snap cenp c pull down experiments cenp c1 544 snap  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92

    Structured Review

    New England Biolabs snap cenp c pull down experiments cenp c1 544 snap
    Molecular Basis of Kinetochore Recruitment of <t>CENP-OPQUR</t> (A) Depletion of CENP-H, CENP-L, or CENP-N prevented kinetochore localization of GFP-CENP-Q in HeLa FlpIn TRex cell lines stably expressing GFP-CENP-Q, as shown by representative images. CENP-HK complex is also lost from kinetochores during the aforementioned RNAi depletions. Scale bar, 5 μm. (B) Quantification of the amount of GFP-CENP-Q (green bars) and CENP-HK (red bars) at kinetochores following CENP-H, CENP-L, or CENP-N depletion. ∗∗ p ≤ 0.01. Graph shows representative results from one of three independent experiments. A minimum of 158 kinetochores was quantified. (C) Coomassie-stained SDS-PAGE of recombinant <t>CENP-C</t> 1–544 , CENP-HI Δ56 KM, and CENP-LN used in (D). (D) Pull-down assays using <t>SNAP-CENP-C</t> 1–544 bait. CENP-OP binds the solid phase only in the presence of CENP-HI Δ56 KM and CENP-LN. Subsequently, CENP-QU and CENP-R can also be recruited. Shown are Western blots of the indicated species. The experiment shown is representative of three technical replicas. (E) RNAi-resistant GFP-CENP-P localized to the kinetochore after depletion of endogenous CENP-P, while GFP-CENP-P F116G did not. CREST signal (red) was unaffected by CENP-P depletion or by impaired localization of GFP-CENP-P F118G . DAPI (DNA) is shown in blue. Arrowheads indicate misaligned chromosomes. MG132 (10 μM) was added to prevent mitotic exit. Scale bar, 5 μm. (F) Quantification of the experiment in (E). The number of cells analyzed is in parentheses. Error bars represent standard deviations. See also Figure S2 and Figure S3 .
    Snap Cenp C Pull Down Experiments Cenp C1 544 Snap, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 92/100, based on 1515 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/snap cenp c pull down experiments cenp c1 544 snap/product/New England Biolabs
    Average 92 stars, based on 1515 article reviews
    Price from $9.99 to $1999.99
    snap cenp c pull down experiments cenp c1 544 snap - by Bioz Stars, 2020-08
    92/100 stars

    Images

    1) Product Images from "Reconstitution of a 26-Subunit Human Kinetochore Reveals Cooperative Microtubule Binding by CENP-OPQUR and NDC80"

    Article Title: Reconstitution of a 26-Subunit Human Kinetochore Reveals Cooperative Microtubule Binding by CENP-OPQUR and NDC80

    Journal: Molecular Cell

    doi: 10.1016/j.molcel.2018.07.038

    Molecular Basis of Kinetochore Recruitment of CENP-OPQUR (A) Depletion of CENP-H, CENP-L, or CENP-N prevented kinetochore localization of GFP-CENP-Q in HeLa FlpIn TRex cell lines stably expressing GFP-CENP-Q, as shown by representative images. CENP-HK complex is also lost from kinetochores during the aforementioned RNAi depletions. Scale bar, 5 μm. (B) Quantification of the amount of GFP-CENP-Q (green bars) and CENP-HK (red bars) at kinetochores following CENP-H, CENP-L, or CENP-N depletion. ∗∗ p ≤ 0.01. Graph shows representative results from one of three independent experiments. A minimum of 158 kinetochores was quantified. (C) Coomassie-stained SDS-PAGE of recombinant CENP-C 1–544 , CENP-HI Δ56 KM, and CENP-LN used in (D). (D) Pull-down assays using SNAP-CENP-C 1–544 bait. CENP-OP binds the solid phase only in the presence of CENP-HI Δ56 KM and CENP-LN. Subsequently, CENP-QU and CENP-R can also be recruited. Shown are Western blots of the indicated species. The experiment shown is representative of three technical replicas. (E) RNAi-resistant GFP-CENP-P localized to the kinetochore after depletion of endogenous CENP-P, while GFP-CENP-P F116G did not. CREST signal (red) was unaffected by CENP-P depletion or by impaired localization of GFP-CENP-P F118G . DAPI (DNA) is shown in blue. Arrowheads indicate misaligned chromosomes. MG132 (10 μM) was added to prevent mitotic exit. Scale bar, 5 μm. (F) Quantification of the experiment in (E). The number of cells analyzed is in parentheses. Error bars represent standard deviations. See also Figure S2 and Figure S3 .
    Figure Legend Snippet: Molecular Basis of Kinetochore Recruitment of CENP-OPQUR (A) Depletion of CENP-H, CENP-L, or CENP-N prevented kinetochore localization of GFP-CENP-Q in HeLa FlpIn TRex cell lines stably expressing GFP-CENP-Q, as shown by representative images. CENP-HK complex is also lost from kinetochores during the aforementioned RNAi depletions. Scale bar, 5 μm. (B) Quantification of the amount of GFP-CENP-Q (green bars) and CENP-HK (red bars) at kinetochores following CENP-H, CENP-L, or CENP-N depletion. ∗∗ p ≤ 0.01. Graph shows representative results from one of three independent experiments. A minimum of 158 kinetochores was quantified. (C) Coomassie-stained SDS-PAGE of recombinant CENP-C 1–544 , CENP-HI Δ56 KM, and CENP-LN used in (D). (D) Pull-down assays using SNAP-CENP-C 1–544 bait. CENP-OP binds the solid phase only in the presence of CENP-HI Δ56 KM and CENP-LN. Subsequently, CENP-QU and CENP-R can also be recruited. Shown are Western blots of the indicated species. The experiment shown is representative of three technical replicas. (E) RNAi-resistant GFP-CENP-P localized to the kinetochore after depletion of endogenous CENP-P, while GFP-CENP-P F116G did not. CREST signal (red) was unaffected by CENP-P depletion or by impaired localization of GFP-CENP-P F118G . DAPI (DNA) is shown in blue. Arrowheads indicate misaligned chromosomes. MG132 (10 μM) was added to prevent mitotic exit. Scale bar, 5 μm. (F) Quantification of the experiment in (E). The number of cells analyzed is in parentheses. Error bars represent standard deviations. See also Figure S2 and Figure S3 .

    Techniques Used: Stable Transfection, Expressing, Staining, SDS Page, Recombinant, Western Blot

    2) Product Images from "A PB1-K577E Mutation in H9N2 Influenza Virus Increases Polymerase Activity and Pathogenicity in Mice"

    Article Title: A PB1-K577E Mutation in H9N2 Influenza Virus Increases Polymerase Activity and Pathogenicity in Mice

    Journal: Viruses

    doi: 10.3390/v10110653

    Deglycosylation of HA caused by mutation. MDCK cells were infected with viruses bearing a wild-type or mutant HA (N132D or N198S) and incubated at 37 °C for 12 h. Proteins were extracted from infected or mock-infected cells and treated with or without PNGase F. The samples were run on an 8% sodium dodecyl sulphate (SDS)-polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane for Western blotting analysis using anti-H9N2 virus mouse polyclonal antibody as the primary antibody. HA0 and NP are indicated by arrowheads.
    Figure Legend Snippet: Deglycosylation of HA caused by mutation. MDCK cells were infected with viruses bearing a wild-type or mutant HA (N132D or N198S) and incubated at 37 °C for 12 h. Proteins were extracted from infected or mock-infected cells and treated with or without PNGase F. The samples were run on an 8% sodium dodecyl sulphate (SDS)-polyacrylamide gel and transferred to a polyvinylidene fluoride (PVDF) membrane for Western blotting analysis using anti-H9N2 virus mouse polyclonal antibody as the primary antibody. HA0 and NP are indicated by arrowheads.

    Techniques Used: Mutagenesis, Infection, Incubation, Western Blot

    3) Product Images from "Non-Secreted Clusterin Isoforms Are Translated in Rare Amounts from Distinct Human mRNA Variants and Do Not Affect Bax-Mediated Apoptosis or the NF-?B Signaling Pathway"

    Article Title: Non-Secreted Clusterin Isoforms Are Translated in Rare Amounts from Distinct Human mRNA Variants and Do Not Affect Bax-Mediated Apoptosis or the NF-?B Signaling Pathway

