’s protocol.

    Techniques: RNA Extraction, Real-time Polymerase Chain Reaction, Mouse Assay, Western Blot

    Estrogen doesn’t modulate steady state mRNA message of MDR-1 but decreases protein level In this experiment, the control (vehicle only) and estrogen treated animals’ ovaries were removed and placed in TRizol for RNA extraction. RNA was then used to make complementary DNA. Quantitative Real-Time Polymerase Chain Reaction was performed using (ERβ) as a control that indicated the mice did actually receive the appropriate dosing. All samples were standardized to β-actin mRNA. The immunoblots were done by using whole ovary lysates of control and estrogen treated mice. Dosages of 1 μg and 10 μg were significantly decreased compared to controls. BCRP did not show a difference with our qPCR data, but we attempted to do immunoblotting without success due to unsuitable antibodies

    Journal: Contraception and Reproductive Medicine

    Article Title: Ovarian hormones modulate multidrug resistance transporters in the ovary

    doi: 10.1186/s40834-018-0076-7

    Figure Lengend Snippet: Estrogen doesn’t modulate steady state mRNA message of MDR-1 but decreases protein level In this experiment, the control (vehicle only) and estrogen treated animals’ ovaries were removed and placed in TRizol for RNA extraction. RNA was then used to make complementary DNA. Quantitative Real-Time Polymerase Chain Reaction was performed using (ERβ) as a control that indicated the mice did actually receive the appropriate dosing. All samples were standardized to β-actin mRNA. The immunoblots were done by using whole ovary lysates of control and estrogen treated mice. Dosages of 1 μg and 10 μg were significantly decreased compared to controls. BCRP did not show a difference with our qPCR data, but we attempted to do immunoblotting without success due to unsuitable antibodies

    Article Snippet: Total RNA was extracted from whole mouse ovaries ( n = 3) using TRIzol reagent (ThermoFisher Scientific Waltham, MA) in accordance with manufacturer’s protocol.

    Techniques: RNA Extraction, Real-time Polymerase Chain Reaction, Mouse Assay, Western Blot

    Characterization of HBV DNA and RNA in sera of CHB patients. (A and B) Analyses of serum viral DNA from CHB patients by Southern blotting. Viral DNA was extracted from serum samples obtained from forty-five chronic hepatitis B patients (20% of input sample used for protein A/G agarose beads pulldown) and subjected to Southern blot analysis. Alternatively, these samples were first incubated with protein A/G agarose beads, and then viral DNA in the pulldown mixtures was analyzed by Southern blotting. Serum samples selected for further examining are marked with arrows, and samples with SS DNA detection are labeled with asterisks. (C) Protein A/G agarose bead pulldown of viral particles. Sera (25 μl each) from CHB patients 37, 38, 14, and 35 (M1, mixture one) or from patients 17, 21, 42, and 44 (M2, mixture two) were pooled and incubated with protein A/G agarose beads. Viral DNA in input sera, protein A/G bead pulldown mixtures (beads), and the remaining supernatants (sup.) were extracted and subjected to Southern blot analysis. (D) Northern blot detection of serum viral RNA from patients 37, 38, 14, 35, 17, 21, 42, and 44. Total RNA were extracted from serum samples by TRIzol reagent and treated with DNase I before Northern blot analysis. (E to G) Southern blot analyses of viral DNA from selected samples. Viral DNA was separated by electrophoresis through TAE or alkaline agarose gels, followed by Southern blot detection with the indicated riboprobes.

    Journal: Journal of Virology

    Article Title: Extracellular Hepatitis B Virus RNAs Are Heterogeneous in Length and Circulate as Capsid-Antibody Complexes in Addition to Virions in Chronic Hepatitis B Patients

