trizol reagent  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher trizol reagent
    Licochalcone A-induced apoptosis in KB oral cancer cells is mediated by expression and activation of caspases. (A) Total <t>RNA</t> from KB oral cancer cells stimulated with licochalcone A for 24 h was isolated using <t>TRIzol</t> reagent. cDNA synthesis was carried out with 1 μg total RNA using reverse transcriptase. qPCR was performed using synthesized cDNA. The amplified PCR product was then electrophoresed on 1% agarose gel. (B) Licochalcone A activated the extrinsic apoptosis signaling pathway in KB oral cancer cells. KB oral cancer cells were stimulated with 25 and 50 μM licochalcone A for 24 h, harvested and lysed using cell lysate buffer. Protein quantification and western blotting were performed. qPCR, quantitative PCR.
    Trizol Reagent, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol reagent/product/Thermo Fisher
    Average 99 stars, based on 37 article reviews
    Price from $9.99 to $1999.99
    trizol reagent - by Bioz Stars, 2022-10
    99/100 stars

    Images

    1) Product Images from "Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway"

    Article Title: Licochalcone A induces apoptosis in KB human oral cancer cells via a caspase-dependent FasL signaling pathway

    Journal: Oncology Reports

    doi: 10.3892/or.2013.2929

    Licochalcone A-induced apoptosis in KB oral cancer cells is mediated by expression and activation of caspases. (A) Total RNA from KB oral cancer cells stimulated with licochalcone A for 24 h was isolated using TRIzol reagent. cDNA synthesis was carried out with 1 μg total RNA using reverse transcriptase. qPCR was performed using synthesized cDNA. The amplified PCR product was then electrophoresed on 1% agarose gel. (B) Licochalcone A activated the extrinsic apoptosis signaling pathway in KB oral cancer cells. KB oral cancer cells were stimulated with 25 and 50 μM licochalcone A for 24 h, harvested and lysed using cell lysate buffer. Protein quantification and western blotting were performed. qPCR, quantitative PCR.
    Figure Legend Snippet: Licochalcone A-induced apoptosis in KB oral cancer cells is mediated by expression and activation of caspases. (A) Total RNA from KB oral cancer cells stimulated with licochalcone A for 24 h was isolated using TRIzol reagent. cDNA synthesis was carried out with 1 μg total RNA using reverse transcriptase. qPCR was performed using synthesized cDNA. The amplified PCR product was then electrophoresed on 1% agarose gel. (B) Licochalcone A activated the extrinsic apoptosis signaling pathway in KB oral cancer cells. KB oral cancer cells were stimulated with 25 and 50 μM licochalcone A for 24 h, harvested and lysed using cell lysate buffer. Protein quantification and western blotting were performed. qPCR, quantitative PCR.

    Techniques Used: Expressing, Activation Assay, Isolation, Real-time Polymerase Chain Reaction, Synthesized, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Western Blot

    2) Product Images from "Survivin counteracts the therapeutic effect of microtubule de-stabilizers by stabilizing tubulin polymers"

    Article Title: Survivin counteracts the therapeutic effect of microtubule de-stabilizers by stabilizing tubulin polymers

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-8-43

    Down-regulation of survivin in KB and KB- L30 cells by siRNA . ( A ) Cells were seeded on 24-well plates overnight and transfected with siR-C (scramble control) or siR-S (survivin specific) for 36 h. Total RNA was extracted by Trizol reagent. RT-PCR was performed and PCR products were resolved by DNA electrophoresis. GAPDH was used as an internal control ( B ) Cells were seeded on 8-well chamber slides overnight and transfected with siR-C (scramble control) or siR-S (survivin specific) for 48 h. Cells were labeled with FITC-coupled anti-human survivin antibody and counter-stained with DAPI nucleus stain. Slides were analyzed using fluorescent microscopy. ( C ) Cells were seeded on 6-well plates overnight and transfected with siR-C or siR-S for 48 h. Cell lysate were extracted and proteins were resolved by SDS-PAGE. Western blot analysis was performed as described in Materials and Methods.
    Figure Legend Snippet: Down-regulation of survivin in KB and KB- L30 cells by siRNA . ( A ) Cells were seeded on 24-well plates overnight and transfected with siR-C (scramble control) or siR-S (survivin specific) for 36 h. Total RNA was extracted by Trizol reagent. RT-PCR was performed and PCR products were resolved by DNA electrophoresis. GAPDH was used as an internal control ( B ) Cells were seeded on 8-well chamber slides overnight and transfected with siR-C (scramble control) or siR-S (survivin specific) for 48 h. Cells were labeled with FITC-coupled anti-human survivin antibody and counter-stained with DAPI nucleus stain. Slides were analyzed using fluorescent microscopy. ( C ) Cells were seeded on 6-well plates overnight and transfected with siR-C or siR-S for 48 h. Cell lysate were extracted and proteins were resolved by SDS-PAGE. Western blot analysis was performed as described in Materials and Methods.

    Techniques Used: Transfection, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Labeling, Staining, Microscopy, SDS Page, Western Blot

    3) Product Images from "Comparison of RNA Isolation Methods From Insect Larvae"

    Article Title: Comparison of RNA Isolation Methods From Insect Larvae

    Journal: Journal of Insect Science

    doi: 10.1093/jisesa/ieu130

    Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Agilent 2100 Bioanalyser electropherogram graphs showing RNA extracted using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent and the SV Total RNA kit Markers can be seen at 25 nt, 18S RNA subunit at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used:

    Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.
    Figure Legend Snippet: Pseudo-gel image produced using an Agilent 2100 Bioanalyser, showing the results of RNA extracted from T. leucotreta using the RNeasy Mini Kit, a CTAB-based protocol, TRIzol reagent, and the SV Total RNA kit. The 18S RNA subunit is visible at 2,000 nt, the 28S large subunit at 3,800 nt, and a combination of 5S, 5.8S, and tRNAs at ± 180 nt.

    Techniques Used: Produced

    4) Product Images from "Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid"

    Article Title: Extractions of High Quality RNA from the Seeds of Jerusalem Artichoke and Other Plant Species with High Levels of Starch and Lipid

    Journal: Plants

    doi: 10.3390/plants2020302

    Agarose gels showing the extractions of total RNA using five RNA isolation methods (R1–R5) from five dry seeds of two Jerusalem artichoke accessions (HEL53, the top panel; JA37, the bottom panel). The five isolation methods are the TRIzol ® (Invitrogen), R1; Plant RNeasy mini kit (Qaigen), R2; Method of Wang et al. [ 7 ], R3; MLT method, R4; and MMY method, R5. M is 100 bp DNA ladder plus (Vivantis). The five dry seed samples are numerically labeled from 1 to 5.
    Figure Legend Snippet: Agarose gels showing the extractions of total RNA using five RNA isolation methods (R1–R5) from five dry seeds of two Jerusalem artichoke accessions (HEL53, the top panel; JA37, the bottom panel). The five isolation methods are the TRIzol ® (Invitrogen), R1; Plant RNeasy mini kit (Qaigen), R2; Method of Wang et al. [ 7 ], R3; MLT method, R4; and MMY method, R5. M is 100 bp DNA ladder plus (Vivantis). The five dry seed samples are numerically labeled from 1 to 5.

    Techniques Used: Isolation, Labeling

    5) Product Images from "Homologous Recombination Occurs in Entamoeba and Is Enhanced during Growth Stress and Stage Conversion"

    Article Title: Homologous Recombination Occurs in Entamoeba and Is Enhanced during Growth Stress and Stage Conversion

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0074465

    Expression of meiotic and HR specific genes during serum starvation in E. histolytica and encystation in E. invadens . (A) Real Time PCR analysis in E. histolytica . Total RNA was extracted at different time points (0, 6, 12, 18 and 24 h) during serum starvation using TRIZOL reagent ( Invitro gen). cDNA was prepared by using Superscript III reverse transcriptase and qRT-PCR was performed with SYBR Green dye as a probe. 18S rDNA was used for normalization. The relative mRNA levels were expressed against those of trophozoites as 1. (B) Real Time PCR analysis in E. invadens . Total RNA was extracted at different time points (0, 8, 16, 24, 40, 48, and 72 h) during encystation and qRT-PCR was performed. mRNA levels of each gene were expressed relative to 0 h (beginning of encystation), shown in the bar graph. Size of all genes was checked by northern blotting (data not shown) by using appropriate probe, amplified by gene specific primers (Table S1in file S1 ). SPO11 , DMC1 and MND1 are meiotic specific genes.
    Figure Legend Snippet: Expression of meiotic and HR specific genes during serum starvation in E. histolytica and encystation in E. invadens . (A) Real Time PCR analysis in E. histolytica . Total RNA was extracted at different time points (0, 6, 12, 18 and 24 h) during serum starvation using TRIZOL reagent ( Invitro gen). cDNA was prepared by using Superscript III reverse transcriptase and qRT-PCR was performed with SYBR Green dye as a probe. 18S rDNA was used for normalization. The relative mRNA levels were expressed against those of trophozoites as 1. (B) Real Time PCR analysis in E. invadens . Total RNA was extracted at different time points (0, 8, 16, 24, 40, 48, and 72 h) during encystation and qRT-PCR was performed. mRNA levels of each gene were expressed relative to 0 h (beginning of encystation), shown in the bar graph. Size of all genes was checked by northern blotting (data not shown) by using appropriate probe, amplified by gene specific primers (Table S1in file S1 ). SPO11 , DMC1 and MND1 are meiotic specific genes.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, SYBR Green Assay, Northern Blot, Amplification

    6) Product Images from "Chemokine Production and Leukocyte Recruitment to the Lungs of Paracoccidioides brasiliensis-Infected Mice Is Modulated by Interferon-?"

    Article Title: Chemokine Production and Leukocyte Recruitment to the Lungs of Paracoccidioides brasiliensis-Infected Mice Is Modulated by Interferon-?

    Journal: The American Journal of Pathology

    doi:

    Paracoccidioides brasiliensis induces a Th1 chemokines and chemokine receptor patterns in the lungs of infected mice. Lungs of WT and GKO mice were harvested at different times after Pb18 infection and total RNA was extracted with Trizol reagent. The mRNA expression of chemokines and chemokine receptors was evaluated by RT-PCR, the amplification products were separated by electrophoresis in acrylamide gel and silver-stained. These data are representative of three independent experiments.
    Figure Legend Snippet: Paracoccidioides brasiliensis induces a Th1 chemokines and chemokine receptor patterns in the lungs of infected mice. Lungs of WT and GKO mice were harvested at different times after Pb18 infection and total RNA was extracted with Trizol reagent. The mRNA expression of chemokines and chemokine receptors was evaluated by RT-PCR, the amplification products were separated by electrophoresis in acrylamide gel and silver-stained. These data are representative of three independent experiments.

    Techniques Used: Infection, Mouse Assay, Expressing, Reverse Transcription Polymerase Chain Reaction, Amplification, Electrophoresis, Acrylamide Gel Assay, Staining

    7) Product Images from "An essential EBV latent antigen 3C binds Bcl6 for targeted degradation and cell proliferation"

    Article Title: An essential EBV latent antigen 3C binds Bcl6 for targeted degradation and cell proliferation

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1006500

    EBNA3C regulates Bcl6 mRNA expression through inhibition of its promoter activity. A) 5 million BJAB, BJAB7, BJAB10, LCL1 and LCL2 cells were harvested and extracted total RNA using Trizol reagent. Then cDNA was prepared with reverse transcriptase kit, and detected Bcl6 mRNA expression by quantitative Real-time PCR analysis (SYBR green). GAPDH was set as an internal reference. Each sample was determined in triplicate. B) EBNA3C knock-down (sh-E3C) stable LCL1 or control (sh-Ctrl) LCL1 cells were harvested and Bcl6 mRNA expression was detected using Real-time PCR as mentioned. C) 10 million BJAB10 cells were transfected with specific EBNA3C (sh-E3C) or control (sh-Ctrl) short hairpin RNA. At 48 hours post-transfection, total RNA was extracted, reverse-transcribed, followed by quantitative Real-time PCR analysis. Meanwhile, EBNA3C expression was also detected by western blot analysis. D) HEK293T cells were transfected with the reporter constructs containing wild-type Bcl6 promoter (pLA/B9) and increasing amount of Myc-EBNA3C. Cells were collected and lysed in lysis buffer at 48 hours post-transfection. Luciferase activity was measured according to the dual-luciferase reporter assay kit. Mean values and standard deviations of two independent experiments were presented. Cell lysate was resolved by 10% SDS-PAGE in order to check EBNA3C expression. GAPDH western blot was done as an internal loading control. E) HEK293T cells were transfected with wild-type Bcl6 promoter reporter plasmids in combination with different expression constructs as indicated. Cells were collected and lysed, then the lysate were used to detect luciferase activity as previously described.
    Figure Legend Snippet: EBNA3C regulates Bcl6 mRNA expression through inhibition of its promoter activity. A) 5 million BJAB, BJAB7, BJAB10, LCL1 and LCL2 cells were harvested and extracted total RNA using Trizol reagent. Then cDNA was prepared with reverse transcriptase kit, and detected Bcl6 mRNA expression by quantitative Real-time PCR analysis (SYBR green). GAPDH was set as an internal reference. Each sample was determined in triplicate. B) EBNA3C knock-down (sh-E3C) stable LCL1 or control (sh-Ctrl) LCL1 cells were harvested and Bcl6 mRNA expression was detected using Real-time PCR as mentioned. C) 10 million BJAB10 cells were transfected with specific EBNA3C (sh-E3C) or control (sh-Ctrl) short hairpin RNA. At 48 hours post-transfection, total RNA was extracted, reverse-transcribed, followed by quantitative Real-time PCR analysis. Meanwhile, EBNA3C expression was also detected by western blot analysis. D) HEK293T cells were transfected with the reporter constructs containing wild-type Bcl6 promoter (pLA/B9) and increasing amount of Myc-EBNA3C. Cells were collected and lysed in lysis buffer at 48 hours post-transfection. Luciferase activity was measured according to the dual-luciferase reporter assay kit. Mean values and standard deviations of two independent experiments were presented. Cell lysate was resolved by 10% SDS-PAGE in order to check EBNA3C expression. GAPDH western blot was done as an internal loading control. E) HEK293T cells were transfected with wild-type Bcl6 promoter reporter plasmids in combination with different expression constructs as indicated. Cells were collected and lysed, then the lysate were used to detect luciferase activity as previously described.