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0075303

    Characterization of CLU-isoform biogenesis. (A) Schematic outline of the 5’-sequence of variant 1 showing the sCLU start codon (framed) and the downstream start codon on exon 3 (underlined). A non-canonical CTG start codon is present on exon 2 (underlined). The SSCR (black shaded nucleotides) and the exon 2/exon 3 border (arrow) are indicated. (B) Western blots of recombinant CLU-V5 proteins in lysates (upper panel) and culture media (lower panel) of HEK-293 cells transiently expressing unmodified or point-mutated (crossed out codons) CLU cDNA variant 1. CLU 34‑449 is translated from the ATG codon on exon 3 (lanes 2, 7). The 50 kDa CLU‑V5 band consists of the sCLU pre-pro-protein (CLU 1‑449 ) translated from the sCLU start codon and CLU 21‑449 translated from the CTG codon (lanes 4, 6). (C) Western blot of recombinant CLU-V5 proteins in lysates of HEK-293 cells transiently expressing sCLU/CLU 1‑449 , CLU 21‑449 or CLU 34‑449 from point-mutated variant 1 cDNAs or unmodified variant 1 cDNA (wildtype). Lysates were treated with PNGase F as indicated. The molecular weights of psCLU and sCLU decrease upon deglycosylation (psCLU/sCLU n.g., lanes 3, 4). PNGase F treatment does not alter the molecular weights of CLU 1‑449 (lanes 3, 4), CLU 21‑449 (lanes 5, 6) and CLU 34‑449 (lanes 7, 8). (D) Western blots of untagged CLU proteins in lysates (upper panel) and culture media (lower panel) of control and MG-132-treated HEK-293 cells transiently expressing sCLU/CLU 1‑449 , CLU 21‑449 or CLU 34‑449 from point-mutated variant 1 cDNAs or transfected with pcDNA (mock). In contrast to CLU 1‑449 and CLU 21‑449 which accumulate upon proteasome inhibition (lanes 3-6), the amount of CLU 34‑449 is not affected (lanes 7, 8). (B, C, D) Data shown are representative of three independent experiments. Lanes are labeled with circled numbers. Recombinant CLU protein bands with a molecular weight of ~38 kDa presumably originate from even further downstream translation initiation sites on CLU cDNAs.
    Figure Legend Snippet: Characterization of CLU-isoform biogenesis. (A) Schematic outline of the 5’-sequence of variant 1 showing the sCLU start codon (framed) and the downstream start codon on exon 3 (underlined). A non-canonical CTG start codon is present on exon 2 (underlined). The SSCR (black shaded nucleotides) and the exon 2/exon 3 border (arrow) are indicated. (B) Western blots of recombinant CLU-V5 proteins in lysates (upper panel) and culture media (lower panel) of HEK-293 cells transiently expressing unmodified or point-mutated (crossed out codons) CLU cDNA variant 1. CLU 34‑449 is translated from the ATG codon on exon 3 (lanes 2, 7). The 50 kDa CLU‑V5 band consists of the sCLU pre-pro-protein (CLU 1‑449 ) translated from the sCLU start codon and CLU 21‑449 translated from the CTG codon (lanes 4, 6). (C) Western blot of recombinant CLU-V5 proteins in lysates of HEK-293 cells transiently expressing sCLU/CLU 1‑449 , CLU 21‑449 or CLU 34‑449 from point-mutated variant 1 cDNAs or unmodified variant 1 cDNA (wildtype). Lysates were treated with PNGase F as indicated. The molecular weights of psCLU and sCLU decrease upon deglycosylation (psCLU/sCLU n.g., lanes 3, 4). PNGase F treatment does not alter the molecular weights of CLU 1‑449 (lanes 3, 4), CLU 21‑449 (lanes 5, 6) and CLU 34‑449 (lanes 7, 8). (D) Western blots of untagged CLU proteins in lysates (upper panel) and culture media (lower panel) of control and MG-132-treated HEK-293 cells transiently expressing sCLU/CLU 1‑449 , CLU 21‑449 or CLU 34‑449 from point-mutated variant 1 cDNAs or transfected with pcDNA (mock). In contrast to CLU 1‑449 and CLU 21‑449 which accumulate upon proteasome inhibition (lanes 3-6), the amount of CLU 34‑449 is not affected (lanes 7, 8). (B, C, D) Data shown are representative of three independent experiments. Lanes are labeled with circled numbers. Recombinant CLU protein bands with a molecular weight of ~38 kDa presumably originate from even further downstream translation initiation sites on CLU cDNAs.

    Techniques Used: Sequencing, Variant Assay, CTG Assay, Western Blot, Recombinant, Expressing, Transfection, Inhibition, Labeling, Molecular Weight

    4) Product Images from "Phosphoregulation of Cbk1 is critical for RAM network control of transcription and morphogenesis"

    Article Title: Phosphoregulation of Cbk1 is critical for RAM network control of transcription and morphogenesis

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200604107

    T-loop modification occurs through intramolecular autophosphorylation.  (A) Proteins were immunoprecipitated with anti-HA from wild-type (ELY126) and Cbk1-HA (ELY140) strains. Half of the immunoprecipitated proteins was removed and treated with λ phosphatase. The proteins were then blotted with the indicated antibodies. Anti-pS570 was used to detect T-loop site phosphorylation, and anti-pT743 was used to detect CT-motif site phosphorylation (Cbk1-HA; 90 kD). (B) Proteins were immunoprecipitated with anti-HA from strains expressing Cbk1-HA (ELY140), the T-loop allele (ELY390), the CT-motif allele (ELY437), and kinase-dead Cbk1 (ELY426). Proteins were resolved by SDS-PAGE and blotted with the indicated antibodies. (C) Proteins were immunoprecipitated from a haploid strain expressing Cbk1-HA (ELY140) and a diploid strain expressing Cbk1-GFP and kinase-dead Cbk1-HA (ELY537). Immunoprecipitation was done with anti-HA so that only kinase-dead Cbk1 would precipitate from the diploid strain (in addition, GFP-tagged Cbk1 runs at a higher molecular weight than HA-tagged Cbk1). Half the immunoprecipitates from Cbk1-HA were treated with λ phosphatase. The proteins were resolved by SDS-PAGE and probed with the indicated antibodies.
    Figure Legend Snippet: T-loop modification occurs through intramolecular autophosphorylation. (A) Proteins were immunoprecipitated with anti-HA from wild-type (ELY126) and Cbk1-HA (ELY140) strains. Half of the immunoprecipitated proteins was removed and treated with λ phosphatase. The proteins were then blotted with the indicated antibodies. Anti-pS570 was used to detect T-loop site phosphorylation, and anti-pT743 was used to detect CT-motif site phosphorylation (Cbk1-HA; 90 kD). (B) Proteins were immunoprecipitated with anti-HA from strains expressing Cbk1-HA (ELY140), the T-loop allele (ELY390), the CT-motif allele (ELY437), and kinase-dead Cbk1 (ELY426). Proteins were resolved by SDS-PAGE and blotted with the indicated antibodies. (C) Proteins were immunoprecipitated from a haploid strain expressing Cbk1-HA (ELY140) and a diploid strain expressing Cbk1-GFP and kinase-dead Cbk1-HA (ELY537). Immunoprecipitation was done with anti-HA so that only kinase-dead Cbk1 would precipitate from the diploid strain (in addition, GFP-tagged Cbk1 runs at a higher molecular weight than HA-tagged Cbk1). Half the immunoprecipitates from Cbk1-HA were treated with λ phosphatase. The proteins were resolved by SDS-PAGE and probed with the indicated antibodies.

    Techniques Used: Modification, Immunoprecipitation, Expressing, SDS Page, Molecular Weight

    Cbk1 modification is dynamic over the cell cycle.  (A) Cells carrying Cbk1-HA (ELY140) were arrested with α factor for 2 h, until  > 80% of cells had formed mating projections. They were then washed extensively and released into fresh YPD. Cells were harvested every 15 min, and lysates from each time point were subjected to immunoprecipitation with anti-HA. The resulting proteins were resolved by SDS-PAGE, blotted with the indicated antibodies, and imaged using fluorescently labeled secondary antibodies. Slower migrating forms of Cbk1-HA appear, particularly at the 45-, 60-, and 150-min time points; these are detected by anti-HA and both phosphospecific antibodies. CT-motif phosphorylation peaks at 45 and 120 min. (B) At each time point, cells were fixed in formaldehyde to assess the budding index. Fixed cells were sonicated with a probe to break apart any clumps of cells, and budding morphology was scored ( n >  200). (C) Merge of anti-HA and anti-pS570 images in A. Fluorescent detection allows overlay of two color images: red represents anti-HA and green represents anti-pS570. Note bias of T-loop phosphorylation to slower migrating forms of Cbk1-HA in both the 45- and 60-min time points. (D) Proteins were immunoprecipitated with anti-HA from strains expressing Cbk1-HA (ELY140), the  cbk1  T-loop allele (ELY390), the  cbk1  CT-motif allele (ELY437), and  cbk1  kinase-dead allele (ELY426). Half of each immunoprecipitation was treated with λ phosphatase. Proteins were resolved by SDS-PAGE, run longer to enhance separation, and blotted with anti-HA. The resulting bands were imaged using fluorescently conjugated secondary antibodies and subsequently quantified; all proteins are expressed at similar levels, and a pronounced shift is evident under these conditions for the CT-motif allele (Cbk1-HA, 90 kD).
    Figure Legend Snippet: Cbk1 modification is dynamic over the cell cycle. (A) Cells carrying Cbk1-HA (ELY140) were arrested with α factor for 2 h, until > 80% of cells had formed mating projections. They were then washed extensively and released into fresh YPD. Cells were harvested every 15 min, and lysates from each time point were subjected to immunoprecipitation with anti-HA. The resulting proteins were resolved by SDS-PAGE, blotted with the indicated antibodies, and imaged using fluorescently labeled secondary antibodies. Slower migrating forms of Cbk1-HA appear, particularly at the 45-, 60-, and 150-min time points; these are detected by anti-HA and both phosphospecific antibodies. CT-motif phosphorylation peaks at 45 and 120 min. (B) At each time point, cells were fixed in formaldehyde to assess the budding index. Fixed cells were sonicated with a probe to break apart any clumps of cells, and budding morphology was scored ( n > 200). (C) Merge of anti-HA and anti-pS570 images in A. Fluorescent detection allows overlay of two color images: red represents anti-HA and green represents anti-pS570. Note bias of T-loop phosphorylation to slower migrating forms of Cbk1-HA in both the 45- and 60-min time points. (D) Proteins were immunoprecipitated with anti-HA from strains expressing Cbk1-HA (ELY140), the cbk1 T-loop allele (ELY390), the cbk1 CT-motif allele (ELY437), and cbk1 kinase-dead allele (ELY426). Half of each immunoprecipitation was treated with λ phosphatase. Proteins were resolved by SDS-PAGE, run longer to enhance separation, and blotted with anti-HA. The resulting bands were imaged using fluorescently conjugated secondary antibodies and subsequently quantified; all proteins are expressed at similar levels, and a pronounced shift is evident under these conditions for the CT-motif allele (Cbk1-HA, 90 kD).