    doi: 10.1128/JVI.00798-18

    Figure Lengend Snippet: Characterization of HBV DNA and RNA in sera of CHB patients. (A and B) Analyses of serum viral DNA from CHB patients by Southern blotting. Viral DNA was extracted from serum samples obtained from forty-five chronic hepatitis B patients (20% of input sample used for protein A/G agarose beads pulldown) and subjected to Southern blot analysis. Alternatively, these samples were first incubated with protein A/G agarose beads, and then viral DNA in the pulldown mixtures was analyzed by Southern blotting. Serum samples selected for further examining are marked with arrows, and samples with SS DNA detection are labeled with asterisks. (C) Protein A/G agarose bead pulldown of viral particles. Sera (25 μl each) from CHB patients 37, 38, 14, and 35 (M1, mixture one) or from patients 17, 21, 42, and 44 (M2, mixture two) were pooled and incubated with protein A/G agarose beads. Viral DNA in input sera, protein A/G bead pulldown mixtures (beads), and the remaining supernatants (sup.) were extracted and subjected to Southern blot analysis. (D) Northern blot detection of serum viral RNA from patients 37, 38, 14, 35, 17, 21, 42, and 44. Total RNA were extracted from serum samples by TRIzol reagent and treated with DNase I before Northern blot analysis. (E to G) Southern blot analyses of viral DNA from selected samples. Viral DNA was separated by electrophoresis through TAE or alkaline agarose gels, followed by Southern blot detection with the indicated riboprobes.

    Article Snippet: In addition to the SDS-proteinase K method, viral RNA was also extracted with TRIzol LS reagent according to the manufacturer’s instructions (Thermo Fisher Scientific).

    Techniques: Southern Blot, Incubation, Labeling, Northern Blot, Electrophoresis

    Mapping and identifying 3′ ends of extracellular HBV RNAs. (A) Northern blot detection of extracellular HBV RNAs with various riboprobes. Viral RNA from cytoplasmic (C) nucleocapsids (lanes 2, 5, 8, 11, 14, and 17) or culture supernatant (S) (lanes 3, 6, 9, 12, 15, and 18) of HepAD38 cells was extracted with TRIzol reagent and treated with DNase I before Northern blot analysis with plus-strand-specific riboprobes spanning the HBV genome as indicated. pgRNA was used as a reference, and map coordinates were numbered according to the sequence of the HBV genome (genotype D, accession number AJ344117.1 ). (B) Identification of 3′ ends of extracellular HBV RNAs. 3′ Ends of extracellular HBV RNAs were identified by the 3′ RACE method using different HBV-specific anchor primers (the same 5′ primers used for generating templates for producing riboprobes used in panel A, lower). Identified 3′ ends were numbered as described above, and numbers in parentheses indicate the amount of clones with the same 3′ ends. The asterisk indicates unknown nucleic acid copurified with intracellular capsid-associated viral RNA by TRIzol reagent. FL, full-length; Cap, 5′ cap of pregenomic RNA; pA, the polyadenylation site; An, poly(A) tail.

    Journal: Journal of Virology

    Article Title: Extracellular Hepatitis B Virus RNAs Are Heterogeneous in Length and Circulate as Capsid-Antibody Complexes in Addition to Virions in Chronic Hepatitis B Patients

    doi: 10.1128/JVI.00798-18

    Figure Lengend Snippet: Mapping and identifying 3′ ends of extracellular HBV RNAs. (A) Northern blot detection of extracellular HBV RNAs with various riboprobes. Viral RNA from cytoplasmic (C) nucleocapsids (lanes 2, 5, 8, 11, 14, and 17) or culture supernatant (S) (lanes 3, 6, 9, 12, 15, and 18) of HepAD38 cells was extracted with TRIzol reagent and treated with DNase I before Northern blot analysis with plus-strand-specific riboprobes spanning the HBV genome as indicated. pgRNA was used as a reference, and map coordinates were numbered according to the sequence of the HBV genome (genotype D, accession number AJ344117.1 ). (B) Identification of 3′ ends of extracellular HBV RNAs. 3′ Ends of extracellular HBV RNAs were identified by the 3′ RACE method using different HBV-specific anchor primers (the same 5′ primers used for generating templates for producing riboprobes used in panel A, lower). Identified 3′ ends were numbered as described above, and numbers in parentheses indicate the amount of clones with the same 3′ ends. The asterisk indicates unknown nucleic acid copurified with intracellular capsid-associated viral RNA by TRIzol reagent. FL, full-length; Cap, 5′ cap of pregenomic RNA; pA, the polyadenylation site; An, poly(A) tail.

    Article Snippet: In addition to the SDS-proteinase K method, viral RNA was also extracted with TRIzol LS reagent according to the manufacturer’s instructions (Thermo Fisher Scientific).

    Techniques: Northern Blot, Sequencing, Clone Assay