    Techniques Used: Expressing, Inhibition, Activity Assay, Real-time Polymerase Chain Reaction, SYBR Green Assay, Transfection, shRNA, Western Blot, Construct, Proximity Ligation Assay, Lysis, Luciferase, Reporter Assay, SDS Page

    8) Product Images from "The presence of six potentially pathogenic viruses in pigs suffering from post-weaning multisystemic wasting syndrome"

    Article Title: The presence of six potentially pathogenic viruses in pigs suffering from post-weaning multisystemic wasting syndrome

    Journal: BMC Veterinary Research

    doi: 10.1186/s12917-014-0221-8

    Prevalence of viruses in individual groups of pigs. Viruses were detected in pooled tissue samples (lymph nodes, liver and spleen) of diseased pigs of different age and lymph nodes of healthy animals. Total DNA or RNA was isolated by Chelex resins or TRIzol reagent, respectively. RNA was transcribed into cDNA using random hexamers (PTV) or gene-specific primer (PRRSV) and SuperScript III reverse transcriptase. Viral genomes were detected by PCR, RT-PCR or real-time PCR based on SYBR Green (TTSuV1 and TTSuV2).
    Figure Legend Snippet: Prevalence of viruses in individual groups of pigs. Viruses were detected in pooled tissue samples (lymph nodes, liver and spleen) of diseased pigs of different age and lymph nodes of healthy animals. Total DNA or RNA was isolated by Chelex resins or TRIzol reagent, respectively. RNA was transcribed into cDNA using random hexamers (PTV) or gene-specific primer (PRRSV) and SuperScript III reverse transcriptase. Viral genomes were detected by PCR, RT-PCR or real-time PCR based on SYBR Green (TTSuV1 and TTSuV2).

    Techniques Used: Isolation, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, SYBR Green Assay

    9) Product Images from "Met interacts with EGFR and Ron in canine osteosarcoma"

    Article Title: Met interacts with EGFR and Ron in canine osteosarcoma

    Journal: Veterinary and comparative oncology

    doi: 10.1111/j.1476-5829.2011.00309.x

    Ron and EGFR are expressed in OSA cell lines and tumour specimens. Total RNA was extracted from primary OSA tumour samples or 15 × 10 6 cells using TRIzol® reagent followed by cDNA synthesis with reverse transcriptase-PCR to detect message
    Figure Legend Snippet: Ron and EGFR are expressed in OSA cell lines and tumour specimens. Total RNA was extracted from primary OSA tumour samples or 15 × 10 6 cells using TRIzol® reagent followed by cDNA synthesis with reverse transcriptase-PCR to detect message

    Techniques Used: Polymerase Chain Reaction

    10) Product Images from "Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection"

    Article Title: Minute Virus of Mice Inhibits Transcription of the Cyclin B1 Gene during Infection

    Journal: Journal of Virology

    doi: 10.1128/JVI.00428-17

    Cyclin B1 driven from a heterologous promoter and 3′ UTR is stable during MVM infection, but nascent cyclin B1 RNA production is reduced during infection. (A) Murine A9 cell lines inducibly expressing 3XF-cyclin B1 were generated as described in Materials and Methods. Cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. Cells were induced with doxycycline, as indicated, at the time of release. Cells were harvested at the indicated time points, and total RNA was isolated using TRIzol reagent. Samples were processed for RPA with a probe against 3XF-cyclin B1 (which separately detects FLAG-tagged and endogenous cyclin B1 RNAs) or actin. (B) The inducible murine A9 cell lines described for panel A were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. Cells were induced with doxycycline, as indicated, at the time of release. Cells were harvested at 34 h postinfection, and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. (C) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. At 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. DRB was added at 40 μg/ml at 24 h postinfection and incubated for 3 h. Cells were then washed with PBS and incubated in complete medium for the indicated time points. Total RNA was isolated using TRIzol, and samples were assayed by reverse transcription-qPCR as described in Materials and Methods. Data are presented as relative expression changes for three independent experiments. 18S rRNA was used for normalization of signals.
    Figure Legend Snippet: Cyclin B1 driven from a heterologous promoter and 3′ UTR is stable during MVM infection, but nascent cyclin B1 RNA production is reduced during infection. (A) Murine A9 cell lines inducibly expressing 3XF-cyclin B1 were generated as described in Materials and Methods. Cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. Cells were induced with doxycycline, as indicated, at the time of release. Cells were harvested at the indicated time points, and total RNA was isolated using TRIzol reagent. Samples were processed for RPA with a probe against 3XF-cyclin B1 (which separately detects FLAG-tagged and endogenous cyclin B1 RNAs) or actin. (B) The inducible murine A9 cell lines described for panel A were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. Cells were induced with doxycycline, as indicated, at the time of release. Cells were harvested at 34 h postinfection, and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. (C) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. At 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. DRB was added at 40 μg/ml at 24 h postinfection and incubated for 3 h. Cells were then washed with PBS and incubated in complete medium for the indicated time points. Total RNA was isolated using TRIzol, and samples were assayed by reverse transcription-qPCR as described in Materials and Methods. Data are presented as relative expression changes for three independent experiments. 18S rRNA was used for normalization of signals.

    Techniques Used: Infection, Expressing, Generated, Isolation, Recombinase Polymerase Amplification, Western Blot, Incubation, Real-time Polymerase Chain Reaction

    Cyclin B1 protein and RNA are reduced during MVM infection. (A) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. In a separate experiment, at 15 h postrelease, cells were treated with 200 nM doxorubicin (Doxo) as indicated. Cells were harvested at the indicated time points (T x , with x given in hours), and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. Entry into S phase occurs approximately 12 h after release into complete medium. Virally infected cells harvested at 24 h thus represent an approximately 12-h transit into S phase. (B) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. Cells were harvested at the indicated time points, and total RNA was isolated using TRIzol reagent. Samples were processed for RNase protection assay (RPA) with a probe against cyclin B1 or actin as described in Materials and Methods. (C) Human NB324K cells were parasynchronized by isoleucine deprivation and infected with MVM or MVM-1989 at an MOI of 10 at the time of release into complete medium. At 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. Cells were harvested at the indicated time points, and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. (D) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. At 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. Cells were harvested at 30 h postrelease, and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. (E) Murine A9 cells were treated as described for panel D. Cells were harvested at 30 h postrelease, and total RNA was isolated using TRIzol reagent. Samples were processed for RPA with a probe against cyclin B1 or GAPDH. (F) Murine A9 cells were parasynchronized by isoleucine deprivation and either infected (MVM) or not (mock) with MVM at an MOI of 10 at the time of release into complete medium. Alternatively, at 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. At 24 h postinfection, cells were then processed for flow cytometry as described in Materials and Methods. Data were processed in FlowJo (FlowJo, LLC) and are presented as percentages of the total per cell cycle phase.
    Figure Legend Snippet: Cyclin B1 protein and RNA are reduced during MVM infection. (A) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. In a separate experiment, at 15 h postrelease, cells were treated with 200 nM doxorubicin (Doxo) as indicated. Cells were harvested at the indicated time points (T x , with x given in hours), and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. Entry into S phase occurs approximately 12 h after release into complete medium. Virally infected cells harvested at 24 h thus represent an approximately 12-h transit into S phase. (B) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. Cells were harvested at the indicated time points, and total RNA was isolated using TRIzol reagent. Samples were processed for RNase protection assay (RPA) with a probe against cyclin B1 or actin as described in Materials and Methods. (C) Human NB324K cells were parasynchronized by isoleucine deprivation and infected with MVM or MVM-1989 at an MOI of 10 at the time of release into complete medium. At 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. Cells were harvested at the indicated time points, and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. (D) Murine A9 cells were parasynchronized by isoleucine deprivation and infected with MVM at an MOI of 10 at the time of release into complete medium. At 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. Cells were harvested at 30 h postrelease, and RIPA lysates were Western blotted using antibodies directed against the indicated proteins. (E) Murine A9 cells were treated as described for panel D. Cells were harvested at 30 h postrelease, and total RNA was isolated using TRIzol reagent. Samples were processed for RPA with a probe against cyclin B1 or GAPDH. (F) Murine A9 cells were parasynchronized by isoleucine deprivation and either infected (MVM) or not (mock) with MVM at an MOI of 10 at the time of release into complete medium. Alternatively, at 15 h postrelease, cells were treated with 200 nM doxorubicin as indicated. At 24 h postinfection, cells were then processed for flow cytometry as described in Materials and Methods. Data were processed in FlowJo (FlowJo, LLC) and are presented as percentages of the total per cell cycle phase.

    Techniques Used: Infection, Western Blot, Isolation, Rnase Protection Assay, Recombinase Polymerase Amplification, Flow Cytometry

    11) Product Images from "Acetylation of the Proto-Oncogene EVI1 Abrogates Bcl-xL Promoter Binding and Induces Apoptosis"

    Article Title: Acetylation of the Proto-Oncogene EVI1 Abrogates Bcl-xL Promoter Binding and Induces Apoptosis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0025370

    EVI1 induces Bcl-xL promoter trans-activity. A. HT-29 cell line was transfected with EVI1 siRNA and its negative control. After 24 h of transfection total RNA was isolated by TRIzol reagent (Invitrogen). Complementary DNA (cDNA) was prepared using oligodT (Fermentas, Germany) and subsequently RQ-PCR was performed with primers Bcl-xL-F- GCCACTTACCTGAATGACCAC , Bcl-xL-R- TGGATGGTCAGTGTCTGGT with SYBR green gold real time master mix (Eurogentec, Belgium). β-actin primers were used on the same sample for normalization. Bcl-xL level went down by 5.02 fold for siRNA transfected cells as compared to normal cells (p value = 0.0141). The left panel showed the expression of EVI1 protein level. siRNA negative control neither showed any change in Bcl-xL mRNA level nor in EVI1 protein level as compared to only HT-29 cells. B. Bcl-xL mRNA was up regulated in EVI1 transfected cells. 293T cells transfected with only empty vector or EVI1 were processed as described above. The EVI1-positive cells showed 5.07 fold more Bcl-xL expression in comparison to normalized vector control (p value = 0.047). C. Total protein was isolated from 293T cells transfected with only vector or with EVI1 and checked for BCL-XL protein level by standard Western blotting by using anti-Bcl-xL antibody (Imgenex India Pvt. Ltd). D. EVI1 positive (n = 13) and negative cases (n = 10) of CML patients were checked for Bcl-xL mRNA by RQ-PCR as described above. The EVI1 positive cases showed an up regulation of Bcl-xL compared to EVI1 negative cases. (P value = 0.0001). E. 293T cell line was transfected with either empty vector or EVI1 along with the pGL2-Bcl-xL promoter or pGL2 Bcl-xL (mut) and renilla luciferase (internal control). Twenty four hours later the cells were lysed and luciferase activity was measured using the luminometer (GLOMAX 20/20, Promega). EVI1 up regulated the Bcl-xL promoter activity by 5.81 fold and not the mutated promoter. Also EVI1-ΔD up regulated the wild type promoter by 5.68 fold and not EVI1-ΔA. The results were expressed as mean ± s.e. of triplicate experiments, which are representative of three different assays (p value
    Figure Legend Snippet: EVI1 induces Bcl-xL promoter trans-activity. A. HT-29 cell line was transfected with EVI1 siRNA and its negative control. After 24 h of transfection total RNA was isolated by TRIzol reagent (Invitrogen). Complementary DNA (cDNA) was prepared using oligodT (Fermentas, Germany) and subsequently RQ-PCR was performed with primers Bcl-xL-F- GCCACTTACCTGAATGACCAC , Bcl-xL-R- TGGATGGTCAGTGTCTGGT with SYBR green gold real time master mix (Eurogentec, Belgium). β-actin primers were used on the same sample for normalization. Bcl-xL level went down by 5.02 fold for siRNA transfected cells as compared to normal cells (p value = 0.0141). The left panel showed the expression of EVI1 protein level. siRNA negative control neither showed any change in Bcl-xL mRNA level nor in EVI1 protein level as compared to only HT-29 cells. B. Bcl-xL mRNA was up regulated in EVI1 transfected cells. 293T cells transfected with only empty vector or EVI1 were processed as described above. The EVI1-positive cells showed 5.07 fold more Bcl-xL expression in comparison to normalized vector control (p value = 0.047). C. Total protein was isolated from 293T cells transfected with only vector or with EVI1 and checked for BCL-XL protein level by standard Western blotting by using anti-Bcl-xL antibody (Imgenex India Pvt. Ltd). D. EVI1 positive (n = 13) and negative cases (n = 10) of CML patients were checked for Bcl-xL mRNA by RQ-PCR as described above. The EVI1 positive cases showed an up regulation of Bcl-xL compared to EVI1 negative cases. (P value = 0.0001). E. 293T cell line was transfected with either empty vector or EVI1 along with the pGL2-Bcl-xL promoter or pGL2 Bcl-xL (mut) and renilla luciferase (internal control). Twenty four hours later the cells were lysed and luciferase activity was measured using the luminometer (GLOMAX 20/20, Promega). EVI1 up regulated the Bcl-xL promoter activity by 5.81 fold and not the mutated promoter. Also EVI1-ΔD up regulated the wild type promoter by 5.68 fold and not EVI1-ΔA. The results were expressed as mean ± s.e. of triplicate experiments, which are representative of three different assays (p value