    Techniques Used: Modification, Immunoprecipitation, SDS Page, Labeling, Sonication, Expressing

    5) Product Images from "Human Cdc14A Phosphatase Modulates the G2/M Transition through Cdc25A and Cdc25B *"

    Article Title: Human Cdc14A Phosphatase Modulates the G2/M Transition through Cdc25A and Cdc25B *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M110.133009

    Cdc14A dephosphorylates and inhibits Cdc25B. A , full-length, N-, or C-terminal Cdc25B forms were expressed in U-2-OS cells for 24 h, immunoprecipitated with anti-HA antibody, and incubated with GST-Cdc14A or λ phosphatase. Dephosphorylation of Cdc25B was monitored by immunoblotting. B , Cdc25B-N or -C immunocomplexes, prepared as in A , were incubated with recombinant Cdk1-cyclin B1 and [γ- 32 P]ATP, and then with GST-Cdc14A or GST-Cdc14A(PD) forms. Phosphorylated proteins were visualized by autoradiography. C , U-2-OS-Cdc14A cell lines were left untreated or induced to express the transgenes for 48 h. Cells were then processed for the measurement of Cdc25B activity on Cdk1-cyclin B1 complexes, whose activation was then measured by kinase assays on histone H1. The input lane shows the activity of Cdk1-cyclin B1 not incubated with Cdc25B. D , U-2-OS cells were synchronized and transfected as described in the legend to Fig. 3 A . Cells were collected at 12 h after release and processed for Cdc25B activity analysis. The results correspond to the 12-h release samples of Fig. 3 and are representative of two independent experiments. E , Cdc25B was immunoprecipitated from U-2-OS cells and incubated with GST-Cdc14A forms. The samples were then divided and processed for the immunoblotting of Cdc25B or the measurement of Cdc25B activity.
    Figure Legend Snippet: Cdc14A dephosphorylates and inhibits Cdc25B. A , full-length, N-, or C-terminal Cdc25B forms were expressed in U-2-OS cells for 24 h, immunoprecipitated with anti-HA antibody, and incubated with GST-Cdc14A or λ phosphatase. Dephosphorylation of Cdc25B was monitored by immunoblotting. B , Cdc25B-N or -C immunocomplexes, prepared as in A , were incubated with recombinant Cdk1-cyclin B1 and [γ- 32 P]ATP, and then with GST-Cdc14A or GST-Cdc14A(PD) forms. Phosphorylated proteins were visualized by autoradiography. C , U-2-OS-Cdc14A cell lines were left untreated or induced to express the transgenes for 48 h. Cells were then processed for the measurement of Cdc25B activity on Cdk1-cyclin B1 complexes, whose activation was then measured by kinase assays on histone H1. The input lane shows the activity of Cdk1-cyclin B1 not incubated with Cdc25B. D , U-2-OS cells were synchronized and transfected as described in the legend to Fig. 3 A . Cells were collected at 12 h after release and processed for Cdc25B activity analysis. The results correspond to the 12-h release samples of Fig. 3 and are representative of two independent experiments. E , Cdc25B was immunoprecipitated from U-2-OS cells and incubated with GST-Cdc14A forms. The samples were then divided and processed for the immunoblotting of Cdc25B or the measurement of Cdc25B activity.

    Techniques Used: Immunoprecipitation, Incubation, De-Phosphorylation Assay, Recombinant, Autoradiography, Activity Assay, Activation Assay, Transfection

    6) Product Images from "BST2/Tetherin Inhibition of Alphavirus Exit"

    Article Title: BST2/Tetherin Inhibition of Alphavirus Exit

    Journal: Viruses

    doi: 10.3390/v7042147

    Effects of tetherin isoforms on SFV and VSV release. ( A ) Populations of Tet-On cells that inducibly express the long and short isoforms of tetherin (Tetherin-WT), or solely L-tetherin or S-tetherin were incubated in the presence or absence of tetracycline (TET) for 24 h. Nuclei (Blue) and cell surface expression of tetherin (Green) were detected as in Figure 1 A. Bars = 50 µm; ( B – D ) SFV release assay. The indicated Tet-On cells were induced as in Figure 7 A, and infected with SFV for 7 h. SFV particles released into the culture medium were either ( B ) titered or ( C – D ) pelleted for SDS-PAGE,WB and quantitation of release as in Figure 2 . Tetherin isoforms were detected by WB; the gel shows the migration of the tetherin dimers. ( E – G ) VSV release assay, performed, titered ( E ), analyzed ( F ) and quantitated ( G ) as in B – D using a mAb to VSV-G. Graphs represent the mean and SD of three independent experiments. Note that all titers are graphed in a log plot.
    Figure Legend Snippet: Effects of tetherin isoforms on SFV and VSV release. ( A ) Populations of Tet-On cells that inducibly express the long and short isoforms of tetherin (Tetherin-WT), or solely L-tetherin or S-tetherin were incubated in the presence or absence of tetracycline (TET) for 24 h. Nuclei (Blue) and cell surface expression of tetherin (Green) were detected as in Figure 1 A. Bars = 50 µm; ( B – D ) SFV release assay. The indicated Tet-On cells were induced as in Figure 7 A, and infected with SFV for 7 h. SFV particles released into the culture medium were either ( B ) titered or ( C – D ) pelleted for SDS-PAGE,WB and quantitation of release as in Figure 2 . Tetherin isoforms were detected by WB; the gel shows the migration of the tetherin dimers. ( E – G ) VSV release assay, performed, titered ( E ), analyzed ( F ) and quantitated ( G ) as in B – D using a mAb to VSV-G. Graphs represent the mean and SD of three independent experiments. Note that all titers are graphed in a log plot.

    Techniques Used: Incubation, Expressing, Release Assay, Infection, SDS Page, Western Blot, Quantitation Assay, Migration

    7) Product Images from "Cryo-EM structure of a helicase loading intermediate containing ORC-Cdc6-Cdt1-MCM2-7 bound to DNA"

    Article Title: Cryo-EM structure of a helicase loading intermediate containing ORC-Cdc6-Cdt1-MCM2-7 bound to DNA