    Techniques Used: Activity Assay, Transfection, Negative Control, Isolation, Polymerase Chain Reaction, SYBR Green Assay, Significance Assay, Expressing, Plasmid Preparation, Western Blot, Luciferase

    12) Product Images from "Imperative role of particulate matter in innate immunity during RNA virus infection"

    Article Title: Imperative role of particulate matter in innate immunity during RNA virus infection

    Journal: bioRxiv

    doi: 10.1101/2020.03.28.013169

    PM 10 regulates the innate immune response upon RNA virus infection Quantification of innate immune response. A549 cells were treated with PM 10 and control mentioned as blank for (A) 24 hours then harvested in Trizol to quantify the mRNA expression of IFNβ and IL6 by qRT-PCR. (B) 36 hours then cell supernatant was collected to measure the protein level of IL6 by ELISA. (C) Schematic representation of workflow for quantification of IFNβ and ISRE promoter activities by luciferase assay as indicated in A549 cells. NDV represents new-castle disease virus infection at MOI = 2. (D) Schematic work flow of PM 10 exposure and NDV infection. (E) Quantification of IFNβ and IL6 mRNA transcripts in uninfected (control), mock infected, blank treated and PM 10 exposed cells by qRT-PCR. (G) Schematic work flow of PM 10 exposure and H5N1 influenza infection. (H) Quantification of IFNβ and IL6 mRNA transcripts in uninfected (control), mock infected, blank treated and PM 10 exposed cells by qRT-PCR. Data are mean +/- SEM of triplicate samples from single experiment and are representative of two independent experiments. *** P
    Figure Legend Snippet: PM 10 regulates the innate immune response upon RNA virus infection Quantification of innate immune response. A549 cells were treated with PM 10 and control mentioned as blank for (A) 24 hours then harvested in Trizol to quantify the mRNA expression of IFNβ and IL6 by qRT-PCR. (B) 36 hours then cell supernatant was collected to measure the protein level of IL6 by ELISA. (C) Schematic representation of workflow for quantification of IFNβ and ISRE promoter activities by luciferase assay as indicated in A549 cells. NDV represents new-castle disease virus infection at MOI = 2. (D) Schematic work flow of PM 10 exposure and NDV infection. (E) Quantification of IFNβ and IL6 mRNA transcripts in uninfected (control), mock infected, blank treated and PM 10 exposed cells by qRT-PCR. (G) Schematic work flow of PM 10 exposure and H5N1 influenza infection. (H) Quantification of IFNβ and IL6 mRNA transcripts in uninfected (control), mock infected, blank treated and PM 10 exposed cells by qRT-PCR. Data are mean +/- SEM of triplicate samples from single experiment and are representative of two independent experiments. *** P

    Techniques Used: Infection, Expressing, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Luciferase

    13) Product Images from "Endoplasmic Reticulum Associated Degradation (ERAD) Deficiency Promotes Mitochondrial Dysfunction and Transcriptional Rewiring in Human Hepatic Cells"

    Article Title: Endoplasmic Reticulum Associated Degradation (ERAD) Deficiency Promotes Mitochondrial Dysfunction and Transcriptional Rewiring in Human Hepatic Cells

    Journal: bioRxiv

    doi: 10.1101/2020.04.22.053546

    ERAD deficiency causes overhauling of mitochondrial activities and enhances the ‘stemness’ property of HepG2 cells. Sel1L +/+ and Sel1L -/- cells were seeded at 1×10 5 /well in 6-well plates and cultured in a humidified CO 2 incubator for 36 hours before being subjected to total RAN extraction using the TRIzol kit. Three replicates of RNA sample for each genotype were used for RNA sequencing. (A) Gene Ontology biological process (red) and biological pathways enrichment (green) analysis of down-regulated (left) and up-regulated (right) genes in Sel1L -/- cells. (B-C) Representative heatmaps of down-regulated (B) and up-regulated (C) genes in Sel1L -/- cells. Colors indicate scaled expression of individual genes. (D-E) Gene set enrichment plot of down-regulated (D) and up-regulated (E) genes in Sel1L -/- cells. The reference gene modules used in D and E are the Wong mitochondria gene module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/WONG_MITOCHONDRIA_GENE_MODULE ) and the JAK2 pathway module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/JAK2_DN.V1_DN , respectively. Each vertical bar on the x- axis in D and E represents a denoted gene in the specific gene set.
    Figure Legend Snippet: ERAD deficiency causes overhauling of mitochondrial activities and enhances the ‘stemness’ property of HepG2 cells. Sel1L +/+ and Sel1L -/- cells were seeded at 1×10 5 /well in 6-well plates and cultured in a humidified CO 2 incubator for 36 hours before being subjected to total RAN extraction using the TRIzol kit. Three replicates of RNA sample for each genotype were used for RNA sequencing. (A) Gene Ontology biological process (red) and biological pathways enrichment (green) analysis of down-regulated (left) and up-regulated (right) genes in Sel1L -/- cells. (B-C) Representative heatmaps of down-regulated (B) and up-regulated (C) genes in Sel1L -/- cells. Colors indicate scaled expression of individual genes. (D-E) Gene set enrichment plot of down-regulated (D) and up-regulated (E) genes in Sel1L -/- cells. The reference gene modules used in D and E are the Wong mitochondria gene module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/WONG_MITOCHONDRIA_GENE_MODULE ) and the JAK2 pathway module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/JAK2_DN.V1_DN , respectively. Each vertical bar on the x- axis in D and E represents a denoted gene in the specific gene set.

    Techniques Used: Cell Culture, RNA Sequencing Assay, Expressing

    14) Product Images from "Evidence for unique small RNA modifications in Alzheimer’s disease"

    Article Title: Evidence for unique small RNA modifications in Alzheimer’s disease

    Journal: bioRxiv

    doi: 10.1101/2020.04.30.071100

    Schematic illustration of LC-MS/MS for detection of RNA modifications. Total RNAs were extracted from brain tissue using the Trizol reagent and then urea-denatured-PAGE was performed to separate different RNA fragments. Targeted RNA fragments were cut according to their size, recovered from the gel, enzymatically treated to obtain single nucleosides, and then subjected to LC/MS-MS profiling. Raw mass spectrometry data were analysed using Xcalibur software, and the relative levels of different RNAs modifications were calculated.
    Figure Legend Snippet: Schematic illustration of LC-MS/MS for detection of RNA modifications. Total RNAs were extracted from brain tissue using the Trizol reagent and then urea-denatured-PAGE was performed to separate different RNA fragments. Targeted RNA fragments were cut according to their size, recovered from the gel, enzymatically treated to obtain single nucleosides, and then subjected to LC/MS-MS profiling. Raw mass spectrometry data were analysed using Xcalibur software, and the relative levels of different RNAs modifications were calculated.

    Techniques Used: Liquid Chromatography with Mass Spectroscopy, Polyacrylamide Gel Electrophoresis, Mass Spectrometry, Software

    15) Product Images from "Methylseleninic acid restricts tumor growth in nude mice model of metastatic breast cancer probably via inhibiting angiopoietin-2"

    Article Title: Methylseleninic acid restricts tumor growth in nude mice model of metastatic breast cancer probably via inhibiting angiopoietin-2

    Journal: BMC Cancer

    doi: 10.1186/1471-2407-12-192

    RNA interference of VEGF and Ang-2. MDA-MB-231 cells were transfected with the pooled siRNAs with lipofectamine 2000 (Invitrogen). Thirty-six hours after the transfection, total RNA from cultured cells was extracted by use of Trizol (Invitrogen). Real-time quantitative PCR was conducted to assess the level of the target mRNA expression using SYBR green dye, with relative changes calculated by the ΔΔCt method. While the suppression of either of VEGF or Ang-2 caused significant reduction of the other when compared with the siRNA controls, inhibition of VEGF lead to a dramatic decrease in the level of Ang-2 . The results indicate that Ang-2 is more likely regulated by VEGF .
    Figure Legend Snippet: RNA interference of VEGF and Ang-2. MDA-MB-231 cells were transfected with the pooled siRNAs with lipofectamine 2000 (Invitrogen). Thirty-six hours after the transfection, total RNA from cultured cells was extracted by use of Trizol (Invitrogen). Real-time quantitative PCR was conducted to assess the level of the target mRNA expression using SYBR green dye, with relative changes calculated by the ΔΔCt method. While the suppression of either of VEGF or Ang-2 caused significant reduction of the other when compared with the siRNA controls, inhibition of VEGF lead to a dramatic decrease in the level of Ang-2 . The results indicate that Ang-2 is more likely regulated by VEGF .

    Techniques Used: Multiple Displacement Amplification, Transfection, Cell Culture, Real-time Polymerase Chain Reaction, Expressing, SYBR Green Assay, Inhibition

    16) Product Images from "Endoplasmic Reticulum Associated Degradation (ERAD) Deficiency Promotes Mitochondrial Dysfunction and Transcriptional Rewiring in Human Hepatic Cells"

    Article Title: Endoplasmic Reticulum Associated Degradation (ERAD) Deficiency Promotes Mitochondrial Dysfunction and Transcriptional Rewiring in Human Hepatic Cells

    Journal: bioRxiv

    doi: 10.1101/2020.04.22.053546

    ERAD deficiency causes overhauling of mitochondrial activities and enhances the ‘stemness’ property of HepG2 cells. Sel1L +/+ and Sel1L -/- cells were seeded at 1×10 5 /well in 6-well plates and cultured in a humidified CO 2 incubator for 36 hours before being subjected to total RAN extraction using the TRIzol kit. Three replicates of RNA sample for each genotype were used for RNA sequencing. (A) Gene Ontology biological process (red) and biological pathways enrichment (green) analysis of down-regulated (left) and up-regulated (right) genes in Sel1L -/- cells. (B-C) Representative heatmaps of down-regulated (B) and up-regulated (C) genes in Sel1L -/- cells. Colors indicate scaled expression of individual genes. (D-E) Gene set enrichment plot of down-regulated (D) and up-regulated (E) genes in Sel1L -/- cells. The reference gene modules used in D and E are the Wong mitochondria gene module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/WONG_MITOCHONDRIA_GENE_MODULE ) and the JAK2 pathway module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/JAK2_DN.V1_DN , respectively. Each vertical bar on the x- axis in D and E represents a denoted gene in the specific gene set.
    Figure Legend Snippet: ERAD deficiency causes overhauling of mitochondrial activities and enhances the ‘stemness’ property of HepG2 cells. Sel1L +/+ and Sel1L -/- cells were seeded at 1×10 5 /well in 6-well plates and cultured in a humidified CO 2 incubator for 36 hours before being subjected to total RAN extraction using the TRIzol kit. Three replicates of RNA sample for each genotype were used for RNA sequencing. (A) Gene Ontology biological process (red) and biological pathways enrichment (green) analysis of down-regulated (left) and up-regulated (right) genes in Sel1L -/- cells. (B-C) Representative heatmaps of down-regulated (B) and up-regulated (C) genes in Sel1L -/- cells. Colors indicate scaled expression of individual genes. (D-E) Gene set enrichment plot of down-regulated (D) and up-regulated (E) genes in Sel1L -/- cells. The reference gene modules used in D and E are the Wong mitochondria gene module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/WONG_MITOCHONDRIA_GENE_MODULE ) and the JAK2 pathway module ( https://www.gsea-msigdb.org/gsea/msigdb/cards/JAK2_DN.V1_DN , respectively. Each vertical bar on the x- axis in D and E represents a denoted gene in the specific gene set.

    Techniques Used: Cell Culture, RNA Sequencing Assay, Expressing

    17) Product Images from "Epstein-Barr Virus Latent Nuclear Antigens Can Induce Metastasis in a Nude Mouse Model ▿"

    Article Title: Epstein-Barr Virus Latent Nuclear Antigens Can Induce Metastasis in a Nude Mouse Model ▿

    Journal: Journal of Virology

    doi: 10.1128/JVI.00886-07

    Analysis of tumor samples for expression of antigens from stable cell lines confirmed expression in the tumors. (a) Protein was extracted from primary tumor tissues, and the concentration was calculated. Tissues were homogenized by using a tissue tearer prior to processing for protein extraction. Portions (100 μg) of lysate were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. Equal loading of samples was confirmed with Ponceau-S staining of the membrane in all cases. The EBNA1 and Myc-tagged Nm23-H1 or EBNA3C were analyzed as reported with the use of anti-EBV human serum and anti-Myc antibody, respectively. (b) Total RNA was isolated from tissues by using TRIZOL reagent. Tissues were homogenized by using a tissue tearer prior to processing for RNA isolation. RT was carried performed with SuperScript II RNase H reverse transcriptase. followed by PCR with specific primers to detect the desired transcript. The Nm23-H1-Myc transcript was amplified by using the forward primer 5′-GATTACACGAGCTGTGCTCA-3′ and the reverse primer 5′-TTCGCTAGCCAAGTCTTCTT-3′ designed to amplify the junction sequence between Nm23-H1 and Myc tag. The EBNA3C-Myc transcript was amplified by using the forward primer 5′-CGGGATCCGGAAGGAACCATGGCCA-3′ and the reverse primer 5′-GAATTCTCCTGTCATTTCATAGATCCA-3′. The EBNA1 transcript was amplified by using the forward primer 5′-CGGGATCCGGAAGGAACCATGGCCA-3′ and the reverse primer 5′-GAATTCTCCTGTCATTTCATAGATCCA-3′. Amplification products were resolved in 1.5% agarose gels.
    Figure Legend Snippet: Analysis of tumor samples for expression of antigens from stable cell lines confirmed expression in the tumors. (a) Protein was extracted from primary tumor tissues, and the concentration was calculated. Tissues were homogenized by using a tissue tearer prior to processing for protein extraction. Portions (100 μg) of lysate were fractionated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto a nitrocellulose membrane. Equal loading of samples was confirmed with Ponceau-S staining of the membrane in all cases. The EBNA1 and Myc-tagged Nm23-H1 or EBNA3C were analyzed as reported with the use of anti-EBV human serum and anti-Myc antibody, respectively. (b) Total RNA was isolated from tissues by using TRIZOL reagent. Tissues were homogenized by using a tissue tearer prior to processing for RNA isolation. RT was carried performed with SuperScript II RNase H reverse transcriptase. followed by PCR with specific primers to detect the desired transcript. The Nm23-H1-Myc transcript was amplified by using the forward primer 5′-GATTACACGAGCTGTGCTCA-3′ and the reverse primer 5′-TTCGCTAGCCAAGTCTTCTT-3′ designed to amplify the junction sequence between Nm23-H1 and Myc tag. The EBNA3C-Myc transcript was amplified by using the forward primer 5′-CGGGATCCGGAAGGAACCATGGCCA-3′ and the reverse primer 5′-GAATTCTCCTGTCATTTCATAGATCCA-3′. The EBNA1 transcript was amplified by using the forward primer 5′-CGGGATCCGGAAGGAACCATGGCCA-3′ and the reverse primer 5′-GAATTCTCCTGTCATTTCATAGATCCA-3′. Amplification products were resolved in 1.5% agarose gels.