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.2629

    Mapping protein and DNA components of the OCCM ( a - f ) 2D class averages and 3D reconstruction of OCCM with MBP fused to the C-terminus (CT) of Orc2 (Orc2-MBP) ( a ), the N-terminus (NT) of Mcm2 (MBP-Mcm2) ( b ), the NT of Mcm3 (MBP-Mcm3) ( c ), the CT of Mcm5 (MBP-Mcm5) ( d ), the NT of Cdt1 (MBP-Cdt1) ( e ), and the NT of Mcm6 (MBP-Mcm6) ( f ), respectively. In each left panel, the upper row shows two reference-free class averages, and the lower row shows the same images displayed at a higher contrast level (C=0.3). Each middle panel shows the surface rendered front, back, and bottom views of the 3D map of the MBP-fused OCCM complex. The peripheral MBP density is colored blue. The surface-rendering thresholds were lowered by ~20% to better visualize the small MBP density. Each right panel shows a vertical ( a-b ) or a horizontal section ( c-f ) of the 3D map of the MBP-fused OCCM (first column) in comparison to the corresponding section of that of the wild type OCCM (second column). The lower row is displayed at a higher contrast level than the upper row. The red arrows point to the MBP density at the peripheral of OCCM. All MBP fusion complexes were imaged by cryo-EM exception for MBP-Mcm3 ( c ) that was by negative stained EM. All fusion complexes were cleaved off the plasmid DNA by DNases I except for MBP-Mcm6 that was by Alu I ( f ). ( g ) Reference-free class averages of wtOCCM with their plasmid DNA digested either by DNase I (upper row) or by Alu I (lower row). Blue arrows point to dsDNA stub on the top ORC-Cdc6 region of OCCM. ( h ) MCM2-7 organization as mapped by the four MBP-fused Mcm subunits (red), viewed from the N-terminal end of MCM2-7. Box size is 37 nm in the left panels, 34 nm in the right panels in ( a-f ), and 31 nm in ( g ). 3D maps are on same scale.
    Figure Legend Snippet: Mapping protein and DNA components of the OCCM ( a - f ) 2D class averages and 3D reconstruction of OCCM with MBP fused to the C-terminus (CT) of Orc2 (Orc2-MBP) ( a ), the N-terminus (NT) of Mcm2 (MBP-Mcm2) ( b ), the NT of Mcm3 (MBP-Mcm3) ( c ), the CT of Mcm5 (MBP-Mcm5) ( d ), the NT of Cdt1 (MBP-Cdt1) ( e ), and the NT of Mcm6 (MBP-Mcm6) ( f ), respectively. In each left panel, the upper row shows two reference-free class averages, and the lower row shows the same images displayed at a higher contrast level (C=0.3). Each middle panel shows the surface rendered front, back, and bottom views of the 3D map of the MBP-fused OCCM complex. The peripheral MBP density is colored blue. The surface-rendering thresholds were lowered by ~20% to better visualize the small MBP density. Each right panel shows a vertical ( a-b ) or a horizontal section ( c-f ) of the 3D map of the MBP-fused OCCM (first column) in comparison to the corresponding section of that of the wild type OCCM (second column). The lower row is displayed at a higher contrast level than the upper row. The red arrows point to the MBP density at the peripheral of OCCM. All MBP fusion complexes were imaged by cryo-EM exception for MBP-Mcm3 ( c ) that was by negative stained EM. All fusion complexes were cleaved off the plasmid DNA by DNases I except for MBP-Mcm6 that was by Alu I ( f ). ( g ) Reference-free class averages of wtOCCM with their plasmid DNA digested either by DNase I (upper row) or by Alu I (lower row). Blue arrows point to dsDNA stub on the top ORC-Cdc6 region of OCCM. ( h ) MCM2-7 organization as mapped by the four MBP-fused Mcm subunits (red), viewed from the N-terminal end of MCM2-7. Box size is 37 nm in the left panels, 34 nm in the right panels in ( a-f ), and 31 nm in ( g ). 3D maps are on same scale.

    Techniques Used: Staining, Plasmid Preparation

    In vitro assembly of the OCCM complex ( a ) Model for Cdc6 recruitment to the replication origin readies the ORC for loading of MCM2-7. ( b ) Averaged cryo-EM images of the in vitro assembled OCCM. For scale, the box size is 27 nm. An enlarged view with the top area tentatively assigned to ORC-Cdc6 and the lower region to Cdt1-MCM2-7. ( c ) Mcm2 IP identifies the OCCM components. Using purified ORC, Cdc6, Cdt1, MCM2-7 (lanes 1-4) and origin DNA OCCM was assembled in the presence of ATPγS. OCCM was cleaved off from the plasmid DNA with DNase I and immunoprecipitated with an anti-Mcm2 antibody (lanes 5-7) or with anti-MBP control antibody (lanes 8-10). Asterisk marks nonspecific proteins from antibody-conjugated beads.
    Figure Legend Snippet: In vitro assembly of the OCCM complex ( a ) Model for Cdc6 recruitment to the replication origin readies the ORC for loading of MCM2-7. ( b ) Averaged cryo-EM images of the in vitro assembled OCCM. For scale, the box size is 27 nm. An enlarged view with the top area tentatively assigned to ORC-Cdc6 and the lower region to Cdt1-MCM2-7. ( c ) Mcm2 IP identifies the OCCM components. Using purified ORC, Cdc6, Cdt1, MCM2-7 (lanes 1-4) and origin DNA OCCM was assembled in the presence of ATPγS. OCCM was cleaved off from the plasmid DNA with DNase I and immunoprecipitated with an anti-Mcm2 antibody (lanes 5-7) or with anti-MBP control antibody (lanes 8-10). Asterisk marks nonspecific proteins from antibody-conjugated beads.

    Techniques Used: In Vitro, Purification, Plasmid Preparation, Immunoprecipitation

    8) Product Images from "Maintenance of epithelial traits and resistance to mesenchymal reprogramming promote proliferation in metastatic breast cancer"

    Article Title: Maintenance of epithelial traits and resistance to mesenchymal reprogramming promote proliferation in metastatic breast cancer

    Journal: bioRxiv

    doi: 10.1101/2020.03.19.998823

    A subset of breast cancer single-cell clones resists complete EMT and maintains the ability to proliferate in different environments a , Bright field images of a representative E-SCC (E1) and a representative M-SCC (M2), untreated (-TAM), treated with Tamoxifen for 7 days (+TAM 7d), or treated with Tamoxifen for 14 days (+TAM 14d). Scale bar: 100 µm. b , Immunofluorescence staining of DAPI (blue), E-cadherin (CDH1, green), and Vimentin (VIM, red) of a representative E-SCC (E1) and a representative M-SCC (M2), untreated (-TAM), treated with Tamoxifen for 15 days (+TAM), or treated with Tamoxifen for 15 days followed by Tamoxifen withdrawal for 9 days (+/-TAM). Scale bar: 20 µm. c , Flow cytometric staining of EPCAM of a representative E-SCC (E1) and a representative M-SCC (M2), untreated (-TAM) or treated with Tamoxifen for 14 days (+TAM 14d). Gates for EPCAM were set according to a control as indicated by control cells only stained for 7AAD (7AAD ctrl). d , log relative mRNA expression levels of EPCAM, CDH1, VIM , and FN1 in E-SCCs (E1-E3) and M-SCCs (M1-M3), treated as described in a. n=3; mean ± SEM; multiple t-tests (Holm-Sidak correction); p-values: *
    Figure Legend Snippet: A subset of breast cancer single-cell clones resists complete EMT and maintains the ability to proliferate in different environments a , Bright field images of a representative E-SCC (E1) and a representative M-SCC (M2), untreated (-TAM), treated with Tamoxifen for 7 days (+TAM 7d), or treated with Tamoxifen for 14 days (+TAM 14d). Scale bar: 100 µm. b , Immunofluorescence staining of DAPI (blue), E-cadherin (CDH1, green), and Vimentin (VIM, red) of a representative E-SCC (E1) and a representative M-SCC (M2), untreated (-TAM), treated with Tamoxifen for 15 days (+TAM), or treated with Tamoxifen for 15 days followed by Tamoxifen withdrawal for 9 days (+/-TAM). Scale bar: 20 µm. c , Flow cytometric staining of EPCAM of a representative E-SCC (E1) and a representative M-SCC (M2), untreated (-TAM) or treated with Tamoxifen for 14 days (+TAM 14d). Gates for EPCAM were set according to a control as indicated by control cells only stained for 7AAD (7AAD ctrl). d , log relative mRNA expression levels of EPCAM, CDH1, VIM , and FN1 in E-SCCs (E1-E3) and M-SCCs (M1-M3), treated as described in a. n=3; mean ± SEM; multiple t-tests (Holm-Sidak correction); p-values: *

    Techniques Used: Clone Assay, Immunofluorescence, Staining, Expressing

    A subset of breast cancer single-cell clones resists complete EMT and maintains the ability to proliferate in different environments a , Table showing number of epithelial (E-SCCs) and mesenchymal (M-SCCs) single-cell clones isolated from the HMLE-Twist1-ER bulk population and determined during Tamoxifen treatment. b , Immunofluorescence staining of DAPI (blue) and Twist1 (red) of E-SCCs (E1-E3) and M-SCCs (M1-M3), untreated (-TAM) or treated with Tamoxifen for 3 days (+TAM 3d), Scale bar: 20 µm. c , Immunoblot of Twist1 and β-actin (ACTB) of untreated E-SCCs and M-SCCs. Twist1 protein levels were quantified relatively to β-actin. d , log relative mRNA expression levels of Twist1 and WNT5A in E-SCCs (E1-E3) and M-SCCs (M1-M3), untreated (-TAM), treated with Tamoxifen for 7 days (+TAM 7d), or treated with Tamoxifen for 14 days (+TAM 14d). n=3; mean ± SEM. e , Bright field images of a representative E-SCC (E1) and a representative M-SCC (M2), treated with Tamoxifen for 14 days followed by Tamoxifen withdrawal for 7 days (+14d/-7d), 14 days (+14d/-14d), or 21 days (+14d/-21d). Scale bar: 100 µm. f , log relative mRNA expression levels of CDH1, VIM, FN1, OVOL2 , and ZEB1 in E-SCCs (E1-E3) and M-SCCs (M1-M3), treated as described in e. n=3; mean ± SEM; multiple t-tests (Holm-Sidak correction); p-values: *
    Figure Legend Snippet: A subset of breast cancer single-cell clones resists complete EMT and maintains the ability to proliferate in different environments a , Table showing number of epithelial (E-SCCs) and mesenchymal (M-SCCs) single-cell clones isolated from the HMLE-Twist1-ER bulk population and determined during Tamoxifen treatment. b , Immunofluorescence staining of DAPI (blue) and Twist1 (red) of E-SCCs (E1-E3) and M-SCCs (M1-M3), untreated (-TAM) or treated with Tamoxifen for 3 days (+TAM 3d), Scale bar: 20 µm. c , Immunoblot of Twist1 and β-actin (ACTB) of untreated E-SCCs and M-SCCs. Twist1 protein levels were quantified relatively to β-actin. d , log relative mRNA expression levels of Twist1 and WNT5A in E-SCCs (E1-E3) and M-SCCs (M1-M3), untreated (-TAM), treated with Tamoxifen for 7 days (+TAM 7d), or treated with Tamoxifen for 14 days (+TAM 14d). n=3; mean ± SEM. e , Bright field images of a representative E-SCC (E1) and a representative M-SCC (M2), treated with Tamoxifen for 14 days followed by Tamoxifen withdrawal for 7 days (+14d/-7d), 14 days (+14d/-14d), or 21 days (+14d/-21d). Scale bar: 100 µm. f , log relative mRNA expression levels of CDH1, VIM, FN1, OVOL2 , and ZEB1 in E-SCCs (E1-E3) and M-SCCs (M1-M3), treated as described in e. n=3; mean ± SEM; multiple t-tests (Holm-Sidak correction); p-values: *