    Techniques Used: Expressing, Stable Transfection, Concentration Assay, Protein Extraction, Polyacrylamide Gel Electrophoresis, Staining, Isolation, Polymerase Chain Reaction, Amplification, Sequencing

    18) Product Images from "During EPO or anemia challenge, erythroid progenitor cells transit through a selectively expandable proerythroblast pool"

    Article Title: During EPO or anemia challenge, erythroid progenitor cells transit through a selectively expandable proerythroblast pool

    Journal: Blood

    doi: 10.1182/blood-2009-12-258947

    Stage E2 proerythroblasts deploy BCL2, whereas BCL-XL expression is activated subsequently at stage E3 . (A) Stage E2 proerythroblasts (but not E1 or E3 cells) express elevated BCL2. Stage E1, E2, and E3 cells were purified from primary SP34-ex cultures, and lysates were directly prepared. Levels of BCL2 and BCL-XL were then assayed by Western blotting. (B) BCL-XL and BCL-2 expression in stage E1, E2, and E3 BM erythroid cohorts. Stage E1, E2, and E3 cells were isolated and cultured for 6 hours in the absence of hematopoietic cytokines. Cells were then exposed to EPO (5 U/mL) for 2.5 and 7.5 hours. Cell lysates were prepared and analyzed for BCL-XL, BCL-2, and β-tubulin expression via Western blotting (left panel). Band intensities of BCL-XL and BCL2 were determined using ImageJ software Version 1.42j (right panel). (C) EPO/EPOR signals regulate Bcl-xL (but not Bcl2 ) in late-stage E3 erythroblasts. Purified primary BM stage E1, E2, and E3 cells were cultured for 6 hours in the absence of hematopoietic growth factors and then challenged with EPO. At 30, 90, and 270 minutes, cells were lysed in Trizol, and RNA and cDNA were prepared. Bcl-xL and Bcl2 levels then were determined via quantitative RT-PCR (with beta-actin as an internal control). (D) Stage-predominant EPO induction and up-modulation of select EPO response factors, such as S3G and Trib3 . Assays of transcripts were performed via quantitative RT-PCR. Values are mean ± SE.
    Figure Legend Snippet: Stage E2 proerythroblasts deploy BCL2, whereas BCL-XL expression is activated subsequently at stage E3 . (A) Stage E2 proerythroblasts (but not E1 or E3 cells) express elevated BCL2. Stage E1, E2, and E3 cells were purified from primary SP34-ex cultures, and lysates were directly prepared. Levels of BCL2 and BCL-XL were then assayed by Western blotting. (B) BCL-XL and BCL-2 expression in stage E1, E2, and E3 BM erythroid cohorts. Stage E1, E2, and E3 cells were isolated and cultured for 6 hours in the absence of hematopoietic cytokines. Cells were then exposed to EPO (5 U/mL) for 2.5 and 7.5 hours. Cell lysates were prepared and analyzed for BCL-XL, BCL-2, and β-tubulin expression via Western blotting (left panel). Band intensities of BCL-XL and BCL2 were determined using ImageJ software Version 1.42j (right panel). (C) EPO/EPOR signals regulate Bcl-xL (but not Bcl2 ) in late-stage E3 erythroblasts. Purified primary BM stage E1, E2, and E3 cells were cultured for 6 hours in the absence of hematopoietic growth factors and then challenged with EPO. At 30, 90, and 270 minutes, cells were lysed in Trizol, and RNA and cDNA were prepared. Bcl-xL and Bcl2 levels then were determined via quantitative RT-PCR (with beta-actin as an internal control). (D) Stage-predominant EPO induction and up-modulation of select EPO response factors, such as S3G and Trib3 . Assays of transcripts were performed via quantitative RT-PCR. Values are mean ± SE.

    Techniques Used: Expressing, Purification, Western Blot, Isolation, Cell Culture, Software, Quantitative RT-PCR

    19) Product Images from "Decursinol Angelate Inhibits LPS-Induced Macrophage Polarization through Modulation of the NFκB and MAPK Signaling Pathways"

    Article Title: Decursinol Angelate Inhibits LPS-Induced Macrophage Polarization through Modulation of the NFκB and MAPK Signaling Pathways

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    doi: 10.3390/molecules23081880

    DA inhibits PMA-induced production of proinflammatory cytokines. ( A ) total RNA was extracted from the treated HL-60 cells using TRIZOL reagent and was reverse-transcribed into cDNA. The amplified products were analyzed through electrophoresis on a 1% agarose gel and visualized using an EcoDye™ Nucleic Acid Staining Solution. Images were then captured using Wise Capture I-1000 software (Daihan Scientific, Seoul, South Korea). DA inhibited pro-inflammatory cytokines in PMA-induced macrophages; ( B ) IL-1β exogenous secretion was measured through ELISA. A 96-well plate was coated with 10 μg/mL purified goat anti-IL-1β antibody. Cell culture supernatants from the control and treated groups were incubated in these plates for 1 h, and then a polyclonal rabbit anti-IL-1β antibody was added to the wells. HRP-conjugated goat anti-rabbit IgG was then added, and the cells were incubated for 30 min. ABTS solution was then added to the plate, and the signal that was developed was detected using a reference wavelength of 490 nm. Data are given as the mean ± SD. * p
    Figure Legend Snippet: DA inhibits PMA-induced production of proinflammatory cytokines. ( A ) total RNA was extracted from the treated HL-60 cells using TRIZOL reagent and was reverse-transcribed into cDNA. The amplified products were analyzed through electrophoresis on a 1% agarose gel and visualized using an EcoDye™ Nucleic Acid Staining Solution. Images were then captured using Wise Capture I-1000 software (Daihan Scientific, Seoul, South Korea). DA inhibited pro-inflammatory cytokines in PMA-induced macrophages; ( B ) IL-1β exogenous secretion was measured through ELISA. A 96-well plate was coated with 10 μg/mL purified goat anti-IL-1β antibody. Cell culture supernatants from the control and treated groups were incubated in these plates for 1 h, and then a polyclonal rabbit anti-IL-1β antibody was added to the wells. HRP-conjugated goat anti-rabbit IgG was then added, and the cells were incubated for 30 min. ABTS solution was then added to the plate, and the signal that was developed was detected using a reference wavelength of 490 nm. Data are given as the mean ± SD. * p

    Techniques Used: Amplification, Electrophoresis, Agarose Gel Electrophoresis, Staining, Software, Enzyme-linked Immunosorbent Assay, Purification, Cell Culture, Incubation

    20) Product Images from "Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins"

    Article Title: Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0154672

    Glucose stimulates miR-33 expression in RAW264.7 macrophages and BMDMs. The effect of glucose on miR-33 levels in the cell lysate and medium was investigated in Raw264.7 murine macrophages (A) and BMDMs (B) by quantitative miRNA real-time PCR. Trizol reagent was used to extract total RNA in cellular lysates and medium from macrophages treated with glucose from 5 to 30 mM. Preparation of microRNA was isolated using the mirVANA microRNA isolation kit and microRNA assays were performed by real-time PCR. The relative miR-33 expression was calculated via the 2 −ΔΔCt method using cel-miR-39 as an endogenous control. The histogram shows the relative fold compared with the control group (set as 1). Results are expressed as mean±SEM of at least three independent experiments. * P
    Figure Legend Snippet: Glucose stimulates miR-33 expression in RAW264.7 macrophages and BMDMs. The effect of glucose on miR-33 levels in the cell lysate and medium was investigated in Raw264.7 murine macrophages (A) and BMDMs (B) by quantitative miRNA real-time PCR. Trizol reagent was used to extract total RNA in cellular lysates and medium from macrophages treated with glucose from 5 to 30 mM. Preparation of microRNA was isolated using the mirVANA microRNA isolation kit and microRNA assays were performed by real-time PCR. The relative miR-33 expression was calculated via the 2 −ΔΔCt method using cel-miR-39 as an endogenous control. The histogram shows the relative fold compared with the control group (set as 1). Results are expressed as mean±SEM of at least three independent experiments. * P

    Techniques Used: Expressing, miRNA RT, Polymerase Chain Reaction, Isolation, Real-time Polymerase Chain Reaction

    21) Product Images from "Time-Dependent Decay of mRNA and Ribosomal RNA during Platelet Aging and Its Correlation with Translation Activity"

    Article Title: Time-Dependent Decay of mRNA and Ribosomal RNA during Platelet Aging and Its Correlation with Translation Activity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0148064

    Decay of the quality of PLT RNA. In another series of experiments, washed PLTs from DT-treated mice were resuspended in Tyrode’s albumin/DMEM medium and incubated at 37°C for 0, 2, 4, 6 and 24h. At the end of each time interval the percentage of TO bright PLTs was determined by FC, after which PLT RNA was extracted in Trizol reagent containing MS2 genomic RNA (see methods ) (n = 4). (A) The profiles of extracted RNAs were analyzed on a Bioanalyzer; a representative series of profiles is shown. Y-axis scales (fluorescence units) are identical for all the electropherograms (20 FU per subdivision). The asterisks indicate the position of MS2 RNA and the right electropherogram corresponds to pure MS2 RNA. First number, time; second number, percentage of TO bright PLTs; third number, 28S/18S RNA ratio; fourth number, percentage of remaining PLT RNA. (B) The decays of rRNA and beta actin mRNA were analyzed by RT-qPCR (see details in method section). Representative amplification curves for MS2, 28S rRNA and beta actin cDNAs at time 0 are shown (1/50 diluted samples, triplicates). No specific amplification products were generated in control experiments without reverse transcriptase (not shown). The relative normalized expression of 28S rRNA and of beta actin mRNA relatively to time 0 were calculated as described in the method section. Histograms represent means and SEM from the 4 independent experiments. C) The presence of beta actin and ubiquitin C transcripts in freshly isolated control and reticulated PLTs was assessed using RNAscope technique. The stringency of the conditions was checked using B subtilis -specific DapB mRNA probes. Hybridized probes were revealed using alkaline phosphatase and HD-assay RED reagent. PLTs were then counterstained with A488-conjugated anti-GP1bβ mAb and DAPI. Upper panels, retPLTs (left, DT) and control PLTs (right, WT) labelled with actin mRNA-specific probes. The masking effect of RED reagent-derived large precipitates on anti-GP1bβ staining is illustrated by arrows. Lower left panel, retPLTs labelled with negative control DapB probes. Lower right panel, retPLTs were stained with Ubiquitin C-specific probes. DAPI staining is not shown because no cells were labelled in the chosen views. Scale bar: 10 μm.
    Figure Legend Snippet: Decay of the quality of PLT RNA. In another series of experiments, washed PLTs from DT-treated mice were resuspended in Tyrode’s albumin/DMEM medium and incubated at 37°C for 0, 2, 4, 6 and 24h. At the end of each time interval the percentage of TO bright PLTs was determined by FC, after which PLT RNA was extracted in Trizol reagent containing MS2 genomic RNA (see methods ) (n = 4). (A) The profiles of extracted RNAs were analyzed on a Bioanalyzer; a representative series of profiles is shown. Y-axis scales (fluorescence units) are identical for all the electropherograms (20 FU per subdivision). The asterisks indicate the position of MS2 RNA and the right electropherogram corresponds to pure MS2 RNA. First number, time; second number, percentage of TO bright PLTs; third number, 28S/18S RNA ratio; fourth number, percentage of remaining PLT RNA. (B) The decays of rRNA and beta actin mRNA were analyzed by RT-qPCR (see details in method section). Representative amplification curves for MS2, 28S rRNA and beta actin cDNAs at time 0 are shown (1/50 diluted samples, triplicates). No specific amplification products were generated in control experiments without reverse transcriptase (not shown). The relative normalized expression of 28S rRNA and of beta actin mRNA relatively to time 0 were calculated as described in the method section. Histograms represent means and SEM from the 4 independent experiments. C) The presence of beta actin and ubiquitin C transcripts in freshly isolated control and reticulated PLTs was assessed using RNAscope technique. The stringency of the conditions was checked using B subtilis -specific DapB mRNA probes. Hybridized probes were revealed using alkaline phosphatase and HD-assay RED reagent. PLTs were then counterstained with A488-conjugated anti-GP1bβ mAb and DAPI. Upper panels, retPLTs (left, DT) and control PLTs (right, WT) labelled with actin mRNA-specific probes. The masking effect of RED reagent-derived large precipitates on anti-GP1bβ staining is illustrated by arrows. Lower left panel, retPLTs labelled with negative control DapB probes. Lower right panel, retPLTs were stained with Ubiquitin C-specific probes. DAPI staining is not shown because no cells were labelled in the chosen views. Scale bar: 10 μm.