    Techniques Used: Clone Assay, Isolation, Immunofluorescence, Staining, Expressing

    EMT-induction causes genome-wide chromatin and transcriptional changes a , Principal component (PC) analysis of ATAC-sequencing data of E-SCCs (△) and M-SCCs ( ◯ ), untreated (-TAM), treated with Tamoxifen for 7 days (+TAM 7d), treated with Tamoxifen for 14 days (+TAM 14d), or treated with Tamoxifen for 14 days followed by Tamoxifen withdrawal for 7 days (+TAM 14d/-TAM 7d). Each data point represents one SCC at the indicated time point. b , Genome browser high resolution screenshot of ATAC-sequencing data of EPCAM and CDH1 of one representative E-SCC (E) and one representative M-SCC (M), untreated (-TAM), treated with Tamoxifen for 7 days (+7d), or treated with Tamoxifen for 14 days (+14d). c , Heatmap of chromatin accessibility of 12 clusters of ATAC-sequencing peaks of E-SCCs and M-SCCs treated as described in b. d , Top 5 hits of Homer de novo transcription factor motif analysis of grouped clusters closing exclusively in M-SCCs (M) during Tamoxifen treatment (+TAM).
    Figure Legend Snippet: EMT-induction causes genome-wide chromatin and transcriptional changes a , Principal component (PC) analysis of ATAC-sequencing data of E-SCCs (△) and M-SCCs ( ◯ ), untreated (-TAM), treated with Tamoxifen for 7 days (+TAM 7d), treated with Tamoxifen for 14 days (+TAM 14d), or treated with Tamoxifen for 14 days followed by Tamoxifen withdrawal for 7 days (+TAM 14d/-TAM 7d). Each data point represents one SCC at the indicated time point. b , Genome browser high resolution screenshot of ATAC-sequencing data of EPCAM and CDH1 of one representative E-SCC (E) and one representative M-SCC (M), untreated (-TAM), treated with Tamoxifen for 7 days (+7d), or treated with Tamoxifen for 14 days (+14d). c , Heatmap of chromatin accessibility of 12 clusters of ATAC-sequencing peaks of E-SCCs and M-SCCs treated as described in b. d , Top 5 hits of Homer de novo transcription factor motif analysis of grouped clusters closing exclusively in M-SCCs (M) during Tamoxifen treatment (+TAM).

    Techniques Used: Genome Wide, Sequencing

    A subset of HMLE-Twist1-ER cells maintains EPCAM expression during EMT-induction a , FACS plot of EPCAM of HMLE-Twist1-ER bulk cells untreated (-TAM) or treated with Tamoxifen for 21 days (+TAM 21d). The gates used for cell sorting are highlighted. b , Flow cytometric staining of EPCAM of sorted EPCAM neg and EPCAM pos cells after 10 days of Tamoxifen withdrawal (+TAM21d/-TAM10d). Gates for EPCAM were set according to unstained control as indicated by cells only stained for 7AAD (7AAD ctrl). c , log relative mRNA expression levels of EPCAM, CDH1, OVOL2 , and ZEB1 of sorted EPCAM neg (neg) and EPCAM pos (pos) HMLE-Twist1-ER cells treated as described in b. n=2; mean ± SEM; multiple t-tests (Holm-Sidak correction); p-values: *
    Figure Legend Snippet: A subset of HMLE-Twist1-ER cells maintains EPCAM expression during EMT-induction a , FACS plot of EPCAM of HMLE-Twist1-ER bulk cells untreated (-TAM) or treated with Tamoxifen for 21 days (+TAM 21d). The gates used for cell sorting are highlighted. b , Flow cytometric staining of EPCAM of sorted EPCAM neg and EPCAM pos cells after 10 days of Tamoxifen withdrawal (+TAM21d/-TAM10d). Gates for EPCAM were set according to unstained control as indicated by cells only stained for 7AAD (7AAD ctrl). c , log relative mRNA expression levels of EPCAM, CDH1, OVOL2 , and ZEB1 of sorted EPCAM neg (neg) and EPCAM pos (pos) HMLE-Twist1-ER cells treated as described in b. n=2; mean ± SEM; multiple t-tests (Holm-Sidak correction); p-values: *

    Techniques Used: Expressing, FACS, Staining

    9) Product Images from "LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space"

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space

    Journal: bioRxiv

    doi: 10.1101/2020.04.06.025635

    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Figure Legend Snippet: Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Techniques Used: Sequencing, Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Standard Deviation

    10) Product Images from "LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space"

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space

    Journal: bioRxiv

    doi: 10.1101/2020.04.06.025635

    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Figure Legend Snippet: Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Techniques Used: Sequencing, Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Standard Deviation

    11) Product Images from "LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space"

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space

    Journal: bioRxiv

    doi: 10.1101/2020.04.06.025635

    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Figure Legend Snippet: Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Techniques Used: Sequencing, Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Standard Deviation

    Modeling of compressed barcoding parameters and per-sample cost of LAMP-Seq. (A-C) Simulation of False Positive Probability and False Negative Probability depending on m2 = the number of sub-pools (A), m = the complexity of the barcode library (B), and k = the number of barcodes per sample (C) when utilizing a compressed barcode space accounting for barcode loss. Dashed grey lines indicate a probability threshold of 0.2%. (D) Cost estimation per sample using LAMP-Seq.
    Figure Legend Snippet: Modeling of compressed barcoding parameters and per-sample cost of LAMP-Seq. (A-C) Simulation of False Positive Probability and False Negative Probability depending on m2 = the number of sub-pools (A), m = the complexity of the barcode library (B), and k = the number of barcodes per sample (C) when utilizing a compressed barcode space accounting for barcode loss. Dashed grey lines indicate a probability threshold of 0.2%. (D) Cost estimation per sample using LAMP-Seq.

    Techniques Used:

    12) Product Images from "p97-dependent retrotranslocation and proteolytic processing govern formation of active Nrf1 upon proteasome inhibition"

    Article Title: p97-dependent retrotranslocation and proteolytic processing govern formation of active Nrf1 upon proteasome inhibition

    Journal: eLife

    doi: 10.7554/eLife.01856

    Different forms of Nrf1. HEK-293 cells stably expressing wild-type Nrf1 3×Flag were treated with MG132 and/or cotransin, an inhibitor of protein insertion into the Sec61 translocation channel ( Garrison et al., 2005 ) as indicated (lanes 1 to 4) and total cell lysates were prepared. Lanes 5 and 6 contain full-length Nrf1 3×Flag and Nrf1(104-742) 3×Flag that were translated in vitro (IVT) in rabbit reticulocyte lysate in the absence of membranes. The HEK293 cell lysates and IVT reactions were examined by SDS-PAGE followed by immunoblotting with anti-Flag antibody. Different Nrf1 species are shown (ungly–unglycosylated; unmod–unmodified). Nrf1 p120 (species ‘a’) was converted to species ‘c’, which comigrated with the primary translation product (species ‘d’) upon expression in cells treated with cotransin, suggesting that the slow mobility of p120 arose from modifications (e.g., N-linked glycosylation) that occurred within the endoplasmic reticulum. Retrotranslocation and processing of p120 (species ‘a’) yielded p110 (species ‘b’). Species ‘b’ was not sensitive to endoglycosidase H ( Figure 4E ), suggesting that it was deglycosylated upon retrotranslocation into the cytosol. Nevertheless, species ‘b’ migrated considerably more slowly than the primary translation product for Nrf1(104-742) 3×Flag (species ‘e’), indicating that p110 must carry additional modifications that remain uncharacterized. Please note that deglycosylation by cytosolic enzymes converts the Asn at the site of glycosylation to Asp, which could influence migration on SDS-PAGE. DOI: http://dx.doi.org/10.7554/eLife.01856.007
    Figure Legend Snippet: Different forms of Nrf1. HEK-293 cells stably expressing wild-type Nrf1 3×Flag were treated with MG132 and/or cotransin, an inhibitor of protein insertion into the Sec61 translocation channel ( Garrison et al., 2005 ) as indicated (lanes 1 to 4) and total cell lysates were prepared. Lanes 5 and 6 contain full-length Nrf1 3×Flag and Nrf1(104-742) 3×Flag that were translated in vitro (IVT) in rabbit reticulocyte lysate in the absence of membranes. The HEK293 cell lysates and IVT reactions were examined by SDS-PAGE followed by immunoblotting with anti-Flag antibody. Different Nrf1 species are shown (ungly–unglycosylated; unmod–unmodified). Nrf1 p120 (species ‘a’) was converted to species ‘c’, which comigrated with the primary translation product (species ‘d’) upon expression in cells treated with cotransin, suggesting that the slow mobility of p120 arose from modifications (e.g., N-linked glycosylation) that occurred within the endoplasmic reticulum. Retrotranslocation and processing of p120 (species ‘a’) yielded p110 (species ‘b’). Species ‘b’ was not sensitive to endoglycosidase H ( Figure 4E ), suggesting that it was deglycosylated upon retrotranslocation into the cytosol. Nevertheless, species ‘b’ migrated considerably more slowly than the primary translation product for Nrf1(104-742) 3×Flag (species ‘e’), indicating that p110 must carry additional modifications that remain uncharacterized. Please note that deglycosylation by cytosolic enzymes converts the Asn at the site of glycosylation to Asp, which could influence migration on SDS-PAGE. DOI: http://dx.doi.org/10.7554/eLife.01856.007