    Techniques Used: Mouse Assay, Incubation, Fluorescence, Quantitative RT-PCR, Amplification, Generated, Expressing, Isolation, HD Assay, Derivative Assay, Staining, Negative Control

    22) Product Images from "Establishment of urinary exosome-like vesicles isolation protocol for FHHNC patients and evaluation of different exosomal RNA extraction methods"

    Article Title: Establishment of urinary exosome-like vesicles isolation protocol for FHHNC patients and evaluation of different exosomal RNA extraction methods

    Journal: Journal of Translational Medicine

    doi: 10.1186/s12967-018-1651-z

    RNA quantification. a Bar graph of total RNA quantified from FHHNC uEVs by Bioanalyzer—Picochip using the five different extraction methods. MirCURY kit followed by TRIzol LS were the most efficient methods. b A representative electropherogram shows that uEVs contain small RNA, including microRNAs (10–40 nt). As expected, small amounts of rRNA were detected. c miRNA profiling by RT-qPCR of RNA extracted from FHHNC uEVs. miRNA expression pattern is consistent independently of the RNA extraction method
    Figure Legend Snippet: RNA quantification. a Bar graph of total RNA quantified from FHHNC uEVs by Bioanalyzer—Picochip using the five different extraction methods. MirCURY kit followed by TRIzol LS were the most efficient methods. b A representative electropherogram shows that uEVs contain small RNA, including microRNAs (10–40 nt). As expected, small amounts of rRNA were detected. c miRNA profiling by RT-qPCR of RNA extracted from FHHNC uEVs. miRNA expression pattern is consistent independently of the RNA extraction method

    Techniques Used: Quantitative RT-PCR, Expressing, RNA Extraction

    23) Product Images from "Differential Expression of Caveolin-1 in Lipopolysaccharide-Activated Murine Macrophages"

    Article Title: Differential Expression of Caveolin-1 in Lipopolysaccharide-Activated Murine Macrophages

    Journal: Infection and Immunity

    doi:

    Effect of LPS on caveolin-1 expression in RAW264.7 cells. RAW264.7 cells were incubated with 100 ng of LPS/ml for various lengths of time. Total RNAs were isolated with Trizol reagent. Equal amounts of total RNAs were reverse transcribed using oligo(dT) 16 as the primer. The caveolin-1-specific primers p1 and p2 were used in PCR amplification. Equal amounts of PCR products were subjected to agarose gel electrophoresis.
    Figure Legend Snippet: Effect of LPS on caveolin-1 expression in RAW264.7 cells. RAW264.7 cells were incubated with 100 ng of LPS/ml for various lengths of time. Total RNAs were isolated with Trizol reagent. Equal amounts of total RNAs were reverse transcribed using oligo(dT) 16 as the primer. The caveolin-1-specific primers p1 and p2 were used in PCR amplification. Equal amounts of PCR products were subjected to agarose gel electrophoresis.

    Techniques Used: Expressing, Incubation, Isolation, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    24) Product Images from "SCD1/FADS2 fatty acid desaturases equipoise lipid metabolic activity and redox-driven ferroptosis in ascites-derived ovarian cancer cells"

    Article Title: SCD1/FADS2 fatty acid desaturases equipoise lipid metabolic activity and redox-driven ferroptosis in ascites-derived ovarian cancer cells

    Journal: Theranostics

    doi: 10.7150/thno.70194

    Effects of SCD1/FADS2 inhibitors with or without cisplatin synergistically inhibit oncogenic and malignant transformation in OvCa and sensitizes OvCa to cisplatin. (A) FA (fraction affected) and CI (combination index) values were calculated using the CalcuSyn software program. (B-D, and H) OCM-co-cultured OVCA433/PEO1/PEO4 cells treated with SCD1 inhibitor (CAY10566, 5 nM), FADS2 inhibitor (sc26196, 100 nM), DDP (cisplatin, 2 µM), combination (CAY10566+sc26196+cisplatin) or lipid removal reagent Cleanascite (CleanA) for 48 h. (B) Cell apoptosis was analyzed by flow cytometry. Cells were stained by Annexin V and propidium iodide (PI). (C) Representative images of the transwell migration assay. (D) Representative images of the cell cycle are determined by PI staining. (E) TGF-β (5 ng/mL)-induced EMT model from patient-derived organoids treated with combined CAY10566 (25 nM) and sc26196 (500 nM) for 2 weeks. Scale bars, 100 µm. (F) Representative fluorescence confocal images of patient-derived organoids show E-cadherin, Vimentin, and DAPI. Scale bars, 100 µm. (G) XTT results in PEO1 (cisplatin sensitive) and PEO4 (cisplatin-resistant) cells. FA (fraction affected) and CI (combination index) values were calculated using the CalcuSyn software program. (H) Representative western blot analysis. GAPDH was used as the internal control. The results are representative of three independent experiments. For the results in ( A-E ), error bars represent the mean ± SEM ( n = 3). Statistical significance was determined by the two-tailed t-test. * P
    Figure Legend Snippet: Effects of SCD1/FADS2 inhibitors with or without cisplatin synergistically inhibit oncogenic and malignant transformation in OvCa and sensitizes OvCa to cisplatin. (A) FA (fraction affected) and CI (combination index) values were calculated using the CalcuSyn software program. (B-D, and H) OCM-co-cultured OVCA433/PEO1/PEO4 cells treated with SCD1 inhibitor (CAY10566, 5 nM), FADS2 inhibitor (sc26196, 100 nM), DDP (cisplatin, 2 µM), combination (CAY10566+sc26196+cisplatin) or lipid removal reagent Cleanascite (CleanA) for 48 h. (B) Cell apoptosis was analyzed by flow cytometry. Cells were stained by Annexin V and propidium iodide (PI). (C) Representative images of the transwell migration assay. (D) Representative images of the cell cycle are determined by PI staining. (E) TGF-β (5 ng/mL)-induced EMT model from patient-derived organoids treated with combined CAY10566 (25 nM) and sc26196 (500 nM) for 2 weeks. Scale bars, 100 µm. (F) Representative fluorescence confocal images of patient-derived organoids show E-cadherin, Vimentin, and DAPI. Scale bars, 100 µm. (G) XTT results in PEO1 (cisplatin sensitive) and PEO4 (cisplatin-resistant) cells. FA (fraction affected) and CI (combination index) values were calculated using the CalcuSyn software program. (H) Representative western blot analysis. GAPDH was used as the internal control. The results are representative of three independent experiments. For the results in ( A-E ), error bars represent the mean ± SEM ( n = 3). Statistical significance was determined by the two-tailed t-test. * P

    Techniques Used: Transformation Assay, Software, Cell Culture, Flow Cytometry, Staining, Transwell Migration Assay, Derivative Assay, Fluorescence, Western Blot, Two Tailed Test

    25) Product Images from "Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism"

    Article Title: Camel Milk Triggers Apoptotic Signaling Pathways in Human Hepatoma HepG2 and Breast Cancer MCF7 Cell Lines through Transcriptional Mechanism

    Journal: Journal of Biomedicine and Biotechnology

    doi: 10.1155/2012/593195

    Effect of camel milk on apoptotic and oxidative stress markers Caspase-3 (a), DR4 (b), and HO-1 (c) mRNA levels in MCF7 cells. MCF7 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3, DR4, and HO-1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on apoptotic and oxidative stress markers Caspase-3 (a), DR4 (b), and HO-1 (c) mRNA levels in MCF7 cells. MCF7 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3, DR4, and HO-1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of camel milk on apoptotic markers Caspase-3 (a), p53 (b), BcL2 (c), and DR4 (d) mRNA levels in HepG2 cells. HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of Caspase-3, p53, BcL2, and DR4 were quantified using RT-PCR normalized to β -actin housekeeping gene as described in Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on apoptotic markers Caspase-3 (a), p53 (b), BcL2 (c), and DR4 (d) mRNA levels in HepG2 cells. HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent, and the mRNA levels of Caspase-3, p53, BcL2, and DR4 were quantified using RT-PCR normalized to β -actin housekeeping gene as described in Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of MAPKs inhibitors on camel milk mediated induction of caspase-3 mRNA levels in HepG2 cells. HepG2 cells were pre-treated with for 2 h with JNK inhibitor, SP600125, p38 inhibitor, SB203580, and ERK inhibitor, U0126, before the addition of camel milk (10 mg/mL) for additional 6 h. Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of MAPKs inhibitors on camel milk mediated induction of caspase-3 mRNA levels in HepG2 cells. HepG2 cells were pre-treated with for 2 h with JNK inhibitor, SP600125, p38 inhibitor, SB203580, and ERK inhibitor, U0126, before the addition of camel milk (10 mg/mL) for additional 6 h. Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of Caspase-3 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    Effect of camel milk on oxidative stress markers HO-1 (a) and NQO1 (b) mRNA levels, and ROS (c) production in HepG2 cells. (a) and (b) HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of HO-1 and NQO1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P
    Figure Legend Snippet: Effect of camel milk on oxidative stress markers HO-1 (a) and NQO1 (b) mRNA levels, and ROS (c) production in HepG2 cells. (a) and (b) HepG2 cells were treated for 6 h with a various concentrations of camel milk (2.5, 5, 10, and 20 mg/mL). Thereafter, total RNA was isolated using TRIzol reagent and the mRNA levels of HO-1 and NQO1 were quantified using RT-PCR normalized to β -actin housekeeping gene as described Section 2 . Duplicate reactions were performed for each experiment, and the values presented are the means ± SEM ( n = 6) of three independent experiments. + P

    Techniques Used: Isolation, Reverse Transcription Polymerase Chain Reaction

    26) Product Images from "PPAR? Activation Attenuates Glycated-Serum Induced Pancreatic Beta-Cell Dysfunction through Enhancing Pdx1 and Mafa Protein Stability"

    Article Title: PPAR? Activation Attenuates Glycated-Serum Induced Pancreatic Beta-Cell Dysfunction through Enhancing Pdx1 and Mafa Protein Stability

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0056386

    Activation of PPARγ rescues insulin gene expression and insulin secretion. (A) Cells were pre-treated with TRO or DMSO for 1 h, followed by treatment with NG or 5% GS for 8 h, and then total RNA was extracted using Trizol reagent. Real-time RT-PCR was utilized to determine mRNA levels of Ins1 and Ins2 . β-Actin was used as an internal standard. ** P
    Figure Legend Snippet: Activation of PPARγ rescues insulin gene expression and insulin secretion. (A) Cells were pre-treated with TRO or DMSO for 1 h, followed by treatment with NG or 5% GS for 8 h, and then total RNA was extracted using Trizol reagent. Real-time RT-PCR was utilized to determine mRNA levels of Ins1 and Ins2 . β-Actin was used as an internal standard. ** P

    Techniques Used: Activation Assay, Expressing, Quantitative RT-PCR

    27) Product Images from "Oxidized phospholipids stimulate production of stem cell factor via NRF2-dependent mechanisms"

    Article Title: Oxidized phospholipids stimulate production of stem cell factor via NRF2-dependent mechanisms

    Journal: Angiogenesis

    doi: 10.1007/s10456-017-9590-5

    Induction of SCF by OxPAPC depends on the transcription factor NRF2. a , b , c and d HUVECs were transfected with siRNAs targeting ATF4 ( a ), PERK ( b ), NRF2 ( c ), or KEAP ( d ). Twenty-four hours after transfection cells were stimulated with OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were analyzed by qRT-PCR in total RNA prepared using Trizol reagent and normalized to β2-microglobulin mRNA. e Protein kinase CK2 inhibitor TBB attenuates induction of SCF by OxPAPC. Cells were pretreated with TBB (20 µM, 30 min) and thereafter stimulated with OxPAPC (100 µg/ml, 6 h); SCF mRNA was quantified as described above. f miR-155 potentiates induction of SCF by OxPAPC. HUVECs were transfected with the RNA oligonucleotide mimicking miR-155 for 24 h and stimulated by OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were quantified by qRT-PCR. g Steady-state levels of SCF mRNA are decreased in aortas of NRF2 − / − mice. Total RNA was prepared from aortas of 6 months old NRF2 − / − or wild-type mice and analyzed by qRT-PCR method. The levels of NRF2 mRNA were normalized to β2-microglobulin mRNA
    Figure Legend Snippet: Induction of SCF by OxPAPC depends on the transcription factor NRF2. a , b , c and d HUVECs were transfected with siRNAs targeting ATF4 ( a ), PERK ( b ), NRF2 ( c ), or KEAP ( d ). Twenty-four hours after transfection cells were stimulated with OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were analyzed by qRT-PCR in total RNA prepared using Trizol reagent and normalized to β2-microglobulin mRNA. e Protein kinase CK2 inhibitor TBB attenuates induction of SCF by OxPAPC. Cells were pretreated with TBB (20 µM, 30 min) and thereafter stimulated with OxPAPC (100 µg/ml, 6 h); SCF mRNA was quantified as described above. f miR-155 potentiates induction of SCF by OxPAPC. HUVECs were transfected with the RNA oligonucleotide mimicking miR-155 for 24 h and stimulated by OxPAPC (100 µg/ml, 6 h). Levels of SCF mRNA were quantified by qRT-PCR. g Steady-state levels of SCF mRNA are decreased in aortas of NRF2 − / − mice. Total RNA was prepared from aortas of 6 months old NRF2 − / − or wild-type mice and analyzed by qRT-PCR method. The levels of NRF2 mRNA were normalized to β2-microglobulin mRNA

    Techniques Used: Transfection, Quantitative RT-PCR, Mouse Assay

    SCF mRNA is induced in endothelial and monocytic cells by OxPLs and PGA2 in a time- and concentration-dependent manner a Endothelial cells were stimulated with OxPAPC (100 µg/ml, 6 h). Total RNA was extracted using Trizol reagent and analyzed by microarray hybridization (HCAEC; three independent experiments and hybridizations) or qRT-PCR (HAEC, HUVEC; quadruplicate samples from one representative experiment out of three). Levels of SCF mRNA were normalized to β2-microglobulin mRNA. b HUVECs were stimulated with OxPAPC (100 µg/ml) for indicated time periods, followed by analysis of SCF mRNA. c HUVECs were treated with indicated concentrations of OxPAPC for 6 h. qRT-PCR was used for SCF mRNA quantification. d , e Levels of SCF mRNA were analyzed in aortas of aged (12 months old) wild type and ApoE − / − mice ( d ) or in aortas of wild type and ApoE − / − young animals fed for 8 weeks either with chow (6.5% fat) or high-fat diet (15% fat) ( e ). Total RNA was prepared from homogenized aortas using Trizol reagent. SCF mRNA expression was analyzed by qRT-PCR and normalized to β2-microglobulin mRNA levels
    Figure Legend Snippet: SCF mRNA is induced in endothelial and monocytic cells by OxPLs and PGA2 in a time- and concentration-dependent manner a Endothelial cells were stimulated with OxPAPC (100 µg/ml, 6 h). Total RNA was extracted using Trizol reagent and analyzed by microarray hybridization (HCAEC; three independent experiments and hybridizations) or qRT-PCR (HAEC, HUVEC; quadruplicate samples from one representative experiment out of three). Levels of SCF mRNA were normalized to β2-microglobulin mRNA. b HUVECs were stimulated with OxPAPC (100 µg/ml) for indicated time periods, followed by analysis of SCF mRNA. c HUVECs were treated with indicated concentrations of OxPAPC for 6 h. qRT-PCR was used for SCF mRNA quantification. d , e Levels of SCF mRNA were analyzed in aortas of aged (12 months old) wild type and ApoE − / − mice ( d ) or in aortas of wild type and ApoE − / − young animals fed for 8 weeks either with chow (6.5% fat) or high-fat diet (15% fat) ( e ). Total RNA was prepared from homogenized aortas using Trizol reagent. SCF mRNA expression was analyzed by qRT-PCR and normalized to β2-microglobulin mRNA levels

    Techniques Used: Concentration Assay, Microarray, Hybridization, Quantitative RT-PCR, Mouse Assay, Expressing

    28) Product Images from "Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions"

    Article Title: Pitfalls of DNA Quantification Using DNA-Binding Fluorescent Dyes and Suggested Solutions

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0150528

    Electrophoresis of DNAs by Agilent 2200 TapeStation. DNAs (100 ng/lane) were electrophoresed on an Agilent 2200 TapeStation. The DNA integrity number (DIN) indicates the fragmentation of genomic DNA on a scale from 1 to 10. A high DIN indicates highly intact DNA, and a low DIN indicates strongly degraded DNA. Lane 1, Frozen-H1; lane 2, Frozen-H2; lane 3, Frozen-H3; lane 4, FFPE-H1; lane 5, FFPE-H2; lane 6, FFPE-H3; lane 7, Trizol-h1; lane 8, Trizol-h2; lane 9, Trizol-h4; lane 10, Trizol-h6; and lane 11, Trizol-h7.
    Figure Legend Snippet: Electrophoresis of DNAs by Agilent 2200 TapeStation. DNAs (100 ng/lane) were electrophoresed on an Agilent 2200 TapeStation. The DNA integrity number (DIN) indicates the fragmentation of genomic DNA on a scale from 1 to 10. A high DIN indicates highly intact DNA, and a low DIN indicates strongly degraded DNA. Lane 1, Frozen-H1; lane 2, Frozen-H2; lane 3, Frozen-H3; lane 4, FFPE-H1; lane 5, FFPE-H2; lane 6, FFPE-H3; lane 7, Trizol-h1; lane 8, Trizol-h2; lane 9, Trizol-h4; lane 10, Trizol-h6; and lane 11, Trizol-h7.

    Techniques Used: Electrophoresis, Formalin-fixed Paraffin-Embedded

    Quantification and qualification of Trizol-DNA. (A) Trizol-DNA was serially diluted with distilled water, and the concentration of each diluent was measured by NanoDrop (circles), BR-Qubit (squares), HS-Qubit (diamonds) and qPCR (triangles). The broken line indicates the expected NanoDrop value. The concentration (ng/μl) of each original DNA solution, as measured by NanoDrop, is shown at the top right: dilution ratio = 1. The detection limits of each measurement are described in Fig 1 . (B) Various lengths of the target sequence were amplified from Trizol-DNAs, and the amplified products were electrophoresed on an agarose gel. Lane 1, Frozen-H1; lane 2, Trizol-h1; lane 3, Trizol-h2; lane 4, Trizol-h3; lane 5, Trizol-h4; lane 6, Trizol-h5; lane 7, Trizol-h6; and lane 8, Trizol-h7.
    Figure Legend Snippet: Quantification and qualification of Trizol-DNA. (A) Trizol-DNA was serially diluted with distilled water, and the concentration of each diluent was measured by NanoDrop (circles), BR-Qubit (squares), HS-Qubit (diamonds) and qPCR (triangles). The broken line indicates the expected NanoDrop value. The concentration (ng/μl) of each original DNA solution, as measured by NanoDrop, is shown at the top right: dilution ratio = 1. The detection limits of each measurement are described in Fig 1 . (B) Various lengths of the target sequence were amplified from Trizol-DNAs, and the amplified products were electrophoresed on an agarose gel. Lane 1, Frozen-H1; lane 2, Trizol-h1; lane 3, Trizol-h2; lane 4, Trizol-h3; lane 5, Trizol-h4; lane 6, Trizol-h5; lane 7, Trizol-h6; and lane 8, Trizol-h7.

    Techniques Used: Concentration Assay, Real-time Polymerase Chain Reaction, Sequencing, Amplification, Agarose Gel Electrophoresis

    29) Product Images from "Methylpiperidinopyrazole Attenuates Estrogen-Induced Mitochondrial Energy Production and Subsequent Osteoblast Maturation via an Estrogen Receptor Alpha-Dependent Mechanism"

    Article Title: Methylpiperidinopyrazole Attenuates Estrogen-Induced Mitochondrial Energy Production and Subsequent Osteoblast Maturation via an Estrogen Receptor Alpha-Dependent Mechanism

    Journal: Molecules

    doi: 10.3390/molecules25122876

    Methylpiperidinopyrazole (MPP) inhibited estradiol-induced expressions of osteoblast maturation-associated bone morphometric protein (BMP)-6 and type I collagen (COL I) mRNA expressions in rat calvarial osteoblasts. Primary osteoblasts isolated from neonatal rat calvarias were exposed to a differentiation agent with estradiol or with a combination of MPP and estradiol for 21 days. Control cells received dimethyl sulfoxide (DMSO) or MPP only. The differentiation agent, MPP, and estradiol were renewed every 2 days. Cell morphologies were observed and photographed using an inverted light microscope ( A ). After drug treatment, total RNAs were prepared from various groups using a TRIzol protocol. Levels of BMP-6 mRNA ( B ) and COL I mRNA ( C ) were analyzed using a real-time PCR. Amounts of β-actin mRNA were measured as the internal control. Each value represents the mean ± standard deviation of at least three independent determinations. The symbols * and # indicate that values significantly ( p
    Figure Legend Snippet: Methylpiperidinopyrazole (MPP) inhibited estradiol-induced expressions of osteoblast maturation-associated bone morphometric protein (BMP)-6 and type I collagen (COL I) mRNA expressions in rat calvarial osteoblasts. Primary osteoblasts isolated from neonatal rat calvarias were exposed to a differentiation agent with estradiol or with a combination of MPP and estradiol for 21 days. Control cells received dimethyl sulfoxide (DMSO) or MPP only. The differentiation agent, MPP, and estradiol were renewed every 2 days. Cell morphologies were observed and photographed using an inverted light microscope ( A ). After drug treatment, total RNAs were prepared from various groups using a TRIzol protocol. Levels of BMP-6 mRNA ( B ) and COL I mRNA ( C ) were analyzed using a real-time PCR. Amounts of β-actin mRNA were measured as the internal control. Each value represents the mean ± standard deviation of at least three independent determinations. The symbols * and # indicate that values significantly ( p

    Techniques Used: Isolation, Light Microscopy, Real-time Polymerase Chain Reaction, Standard Deviation

    30) Product Images from "The Actin-Sequestering Protein Thymosin Beta-4 Is a Novel Target of Hypoxia-Inducible Nitric Oxide and HIF-1α Regulation"

    Article Title: The Actin-Sequestering Protein Thymosin Beta-4 Is a Novel Target of Hypoxia-Inducible Nitric Oxide and HIF-1α Regulation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0106532

    Nitric oxide (NO) enhanced thymosin beta-4 (Tβ4) expression and cell migration. A: HeLa cells were incubated under normoxic or hypoxic conditions for 1 h. RNA was purified with TRIZOL reagent as described in the Materials and Methods, and the Tβ4 transcript level was measured using reverse transcriptase polymerase chain reaction (RT-PCR). B: HeLa cells were transfected with a Gaussia luciferase plasmid Tβ4 promoter (Tβ4-GLuc) for 12 h and were incubated under normoxic or hypoxic conditions for 1 h. GLuc activity in culture medium was measured with a luminometer using GLuc substrate and represented as fold GLuc to normoxia control. C–D: HeLa cells were incubated under normoxia or hypoxia condition for an appropriate time. Cell lysates were prepared and the protein level of HIF-1α and Tβ4 in HeLa cells was detected by Western blot analysis ( C ). NO production was detected with Griess reagents ( D ). Data in the bar graph are means ± standard error of the difference (SED). * p
    Figure Legend Snippet: Nitric oxide (NO) enhanced thymosin beta-4 (Tβ4) expression and cell migration. A: HeLa cells were incubated under normoxic or hypoxic conditions for 1 h. RNA was purified with TRIZOL reagent as described in the Materials and Methods, and the Tβ4 transcript level was measured using reverse transcriptase polymerase chain reaction (RT-PCR). B: HeLa cells were transfected with a Gaussia luciferase plasmid Tβ4 promoter (Tβ4-GLuc) for 12 h and were incubated under normoxic or hypoxic conditions for 1 h. GLuc activity in culture medium was measured with a luminometer using GLuc substrate and represented as fold GLuc to normoxia control. C–D: HeLa cells were incubated under normoxia or hypoxia condition for an appropriate time. Cell lysates were prepared and the protein level of HIF-1α and Tβ4 in HeLa cells was detected by Western blot analysis ( C ). NO production was detected with Griess reagents ( D ). Data in the bar graph are means ± standard error of the difference (SED). * p

    Techniques Used: Expressing, Migration, Incubation, Purification, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Transfection, Luciferase, Plasmid Preparation, Activity Assay, Western Blot

    31) Product Images from "Galectin-3 Functions as an Alarmin: Pathogenic Role for Sepsis Development in Murine Respiratory Tularemia"

    Article Title: Galectin-3 Functions as an Alarmin: Pathogenic Role for Sepsis Development in Murine Respiratory Tularemia

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0059616

    Upregulated expression and extracellular release of Galectin-3 in lungs during respiratory F. novicida infection. ( A ) Total RNA was extracted by Trizol method from lungs harvested at the indicated times after infection with the Wild-type bacteria (WT) or from mice vaccinated with an attenuated mutant strain followed by challenge with WT bacteria (Mut/WT mice). The mRNA levels of Galectin-3 were analyzed by real-time PCR as described in Materials and Methods and are expressed as fold changes over the levels in mock control mice. Data shown are the averages of 3–4 mice per group. Statistically significant differences are denoted by asterisks (**p
    Figure Legend Snippet: Upregulated expression and extracellular release of Galectin-3 in lungs during respiratory F. novicida infection. ( A ) Total RNA was extracted by Trizol method from lungs harvested at the indicated times after infection with the Wild-type bacteria (WT) or from mice vaccinated with an attenuated mutant strain followed by challenge with WT bacteria (Mut/WT mice). The mRNA levels of Galectin-3 were analyzed by real-time PCR as described in Materials and Methods and are expressed as fold changes over the levels in mock control mice. Data shown are the averages of 3–4 mice per group. Statistically significant differences are denoted by asterisks (**p

    Techniques Used: Expressing, Infection, Mouse Assay, Mutagenesis, Real-time Polymerase Chain Reaction

    32) Product Images from "microRNA-103 regulates the growth and invasion of endometrial cancer cells through the downregulation of tissue inhibitor of metalloproteinase 3"

    Article Title: microRNA-103 regulates the growth and invasion of endometrial cancer cells through the downregulation of tissue inhibitor of metalloproteinase 3