    Techniques Used: Stable Transfection, Expressing, Translocation Assay, In Vitro, SDS Page, Migration

    13) Product Images from "The SERRATE protein is involved in alternative splicing in Arabidopsis thaliana"

    Article Title: The SERRATE protein is involved in alternative splicing in Arabidopsis thaliana

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt894

    The interaction between FL AtSE or its core fragment (residues 194–543; AtSE core), and AtCBP20 and/or AtCBP80. AtSE FL, AtSE core and GFP proteins were overexpressed in bacteria in fusion with MBP; AtCBP20, AtCBP80 and TPRSGT1 (used as a negative control) were synthesized in the presence of [ 35 S]-methionine (an asterisk in the protein name abbreviation means that the protein was labeled). The complexes were selected on amylose beads, separated on 14% SDS-PAGE and detected by exposure to an image analyzer. Inputs represent one-twentieth of the samples used in the experiment.
    Figure Legend Snippet: The interaction between FL AtSE or its core fragment (residues 194–543; AtSE core), and AtCBP20 and/or AtCBP80. AtSE FL, AtSE core and GFP proteins were overexpressed in bacteria in fusion with MBP; AtCBP20, AtCBP80 and TPRSGT1 (used as a negative control) were synthesized in the presence of [ 35 S]-methionine (an asterisk in the protein name abbreviation means that the protein was labeled). The complexes were selected on amylose beads, separated on 14% SDS-PAGE and detected by exposure to an image analyzer. Inputs represent one-twentieth of the samples used in the experiment.

    Techniques Used: Negative Control, Synthesized, Labeling, SDS Page

    14) Product Images from "Simultaneous characterization of cellular RNA structure and function with in-cell SHAPE-Seq"

    Article Title: Simultaneous characterization of cellular RNA structure and function with in-cell SHAPE-Seq

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkv879

    In-cell structure–function characterization of the RNA-IN/OUT translational repressor system. Color-coded reactivity spectra of RNA-IN S4 (A), RNA-OUT A4 (B) and RNA-IN S4 C24A A25C with RNA-OUT A4 or the antisense control plasmid (C) represent averages over three independent in-cell SHAPE-Seq experiments. Error bars represent one standard deviation. All secondary structures are color-coded by reactivity intensity. ( A ) Reactivity spectrum of the first 60 nts of RNA-IN S4 (top), with nucleotides color-coded by reactivity on a single-stranded structural model of this region (bottom). RBS and start codon (AUG) are boxed. ( B ) Reactivity spectrum of RNA-OUT A4 (top), with a minimum free energy structure generated by RNAStructure ( 35 ) using in-cell SHAPE-Seq reactivity data as constraints (bottom; see Materials and Methods). The terminators following RNA-OUT A4 were not included in structural analysis. ( C ) Reactivity maps of RNA-IN S4 C24A A25C expressed with RNA-OUT A4 or an antisense control plasmid are on the left. Average fluorescence (FL/OD) values (normalized to the S4 C24A A25C with antisense control plasmid FL/OD value) on the right show 69% repression of gene expression when RNA-OUT A4 is expressed, with error bars representing one standard deviation. The RBS and start codon (AUG) locations are boxed. CDS = coding sequence.
    Figure Legend Snippet: In-cell structure–function characterization of the RNA-IN/OUT translational repressor system. Color-coded reactivity spectra of RNA-IN S4 (A), RNA-OUT A4 (B) and RNA-IN S4 C24A A25C with RNA-OUT A4 or the antisense control plasmid (C) represent averages over three independent in-cell SHAPE-Seq experiments. Error bars represent one standard deviation. All secondary structures are color-coded by reactivity intensity. ( A ) Reactivity spectrum of the first 60 nts of RNA-IN S4 (top), with nucleotides color-coded by reactivity on a single-stranded structural model of this region (bottom). RBS and start codon (AUG) are boxed. ( B ) Reactivity spectrum of RNA-OUT A4 (top), with a minimum free energy structure generated by RNAStructure ( 35 ) using in-cell SHAPE-Seq reactivity data as constraints (bottom; see Materials and Methods). The terminators following RNA-OUT A4 were not included in structural analysis. ( C ) Reactivity maps of RNA-IN S4 C24A A25C expressed with RNA-OUT A4 or an antisense control plasmid are on the left. Average fluorescence (FL/OD) values (normalized to the S4 C24A A25C with antisense control plasmid FL/OD value) on the right show 69% repression of gene expression when RNA-OUT A4 is expressed, with error bars representing one standard deviation. The RBS and start codon (AUG) locations are boxed. CDS = coding sequence.

    Techniques Used: Plasmid Preparation, Standard Deviation, Generated, Fluorescence, Expressing, Sequencing

    15) Product Images from "MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5"

    Article Title: MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.201501002

    TFEB translocates to the nucleus during mitophagy in a Parkin- and PINK1-dependent manner. (A) YFP-Parkin HeLa cells were treated with O/A for up to 10 h, fractionated, and immunoblotted. (B) Quantification of data in A. Endogenous TFEB expression was normalized to GAPDH (cytosol) or histone H3 (nuclear) and nuclear TFEB expressed as a percentage of total TFEB. Data are means ± SD ( n = 3). (C) mCherry-Parkin HeLa cells were left untreated (Control), starved (2 h), or treated with torin 1 (2 h), O/A (6 h), or valinomycin (Val; 6 h). CIP treatment of cell lysates was performed before immunoblotting. (D) WT and mCherry-Parkin HeLa cells were treated with DMSO or O/A (6 h), lysed, and immunoblotted. A CIP-treated control was included as a reference for total TFEB dephosphorylation. (E) WT and mCherry-Parkin HeLa cells were treated with DMSO, torin 1, or O/A for 18 h and analyzed by quantitative PCR for TFEB target gene expression. Data are means ± SD ( n = 3). (F) WT and PINK1 KO HeLa cells stably expressing TFEB-GFP with or without mCherry-Parkin were treated as in C. Fixed cells were stained with DAPI and analyzed by immunofluorescence. Bars, 10 µm. See Fig. S1 F for quantification. *, P
    Figure Legend Snippet: TFEB translocates to the nucleus during mitophagy in a Parkin- and PINK1-dependent manner. (A) YFP-Parkin HeLa cells were treated with O/A for up to 10 h, fractionated, and immunoblotted. (B) Quantification of data in A. Endogenous TFEB expression was normalized to GAPDH (cytosol) or histone H3 (nuclear) and nuclear TFEB expressed as a percentage of total TFEB. Data are means ± SD ( n = 3). (C) mCherry-Parkin HeLa cells were left untreated (Control), starved (2 h), or treated with torin 1 (2 h), O/A (6 h), or valinomycin (Val; 6 h). CIP treatment of cell lysates was performed before immunoblotting. (D) WT and mCherry-Parkin HeLa cells were treated with DMSO or O/A (6 h), lysed, and immunoblotted. A CIP-treated control was included as a reference for total TFEB dephosphorylation. (E) WT and mCherry-Parkin HeLa cells were treated with DMSO, torin 1, or O/A for 18 h and analyzed by quantitative PCR for TFEB target gene expression. Data are means ± SD ( n = 3). (F) WT and PINK1 KO HeLa cells stably expressing TFEB-GFP with or without mCherry-Parkin were treated as in C. Fixed cells were stained with DAPI and analyzed by immunofluorescence. Bars, 10 µm. See Fig. S1 F for quantification. *, P

    Techniques Used: Expressing, De-Phosphorylation Assay, Real-time Polymerase Chain Reaction, Stable Transfection, Staining, Immunofluorescence

    16) Product Images from "Structural basis of pyrimidine-pyrimidone (6–4) photoproduct recognition by UV-DDB in the nucleosome"

    Article Title: Structural basis of pyrimidine-pyrimidone (6–4) photoproduct recognition by UV-DDB in the nucleosome