    Journal: Oncology Letters

    doi: 10.3892/ol.2012.638

    TIMP-3 3’-UTR is a direct target for miR-103. (A) Suppression of miR-103 by anti-miR-103 in Ishikawa cells is shown. The cells were frst transfected with anti-miR-103 or negative control oligonucleotide. The cells were harvested 2 days later and total RNA was extracted using TRIzol reagent. Mature miR-103 was detected by SYBR qRT-PCR, using U6 RNA for normalization. (B) Suppression of miR-103 by anti-miR-103 in HEC-1B cells is shown. Following transfection with anti-miR-103 (Anti-miR) or negative control oligonucleotide (Neg Control), mature miR-103 was detected as in (A). (C) An evolutionarily conserved target sequence for miR-103 is detected in the 3’-UTR of TIMP-3. (D and E) The luciferase assay was performed using Ishikawa and HEC-1B cells, respectively. The effect of miR-103 on the luciferase activity of pGL3-TIMP-3-wt and pGL3-TIMP-3-mut was measured as described in Materials and methods. A statistically significant upregulation in luciferase activity was found when the cells were transfected with pGL3-TIMP-3-wt together with anti-miR-103. pGL3-TIMP-3-wt, vector with wild-type TIMP-3 3’-UTR; pGL3-TIMP-3-mut, vector with mutated TIMP-3 3’-UTR. Each bar is the mean ± SEM from three independent experiments. * P
    Figure Legend Snippet: TIMP-3 3’-UTR is a direct target for miR-103. (A) Suppression of miR-103 by anti-miR-103 in Ishikawa cells is shown. The cells were frst transfected with anti-miR-103 or negative control oligonucleotide. The cells were harvested 2 days later and total RNA was extracted using TRIzol reagent. Mature miR-103 was detected by SYBR qRT-PCR, using U6 RNA for normalization. (B) Suppression of miR-103 by anti-miR-103 in HEC-1B cells is shown. Following transfection with anti-miR-103 (Anti-miR) or negative control oligonucleotide (Neg Control), mature miR-103 was detected as in (A). (C) An evolutionarily conserved target sequence for miR-103 is detected in the 3’-UTR of TIMP-3. (D and E) The luciferase assay was performed using Ishikawa and HEC-1B cells, respectively. The effect of miR-103 on the luciferase activity of pGL3-TIMP-3-wt and pGL3-TIMP-3-mut was measured as described in Materials and methods. A statistically significant upregulation in luciferase activity was found when the cells were transfected with pGL3-TIMP-3-wt together with anti-miR-103. pGL3-TIMP-3-wt, vector with wild-type TIMP-3 3’-UTR; pGL3-TIMP-3-mut, vector with mutated TIMP-3 3’-UTR. Each bar is the mean ± SEM from three independent experiments. * P

    Techniques Used: Transfection, Negative Control, Quantitative RT-PCR, Sequencing, Luciferase, Activity Assay, Plasmid Preparation

    33) Product Images from "Enhancing Responsiveness of Human Jejunal Enteroids to Host and Microbial Stimuli"

    Article Title: Enhancing Responsiveness of Human Jejunal Enteroids to Host and Microbial Stimuli

    Journal: The Journal of physiology

    doi: 10.1113/JP279423

    TNF modulates tight junction gene expression by qPCR. Real time quantitative PCR (qPCR) was used to examine the relative expression of junction markers A . Claudin-2 , B. ZO-1 , C. β-catenin , and D. Occludin. HIEs were incubated for 16hours in media, 1 μg/ml IL-1α, TNF and flagellin. The cells were then collected in TRIZOL and RNA isolated. qPCR was then formed to evaluate tight junctions. Data is presented as the ΔΔCT with the house-keeping gene 18S. n=3 wells/experiments, representative of 3 independent experiments. One-Way ANOVA. *p
    Figure Legend Snippet: TNF modulates tight junction gene expression by qPCR. Real time quantitative PCR (qPCR) was used to examine the relative expression of junction markers A . Claudin-2 , B. ZO-1 , C. β-catenin , and D. Occludin. HIEs were incubated for 16hours in media, 1 μg/ml IL-1α, TNF and flagellin. The cells were then collected in TRIZOL and RNA isolated. qPCR was then formed to evaluate tight junctions. Data is presented as the ΔΔCT with the house-keeping gene 18S. n=3 wells/experiments, representative of 3 independent experiments. One-Way ANOVA. *p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Incubation, Isolation

    34) Product Images from "An optimized method to obtain high-quality RNA from different tissues in Lilium davidii var. unicolor"

    Article Title: An optimized method to obtain high-quality RNA from different tissues in Lilium davidii var. unicolor

    Journal: Scientific Reports

    doi: 10.1038/s41598-022-06810-7

    Gel images of total RNA from external scales of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by the modified TRIzol method ( A ), Kit method ( B ) and CTAB method ( C ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, andpictures were taken, respectively. The order of samples of each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium ; Lanes 5–7 are RNA isolated from middle scales of Lilium ; Lanes 8–10 are RNA isolated from basal scales of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.
    Figure Legend Snippet: Gel images of total RNA from external scales of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by the modified TRIzol method ( A ), Kit method ( B ) and CTAB method ( C ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, andpictures were taken, respectively. The order of samples of each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium ; Lanes 5–7 are RNA isolated from middle scales of Lilium ; Lanes 8–10 are RNA isolated from basal scales of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.

    Techniques Used: Isolation, Modification, Marker

    Gel images of total RNA from inner scales of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by TRIzol method ( A ), the modified TRIzol method ( B ), Kit method ( C ) and CTAB method ( D ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples in each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium ; Lanes 5–7 are RNA isolated from middle scales of Lilium ; Lanes 8–10 are RNA isolated from basal scales of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.
    Figure Legend Snippet: Gel images of total RNA from inner scales of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by TRIzol method ( A ), the modified TRIzol method ( B ), Kit method ( C ) and CTAB method ( D ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples in each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium ; Lanes 5–7 are RNA isolated from middle scales of Lilium ; Lanes 8–10 are RNA isolated from basal scales of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.

    Techniques Used: Isolation, Modification, Marker

    Gel images of total RNA from middle scales of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by the modified TRIzol method ( A ), Kit method ( B ) and CTAB method ( C ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples of each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium ; Lanes 5–7 are RNA isolated from middle scales of Lilium ; Lanes 8–10 are RNA isolated from basal scales of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.
    Figure Legend Snippet: Gel images of total RNA from middle scales of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by the modified TRIzol method ( A ), Kit method ( B ) and CTAB method ( C ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples of each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium ; Lanes 5–7 are RNA isolated from middle scales of Lilium ; Lanes 8–10 are RNA isolated from basal scales of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.

    Techniques Used: Isolation, Modification, Marker

    Gel images of total RNA from inner scales of Lilium lancifolium Thunb. and Lilium brownii var. viridulum Baker isolated using the modified TRIzol method. The RNA samples extracted by the modified TRIzol method were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples of each gel lane is as follows: ( A ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium lancifolium Thunb.; Lanes 5–7 are RNA isolated from middle scales of Lilium lancifolium Thunb.; Lanes 8–10 are RNA isolated from basal scales of Lilium lancifolium Thunb.; Lane 11: Loading buffer solution without RNA to serve as a control; ( B ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium brownii var. viridulum Baker; Lanes 5–7 are RNA isolated from middle scales of Lilium brownii var. viridulum Baker; Lanes 8–10 are RNA isolated from basal scales of Lilium brownii var. viridulum Baker; Lane 11: Loading buffer solution without RNA to serve as a control . 28S and 18S represent the location of 28S and 18S rRNA bands.
    Figure Legend Snippet: Gel images of total RNA from inner scales of Lilium lancifolium Thunb. and Lilium brownii var. viridulum Baker isolated using the modified TRIzol method. The RNA samples extracted by the modified TRIzol method were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples of each gel lane is as follows: ( A ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium lancifolium Thunb.; Lanes 5–7 are RNA isolated from middle scales of Lilium lancifolium Thunb.; Lanes 8–10 are RNA isolated from basal scales of Lilium lancifolium Thunb.; Lane 11: Loading buffer solution without RNA to serve as a control; ( B ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium brownii var. viridulum Baker; Lanes 5–7 are RNA isolated from middle scales of Lilium brownii var. viridulum Baker; Lanes 8–10 are RNA isolated from basal scales of Lilium brownii var. viridulum Baker; Lane 11: Loading buffer solution without RNA to serve as a control . 28S and 18S represent the location of 28S and 18S rRNA bands.

    Techniques Used: Isolation, Modification, Marker

    Gel images of total RNAs from root, stem and leaf tissues of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by TRIzol method ( A ), the modified TRIzol method ( B ), Kit method ( C ) and CTAB method ( D ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples in each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from root of Lilium ; Lanes 5–7 are RNA isolated from stem of Lilium ; Lanes 8–10 are RNA isolated from leaf of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.
    Figure Legend Snippet: Gel images of total RNAs from root, stem and leaf tissues of Lilium davidii var. unicolor isolated using different protocols. The RNA samples extracted by TRIzol method ( A ), the modified TRIzol method ( B ), Kit method ( C ) and CTAB method ( D ) were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples in each gel lane is as follows: Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from root of Lilium ; Lanes 5–7 are RNA isolated from stem of Lilium ; Lanes 8–10 are RNA isolated from leaf of Lilium ; Lane 11: Loading buffer solution without RNA to serve as a control. 28S and 18S represent the location of 28S and 18S rRNA bands.

    Techniques Used: Isolation, Modification, Marker

    Gel images of total RNA from inner scales of Lilium lancifolium Thunb. and Lilium brownii var. viridulum Baker isolated using TRIzol method. The RNA samples extracted by TRIzol method were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples of each gel lane is as follows: ( A ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium lancifolium Thunb.; Lanes 5–7 are RNA isolated from middle scales of Lilium lancifolium Thunb.; Lanes 8–10 are RNA isolated from basal scales of Lilium lancifolium Thunb.; Lane 11: Loading buffer solution without RNA to serve as a control; ( B ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium brownii var. viridulum Baker; Lanes 5–7 are RNA isolated from middle scales of Lilium brownii var. viridulum Baker; Lanes 8–10 are RNA isolated from basal scales of Lilium brownii var. viridulum Baker; Lane 11: Loading buffer solution without RNA to serve as a control . 28S and 18S represent the location of 28S and 18S rRNA bands.
    Figure Legend Snippet: Gel images of total RNA from inner scales of Lilium lancifolium Thunb. and Lilium brownii var. viridulum Baker isolated using TRIzol method. The RNA samples extracted by TRIzol method were separated and analyzed in 1% agarose gels, respectively. Then the gels were visualized and exposed by Gel Imager System in different fields, and pictures were taken, respectively. The order of samples of each gel lane is as follows: ( A ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium lancifolium Thunb.; Lanes 5–7 are RNA isolated from middle scales of Lilium lancifolium Thunb.; Lanes 8–10 are RNA isolated from basal scales of Lilium lancifolium Thunb.; Lane 11: Loading buffer solution without RNA to serve as a control; ( B ) Lane 1: DL2000 DNA marker; Lanes 2–4 are RNA isolated from top scales of Lilium brownii var. viridulum Baker; Lanes 5–7 are RNA isolated from middle scales of Lilium brownii var. viridulum Baker; Lanes 8–10 are RNA isolated from basal scales of Lilium brownii var. viridulum Baker; Lane 11: Loading buffer solution without RNA to serve as a control . 28S and 18S represent the location of 28S and 18S rRNA bands.

    Techniques Used: Isolation, Marker

    35) Product Images from "Non-coding function for mRNAs in Focal Adhesion Architecture and Mechanotransduction"

    Article Title: Non-coding function for mRNAs in Focal Adhesion Architecture and Mechanotransduction

    Journal: bioRxiv

    doi: 10.1101/2021.10.04.463097

    Analysis of RNase A treatment. ( A ) RNA purified using standard protocols using Trizol from isolated FAs from control, cyclohexamide (CHX, 100 μg/mL for 10 minutes), or RNase A treatment (1 mg/ml for 10 minutes). ( B ) Box plots represent the number of translational events detected per cell using Puro-PLA for TLN1 and CTNNB1 in Con, CHX, and RNase A treated cells (n=25 cells). CHX treatment decreased the amount of newly synthesized peptide while RNase A treatment saw no change compared to control cells. ( C ) Mean ± STDEV expression of core FA proteins (ITGB1, VCL, PXN, TLN1, ACTN1) from liquid chromatography–mass spectrometry analysis of isolated FAs from control and RNase A treated cells (normalized to controls). ( D ) Representative images of either control or RNase A (1 mg/ml for 10 minutes) treated cells cultured on fibronectin (FN), collagen IV (Col IV), laminin (LM), or collagen I (col I). FAs (white arrows) marked by paxillin (PXN, green) and Vinculin (VCL, red) are show with DAPI (blue) counterstain. For all graphs, significance is represented as not significant (n.s.) P > 0.05, **P ≤ 0.01,***P ≤ 0.001, ****P ≤ 0.0001.
    Figure Legend Snippet: Analysis of RNase A treatment. ( A ) RNA purified using standard protocols using Trizol from isolated FAs from control, cyclohexamide (CHX, 100 μg/mL for 10 minutes), or RNase A treatment (1 mg/ml for 10 minutes). ( B ) Box plots represent the number of translational events detected per cell using Puro-PLA for TLN1 and CTNNB1 in Con, CHX, and RNase A treated cells (n=25 cells). CHX treatment decreased the amount of newly synthesized peptide while RNase A treatment saw no change compared to control cells. ( C ) Mean ± STDEV expression of core FA proteins (ITGB1, VCL, PXN, TLN1, ACTN1) from liquid chromatography–mass spectrometry analysis of isolated FAs from control and RNase A treated cells (normalized to controls). ( D ) Representative images of either control or RNase A (1 mg/ml for 10 minutes) treated cells cultured on fibronectin (FN), collagen IV (Col IV), laminin (LM), or collagen I (col I). FAs (white arrows) marked by paxillin (PXN, green) and Vinculin (VCL, red) are show with DAPI (blue) counterstain. For all graphs, significance is represented as not significant (n.s.) P > 0.05, **P ≤ 0.01,***P ≤ 0.001, ****P ≤ 0.0001.