    Journal: Scientific Reports

    doi: 10.1038/srep16330

    Nucleosomal 6–4PP DNA binding of UV-DDB. ( a ) Schematic representations of reconstituted nucleosomes containing 6–4PP(inside) and 6–4PP(outside). The affected T-T bases are indicated in red. ( b ) Gel electrophoretic mobility shift assay for nucleosome binding by UV-DDB. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), 6–4PP(inside) (lanes 7–12), or 6–4PP(outside) (lanes 13–18) were incubated with UV-DDB. The UV-DDB concentrations are 0 nM (lanes 1, 7, and 13), 2.5 nM (lanes 2, 8, and 14), 5 nM (lanes 3, 9, and 15), 10 nM (lanes 4, 10, and 16), 20 nM (lanes 5, 11, and 17), and 40 nM (lanes 6, 12, and 18). ( c ) Graphic representation of the experiments shown in panel ( b ). Standard deviation values are shown (n = 3).
    Figure Legend Snippet: Nucleosomal 6–4PP DNA binding of UV-DDB. ( a ) Schematic representations of reconstituted nucleosomes containing 6–4PP(inside) and 6–4PP(outside). The affected T-T bases are indicated in red. ( b ) Gel electrophoretic mobility shift assay for nucleosome binding by UV-DDB. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), 6–4PP(inside) (lanes 7–12), or 6–4PP(outside) (lanes 13–18) were incubated with UV-DDB. The UV-DDB concentrations are 0 nM (lanes 1, 7, and 13), 2.5 nM (lanes 2, 8, and 14), 5 nM (lanes 3, 9, and 15), 10 nM (lanes 4, 10, and 16), 20 nM (lanes 5, 11, and 17), and 40 nM (lanes 6, 12, and 18). ( c ) Graphic representation of the experiments shown in panel ( b ). Standard deviation values are shown (n = 3).

    Techniques Used: Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Standard Deviation

    Nucleosomal apyrimidinic DNA binding of UV-DDB. ( a ) Schematic representations of reconstituted nucleosomes containing undamaged DNA, AP(inside), and AP(outside). ( b ) Gel electrophoretic mobility shift assay for nucleosome binding of UV-DDB. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), AP(inside) (lanes 7–12), or AP(outside) (lanes 13–18) were incubated with UV-DDB. The UV-DDB concentrations are 0 nM (lanes 1, 7, and 13), 2.5 nM (lanes 2, 8, and 14), 5 nM (lanes 3, 9, and 15), 10 nM (lanes 4, 10, and 16), 20 nM (lanes 5, 11, and 17), and 40 nM (lanes 6, 12, and 18). ( c ) Graphic representation of the experiments shown in panel ( b ). Standard deviation values are shown (n = 3). ( d ) Graphic representation of naked DNA binding of UV-DDB. Standard deviation values are shown (n = 3).
    Figure Legend Snippet: Nucleosomal apyrimidinic DNA binding of UV-DDB. ( a ) Schematic representations of reconstituted nucleosomes containing undamaged DNA, AP(inside), and AP(outside). ( b ) Gel electrophoretic mobility shift assay for nucleosome binding of UV-DDB. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), AP(inside) (lanes 7–12), or AP(outside) (lanes 13–18) were incubated with UV-DDB. The UV-DDB concentrations are 0 nM (lanes 1, 7, and 13), 2.5 nM (lanes 2, 8, and 14), 5 nM (lanes 3, 9, and 15), 10 nM (lanes 4, 10, and 16), 20 nM (lanes 5, 11, and 17), and 40 nM (lanes 6, 12, and 18). ( c ) Graphic representation of the experiments shown in panel ( b ). Standard deviation values are shown (n = 3). ( d ) Graphic representation of naked DNA binding of UV-DDB. Standard deviation values are shown (n = 3).

    Techniques Used: Binding Assay, Electrophoretic Mobility Shift Assay, Incubation, Standard Deviation

    UV-DDB binds to the nucleosomal apyrimidinic DNA with a different translational position. ( a ) Schematic representations of reconstituted nucleosomes containing single AP(outside) and single AP(outside+21). The original AP(outside) position and the AP(outside+21) position are represented by red and blue stars, respectively. The arrow indicates the nucleosomal dyad. ( b ) Gel electrophoretic mobility shift assay for UV-DDB binding to single AP nucleosomes. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), AP(outside) (lanes 7–12), single AP(outside) (lanes 13–18), and AP(outside+21) (lanes 19—24) were incubated with UV-DDB. The UV-DDB concentrations are 0 nM (lanes 1, 7, and 13), 2.5 nM (lanes 2, 8, and 14), 5 nM (lanes 3, 9, and 15), 10 nM (lanes 4, 10, and 16), 20 nM (lanes 5, 11, and 17), and 40 nM (lanes 6, 12, and 18). ( c ) Time course experiments. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), single AP(outside) (lanes 7–12), and single AP(outside+21) (lanes 13–18) were incubated with UV-DDB (10 nM) for 1 min (lanes 2, 8, and 14), 3 min (lanes 3, 9, and 15), 5 min (lanes 4, 10, and 16), 10 min (lanes 5, 11, and 17), and 30 min (lanes 6, 12, and 18). Lanes 1, 7, and 13 are the experiments without UV-DDB. ( d ) Graphic representation of the time course experiments shown in panel ( c ). Standard deviation values are shown (n = 3).
    Figure Legend Snippet: UV-DDB binds to the nucleosomal apyrimidinic DNA with a different translational position. ( a ) Schematic representations of reconstituted nucleosomes containing single AP(outside) and single AP(outside+21). The original AP(outside) position and the AP(outside+21) position are represented by red and blue stars, respectively. The arrow indicates the nucleosomal dyad. ( b ) Gel electrophoretic mobility shift assay for UV-DDB binding to single AP nucleosomes. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), AP(outside) (lanes 7–12), single AP(outside) (lanes 13–18), and AP(outside+21) (lanes 19—24) were incubated with UV-DDB. The UV-DDB concentrations are 0 nM (lanes 1, 7, and 13), 2.5 nM (lanes 2, 8, and 14), 5 nM (lanes 3, 9, and 15), 10 nM (lanes 4, 10, and 16), 20 nM (lanes 5, 11, and 17), and 40 nM (lanes 6, 12, and 18). ( c ) Time course experiments. Nucleosome core particles (NCP; 5 nM) containing undamaged DNA (lanes 1–6), single AP(outside) (lanes 7–12), and single AP(outside+21) (lanes 13–18) were incubated with UV-DDB (10 nM) for 1 min (lanes 2, 8, and 14), 3 min (lanes 3, 9, and 15), 5 min (lanes 4, 10, and 16), 10 min (lanes 5, 11, and 17), and 30 min (lanes 6, 12, and 18). Lanes 1, 7, and 13 are the experiments without UV-DDB. ( d ) Graphic representation of the time course experiments shown in panel ( c ). Standard deviation values are shown (n = 3).

    Techniques Used: Electrophoretic Mobility Shift Assay, Binding Assay, Incubation, Standard Deviation

    17) Product Images from "A FRET biosensor reveals spatiotemporal activation and functions of aurora kinase A in living cells"

    Article Title: A FRET biosensor reveals spatiotemporal activation and functions of aurora kinase A in living cells

    Journal: Nature Communications

    doi: 10.1038/ncomms12674

    The AURKA biosensor displays intramolecular FRET in vitro . ( a ) Representative fluorescence (GFP channel) and lifetime images taken at selected time points, and corresponding quantification of the in vitro FLIM analysis of the lifetime of EGFP from GFP-AURKA, GFP-AURKA-mCherry or GFP-AURKA and AURKA-mCherry samples incubated at 30 °C with λPP for 1 h, and then treated with ATP for 1 h. Images were acquired every 5 min. Data represent means±s.e.m. of three independent experiments. *** P
    Figure Legend Snippet: The AURKA biosensor displays intramolecular FRET in vitro . ( a ) Representative fluorescence (GFP channel) and lifetime images taken at selected time points, and corresponding quantification of the in vitro FLIM analysis of the lifetime of EGFP from GFP-AURKA, GFP-AURKA-mCherry or GFP-AURKA and AURKA-mCherry samples incubated at 30 °C with λPP for 1 h, and then treated with ATP for 1 h. Images were acquired every 5 min. Data represent means±s.e.m. of three independent experiments. *** P