    Techniques Used: Purification, Isolation, Proximity Ligation Assay, Synthesized, Expressing, Liquid Chromatography, Mass Spectrometry, Cell Culture

    36) Product Images from "Carcinoma-associated fibroblasts promote the proliferation and metastasis of osteosarcoma by transferring exosomal LncRNA SNHG17"

    Article Title: Carcinoma-associated fibroblasts promote the proliferation and metastasis of osteosarcoma by transferring exosomal LncRNA SNHG17

    Journal: American Journal of Translational Research

    doi:

    SNHG17 activates the MMP2 by acting as a competing endogenous RNA sponge for miR-2861. A. The miRNAs targeting MMP2 and SNHG17 were predicted by four online databases. The overlapping miRNAs were performed by the Venn diagram. B. The expression level of miR-2861 and miR-4700-3p in normal tissues and tumor tissues were analyzed by qRT-PCR. C. The binding site between SNHG17 and miR-2861, or the binding sites between MMP2 and miR-2861, was predicted by RNAhybrid databases. D. Luciferase activity in HEK293T cells co-transfected with miR-2861 mimic, inhibitor or related controls (mimic-NC, inhibitor-NC), and a vector containing SNHG17 WT or SNHG17 MUT 3’-UTR, or vectors containing MMP2 WT or MMP2 MUT 3’-UTR. E. Immunoprecipitation using anti-AgO2 antibody or IgG followed by Western blot analysis. Immunoprecipitated RNA was isolated by TRIzol reagent, and the level of miR-2861 or SNHG17 was analyzed by qRT-PCR. ***P
    Figure Legend Snippet: SNHG17 activates the MMP2 by acting as a competing endogenous RNA sponge for miR-2861. A. The miRNAs targeting MMP2 and SNHG17 were predicted by four online databases. The overlapping miRNAs were performed by the Venn diagram. B. The expression level of miR-2861 and miR-4700-3p in normal tissues and tumor tissues were analyzed by qRT-PCR. C. The binding site between SNHG17 and miR-2861, or the binding sites between MMP2 and miR-2861, was predicted by RNAhybrid databases. D. Luciferase activity in HEK293T cells co-transfected with miR-2861 mimic, inhibitor or related controls (mimic-NC, inhibitor-NC), and a vector containing SNHG17 WT or SNHG17 MUT 3’-UTR, or vectors containing MMP2 WT or MMP2 MUT 3’-UTR. E. Immunoprecipitation using anti-AgO2 antibody or IgG followed by Western blot analysis. Immunoprecipitated RNA was isolated by TRIzol reagent, and the level of miR-2861 or SNHG17 was analyzed by qRT-PCR. ***P

    Techniques Used: Expressing, Quantitative RT-PCR, Binding Assay, Luciferase, Activity Assay, Transfection, Plasmid Preparation, Immunoprecipitation, Western Blot, Isolation

    37) Product Images from "Mice with targeted disruption of p8 gene show increased sensitivity to lipopolysaccharide and DNA microarray analysis of livers reveals an aberrant gene expression response"

    Article Title: Mice with targeted disruption of p8 gene show increased sensitivity to lipopolysaccharide and DNA microarray analysis of livers reveals an aberrant gene expression response

    Journal: BMC Gastroenterology

    doi: 10.1186/1471-230X-3-25

    Wild-type mice were injected intraperitoneally with 70 mg/kg LPS ( Salmonella thyphosa ), and mRNA expression was measured in liver after 6 and 18 hours. RNA was extracted using Trizol procedures and 1 μg RNA was analyzed by RT-PCR using specific primers for HMG1, p8 and ribosomal protein L3 (RL3) as a control as described in Material and Methods.
    Figure Legend Snippet: Wild-type mice were injected intraperitoneally with 70 mg/kg LPS ( Salmonella thyphosa ), and mRNA expression was measured in liver after 6 and 18 hours. RNA was extracted using Trizol procedures and 1 μg RNA was analyzed by RT-PCR using specific primers for HMG1, p8 and ribosomal protein L3 (RL3) as a control as described in Material and Methods.

    Techniques Used: Mouse Assay, Injection, Expressing, Reverse Transcription Polymerase Chain Reaction

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher trizol
    qRT-PCR to determine the relative amount of other RNAs compared with L1 <t>RNA</t> in L1 RNPs. ( A ) Total RNA was isolated from RNPs after transfecting FL-O1F by <t>Trizol</t> extraction and treated with DNAse. cDNA was synthesized using an oligo-dT (12 Ts) primer and
    Trizol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 4404 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/trizol/product/Thermo Fisher
    Average 99 stars, based on 4404 article reviews
    Price from $9.99 to $1999.99
    trizol - by Bioz Stars, 2022-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    qRT-PCR to determine the relative amount of other RNAs compared with L1 RNA in L1 RNPs. ( A ) Total RNA was isolated from RNPs after transfecting FL-O1F by Trizol extraction and treated with DNAse. cDNA was synthesized using an oligo-dT (12 Ts) primer and

    Journal: Human Molecular Genetics

    Article Title: Enrichment of processed pseudogene transcripts in L1-ribonucleoprotein particles

    doi: 10.1093/hmg/ddt225

    Figure Lengend Snippet: qRT-PCR to determine the relative amount of other RNAs compared with L1 RNA in L1 RNPs. ( A ) Total RNA was isolated from RNPs after transfecting FL-O1F by Trizol extraction and treated with DNAse. cDNA was synthesized using an oligo-dT (12 Ts) primer and

    Article Snippet: The remainder (148 µl) was used to isolate total RNA from RNPs by Trizol (Ambion).

    Techniques: Quantitative RT-PCR, Isolation, Synthesized

    WT and IRAK2 KO BMDMs were treated with LPS for indicated times and fixed in 0.1% formaldehyde for 15 min at room temperature, whereupon the cross-linking reaction was stopped with glycine (pH 7; 0.25 M). The cells were then washed twice with ice-cold PBS, resuspended in 2 ml RIPA buffer (50 mM Tris-HCl [pH 7.5], 1% NP-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, and proteinase inhibitors), and sonicated. The lysate was centrifuged and each supernatant was immunoprecipitated overnight at 4°C, using Dynabeads preincubated with anti-SRSF1 antibody. The beads were washed five times with 1 ml RIPA buffer and resuspended in 150 ml elution buffer (50 mM Tris-Cl [pH 7], 5 mM EDTA, 10 mM DTT, 1% SDS). RNA was purified from immunoprecipitates with Trizol and RT-PCR analyses of the indicated mRNAs. The presented are the relative values normalized against IgG control (Materials and methods). The experiments were repeated for five times with similar results. Data represent mean ± SEM; *p

    Journal: eLife

    Article Title: IRAK2 directs stimulus-dependent nuclear export of inflammatory mRNAs

    doi: 10.7554/eLife.29630

    Figure Lengend Snippet: WT and IRAK2 KO BMDMs were treated with LPS for indicated times and fixed in 0.1% formaldehyde for 15 min at room temperature, whereupon the cross-linking reaction was stopped with glycine (pH 7; 0.25 M). The cells were then washed twice with ice-cold PBS, resuspended in 2 ml RIPA buffer (50 mM Tris-HCl [pH 7.5], 1% NP-40, 0.5% sodium deoxycholate, 0.05% SDS, 1 mM EDTA, 150 mM NaCl, and proteinase inhibitors), and sonicated. The lysate was centrifuged and each supernatant was immunoprecipitated overnight at 4°C, using Dynabeads preincubated with anti-SRSF1 antibody. The beads were washed five times with 1 ml RIPA buffer and resuspended in 150 ml elution buffer (50 mM Tris-Cl [pH 7], 5 mM EDTA, 10 mM DTT, 1% SDS). RNA was purified from immunoprecipitates with Trizol and RT-PCR analyses of the indicated mRNAs. The presented are the relative values normalized against IgG control (Materials and methods). The experiments were repeated for five times with similar results. Data represent mean ± SEM; *p

    Article Snippet: RNA was purified from immunoprecipitates with Trizol (Invitrogen) according to the manufacturer’s instructions and treated with RNase-free DNase, the cDNAs were synthesized and 10% of the reverse transcriptase product was subjected to quantitative real-time PCR.

    Techniques: Sonication, Immunoprecipitation, Purification, Reverse Transcription Polymerase Chain Reaction

    a, Results of PCR amplifications of the SLC3A1 exons (1–10) and an unrelated gene (N.R.). The patients’ DNA (V10 and V15 in fig. 1 a ) failed to amplify the SLC3A1 exons, whereas good amplification was observed for DNA from a parent (IV1 in fig. 1 a ) and a control. The quality of the patients’ DNA was assessed by its ability to amplify an unrelated gene. A = affected, P = parent, C = unrelated control individual, and M = molecular weight marker X of Amersham. b, Multiplex PCR assay defining the deletion borders. Affected children are indicated by blackened symbols. The PCR reaction included primers a, b, and c, as indicated in fig. 3 a. Primers’ concentrations were 1 mM for primers b and c and 0.5 mM for primer a; annealing temperature was 57°C. The 439-bp product was obtained only if a normal allele was present; the 376-bp product was obtained only if a deletion allele was present. All parents are therefore heterozygotes for the deletion and the wild-type allele. M = the molecular weight marker X of Amersham. c, Results of RT-PCR from lymphoblastoid RNA from an affected individual (A; V10 in fig. 1 a ) compared with control (C) of the SLC3A1, PP2Cβ, and KIAA0436 genes. None of these transcripts are PCR-amplified in the affected individual. The actin gene was included to assess RNA quality. Primers for the PCR were selected on different exons, to avoid amplification from residual DNA in the RNA preparation.

    Journal: American Journal of Human Genetics

    Article Title: A Recessive Contiguous Gene Deletion of Chromosome 2p16 Associated with Cystinuria and a Mitochondrial Disease

    doi:

    Figure Lengend Snippet: a, Results of PCR amplifications of the SLC3A1 exons (1–10) and an unrelated gene (N.R.). The patients’ DNA (V10 and V15 in fig. 1 a ) failed to amplify the SLC3A1 exons, whereas good amplification was observed for DNA from a parent (IV1 in fig. 1 a ) and a control. The quality of the patients’ DNA was assessed by its ability to amplify an unrelated gene. A = affected, P = parent, C = unrelated control individual, and M = molecular weight marker X of Amersham. b, Multiplex PCR assay defining the deletion borders. Affected children are indicated by blackened symbols. The PCR reaction included primers a, b, and c, as indicated in fig. 3 a. Primers’ concentrations were 1 mM for primers b and c and 0.5 mM for primer a; annealing temperature was 57°C. The 439-bp product was obtained only if a normal allele was present; the 376-bp product was obtained only if a deletion allele was present. All parents are therefore heterozygotes for the deletion and the wild-type allele. M = the molecular weight marker X of Amersham. c, Results of RT-PCR from lymphoblastoid RNA from an affected individual (A; V10 in fig. 1 a ) compared with control (C) of the SLC3A1, PP2Cβ, and KIAA0436 genes. None of these transcripts are PCR-amplified in the affected individual. The actin gene was included to assess RNA quality. Primers for the PCR were selected on different exons, to avoid amplification from residual DNA in the RNA preparation.

    Article Snippet: RNA was extracted, using Trizol (Gibco), from lymphoblastoid cell lines of two patients.

    Techniques: Polymerase Chain Reaction, Amplification, Molecular Weight, Marker, Multiplex Assay, Reverse Transcription Polymerase Chain Reaction

    DNA can serve as a template during miRNA detection. ( A ) False positive signal of DNA derives mainly from the reverse transcription reaction. Mature miR-1226-3p was tested in the indicated samples, with or without reverse transcription (RT). On the y-axis, dC t value is represented, calculated as the Ct difference between the examined samples and the gDNA of control HeLa_mir-33b cell line (Ct = 35,9). One C t difference represents about 2× higher detected mature miRNA level. ( B ) DNA contamination remains in total RNA samples during isolation by the widely used Trizol reagent. Total RNA samples were isolated from transiently transfected HeLa cells; the transfected plasmid DNA amounts are indicated. Samples were DNase treated and non-treated, then reverse transcribed and subjected to real-time PCR. Expression values relative to U6 snRNA are shown on the y-axis. Experiments were carried out with three replicates at least from three independent experiments; one representative experiment is shown, error bars represent standard deviations.

    Journal: PLoS ONE

    Article Title: 3′ IsomiR Species and DNA Contamination Influence Reliable Quantification of MicroRNAs by Stem-Loop Quantitative PCR

    doi: 10.1371/journal.pone.0106315

    Figure Lengend Snippet: DNA can serve as a template during miRNA detection. ( A ) False positive signal of DNA derives mainly from the reverse transcription reaction. Mature miR-1226-3p was tested in the indicated samples, with or without reverse transcription (RT). On the y-axis, dC t value is represented, calculated as the Ct difference between the examined samples and the gDNA of control HeLa_mir-33b cell line (Ct = 35,9). One C t difference represents about 2× higher detected mature miRNA level. ( B ) DNA contamination remains in total RNA samples during isolation by the widely used Trizol reagent. Total RNA samples were isolated from transiently transfected HeLa cells; the transfected plasmid DNA amounts are indicated. Samples were DNase treated and non-treated, then reverse transcribed and subjected to real-time PCR. Expression values relative to U6 snRNA are shown on the y-axis. Experiments were carried out with three replicates at least from three independent experiments; one representative experiment is shown, error bars represent standard deviations.

    Article Snippet: miRNA analysis Total RNA was isolated from cultured cells using either the Trizol reagent or the mir Vana miRNA Isolation Kit (Life Technologies); small RNA samples were isolated using the mir Vana miRNA Isolation Kit (Life Technologies).

    Techniques: Isolation, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction, Expressing