    Techniques Used: In Vitro, Fluorescence, Incubation

    The AURKA biosensor detects the autophosphorylation of AURKA on Thr288 in vitro . ( a ) Model illustrating the mode of action of the AURKA biosensor. The complete sequence of AURKA is located between the donor (D, EGFP) and the acceptor (A, mCherry) fluorophores. When AURKA is autophosphorylated on Thr288, the kinase undergoes a conformational change bringing the donor and the acceptor in proximity and allowing FRET detection. Of note, the real three-dimensional orientations of the two fluorescent proteins are not known. ( b ) (Left panels) Representative fluorescence (GFP channel) and lifetime images from in vitro FLIM analysis of purified GFP-AURKA and GFP-AURKA-mCherry proteins. (Right panel) The graph illustrates a time-lapse analysis of the fluorescence lifetime of EGFP for both proteins. Images were acquired every 5 min. Data represent means±s.e.m. of three independent experiments. ( c ) (Left panels) Representative fluorescence (GFP channel) and lifetime images taken at selected time points, and (right panel) corresponding quantification of the in vitro FLIM analysis of GFP-AURKA and GFP-AURKA-mCherry following λPP and ATP treatments. All treatments were performed at 30 °C and images were acquired every 5 min. The addition of λPP and ATP is indicated by an arrow on the graph. Data represent means±s.e.m. of three independent experiments. The pseudocolour scale in b , c represents pixel-by-pixel lifetimes; conditions and/or time points are indicated in italics. Scale bar, 5 μm. *** P
    Figure Legend Snippet: The AURKA biosensor detects the autophosphorylation of AURKA on Thr288 in vitro . ( a ) Model illustrating the mode of action of the AURKA biosensor. The complete sequence of AURKA is located between the donor (D, EGFP) and the acceptor (A, mCherry) fluorophores. When AURKA is autophosphorylated on Thr288, the kinase undergoes a conformational change bringing the donor and the acceptor in proximity and allowing FRET detection. Of note, the real three-dimensional orientations of the two fluorescent proteins are not known. ( b ) (Left panels) Representative fluorescence (GFP channel) and lifetime images from in vitro FLIM analysis of purified GFP-AURKA and GFP-AURKA-mCherry proteins. (Right panel) The graph illustrates a time-lapse analysis of the fluorescence lifetime of EGFP for both proteins. Images were acquired every 5 min. Data represent means±s.e.m. of three independent experiments. ( c ) (Left panels) Representative fluorescence (GFP channel) and lifetime images taken at selected time points, and (right panel) corresponding quantification of the in vitro FLIM analysis of GFP-AURKA and GFP-AURKA-mCherry following λPP and ATP treatments. All treatments were performed at 30 °C and images were acquired every 5 min. The addition of λPP and ATP is indicated by an arrow on the graph. Data represent means±s.e.m. of three independent experiments. The pseudocolour scale in b , c represents pixel-by-pixel lifetimes; conditions and/or time points are indicated in italics. Scale bar, 5 μm. *** P

    Techniques Used: In Vitro, Sequencing, Fluorescence, Purification

    18) Product Images from "LASP1 is a novel BCR-ABL substrate and a phosphorylation-dependent binding partner of CRKL in chronic myeloid leukemia"

    Article Title: LASP1 is a novel BCR-ABL substrate and a phosphorylation-dependent binding partner of CRKL in chronic myeloid leukemia

    Journal: Oncotarget

    doi:

    CRKL binds to phosphorylated LASP1 (A) Western blot analysis (10% gel) of bound CRKL to LASP1 and phosphorylated pLASP1-Y171 (pLASP). Blotted LASP1 and pLASP1-Y171 were overlayed with GST (control), GST-CRKL, phosphorylated GST-pCRKL and mutated GST-CRKL-R39K. Binding was detected by GST Western blot. CRKL binds only to phosphorylated pLASP1-Y171. (B) Western blot control of GST-CRKL concentrations used for the overlay experiment in Figure 6A . (C) Western blot analysis (10% gel) of CRKL, pulled-down with GST-LASP1 and GST-pLASP1-Y171 from K562 homogenate. In the lower Coomassie-stained part, used GST-beads and K562 homogenate is shown. Phosphorylation of LASP1 at Tyr-171 results in a faint shift. (D) Western blot analysis (10% gel) of CRKL, immunoprecipitated with anti-CRKL antibody from leukemia cell lines as indicated, and LASP1/pLASP1-Y171, co-immunoprecipitated with CRKL.
    Figure Legend Snippet: CRKL binds to phosphorylated LASP1 (A) Western blot analysis (10% gel) of bound CRKL to LASP1 and phosphorylated pLASP1-Y171 (pLASP). Blotted LASP1 and pLASP1-Y171 were overlayed with GST (control), GST-CRKL, phosphorylated GST-pCRKL and mutated GST-CRKL-R39K. Binding was detected by GST Western blot. CRKL binds only to phosphorylated pLASP1-Y171. (B) Western blot control of GST-CRKL concentrations used for the overlay experiment in Figure 6A . (C) Western blot analysis (10% gel) of CRKL, pulled-down with GST-LASP1 and GST-pLASP1-Y171 from K562 homogenate. In the lower Coomassie-stained part, used GST-beads and K562 homogenate is shown. Phosphorylation of LASP1 at Tyr-171 results in a faint shift. (D) Western blot analysis (10% gel) of CRKL, immunoprecipitated with anti-CRKL antibody from leukemia cell lines as indicated, and LASP1/pLASP1-Y171, co-immunoprecipitated with CRKL.

    Techniques Used: Western Blot, Binding Assay, Staining, Immunoprecipitation

    LASP1 is phosphorylated in CML patients Western blot analysis (gradient gel) of LASP1, pLASP1-Y171 and p/CRKL in the leukemia cell line M07p210, in three healthy control donors and in five CML patients before and after TKI treatment. Loading M07p210: 10 μg; loading blood samples: 10 μg for LASP1 and β-actin, 100 μg for pLASP1-Y171, CRKL and BCR-ABL WB. Expression of ABL is not reliably detectable in CML patients. LASP1 is phosphorylated only in CML patients and in the M07p210 cell line but not in controls. In general, CRKL and pLASP1-Y171 phosphorylation decrease under TKI therapy. Patient 4 shows only minimal cytogenetic response to nilotinib treatment (Table 1 ).
    Figure Legend Snippet: LASP1 is phosphorylated in CML patients Western blot analysis (gradient gel) of LASP1, pLASP1-Y171 and p/CRKL in the leukemia cell line M07p210, in three healthy control donors and in five CML patients before and after TKI treatment. Loading M07p210: 10 μg; loading blood samples: 10 μg for LASP1 and β-actin, 100 μg for pLASP1-Y171, CRKL and BCR-ABL WB. Expression of ABL is not reliably detectable in CML patients. LASP1 is phosphorylated only in CML patients and in the M07p210 cell line but not in controls. In general, CRKL and pLASP1-Y171 phosphorylation decrease under TKI therapy. Patient 4 shows only minimal cytogenetic response to nilotinib treatment (Table 1 ).

    Techniques Used: Western Blot, Expressing

    Phosphorylation of LASP1 and CRKL is inhibited by the tyrosine kinase inhibitor nilotinib Western blot analysis (gradient gel) of BCR-ABL, ABL, LASP1, pLASP1-Y171 and p/CRKL in the leukemia cell lines K562 and M07p210 after a time- and concentration-dependent treatment with the tyrosine kinase inhibitor nilotinib. CRKL: (37 kDa); pCRKL: phospho-CRKL (38 kDa). In the non-transformed cell line M07e, no BCR-ABL kinase is present; thus no CRKL and LASP1 phosphorylation is observed. β-actin served as loading control.
    Figure Legend Snippet: Phosphorylation of LASP1 and CRKL is inhibited by the tyrosine kinase inhibitor nilotinib Western blot analysis (gradient gel) of BCR-ABL, ABL, LASP1, pLASP1-Y171 and p/CRKL in the leukemia cell lines K562 and M07p210 after a time- and concentration-dependent treatment with the tyrosine kinase inhibitor nilotinib. CRKL: (37 kDa); pCRKL: phospho-CRKL (38 kDa). In the non-transformed cell line M07e, no BCR-ABL kinase is present; thus no CRKL and LASP1 phosphorylation is observed. β-actin served as loading control.

    Techniques Used: Western Blot, Concentration Assay, Transformation Assay

    LASP1 and CRKL are phosphorylated by BCR-ABL-kinase Western blot analysis (gradient gel) of BCR-ABL, ABL, LASP1, pLASP1-Y171 and p/CRKL in Ba/F3 leukemia cell lines. While CRKL and LASP1 phosphorylation is inhibited by nilotinib in the BCR-ABL expressing cell line Ba/F3p210, inhibition failed in the nilotinib resistant BCR-ABL mutant cell line Ba/F3p210T315I. CRKL: (37 kDa); pCRKL: phospho-CRKL (38 kDa). In the non-transformed cell line Ba/F3, no BCR-ABL kinase is present; thus no CRKL and LASP1 phosphorylation is observed. β-actin is shown for loading control.
    Figure Legend Snippet: LASP1 and CRKL are phosphorylated by BCR-ABL-kinase Western blot analysis (gradient gel) of BCR-ABL, ABL, LASP1, pLASP1-Y171 and p/CRKL in Ba/F3 leukemia cell lines. While CRKL and LASP1 phosphorylation is inhibited by nilotinib in the BCR-ABL expressing cell line Ba/F3p210, inhibition failed in the nilotinib resistant BCR-ABL mutant cell line Ba/F3p210T315I. CRKL: (37 kDa); pCRKL: phospho-CRKL (38 kDa). In the non-transformed cell line Ba/F3, no BCR-ABL kinase is present; thus no CRKL and LASP1 phosphorylation is observed. β-actin is shown for loading control.

    Techniques Used: Western Blot, Expressing, Inhibition, Mutagenesis, Transformation Assay

    LASP1 is overexpressed in CML and phosphorylated at Tyr-171 in leukemia cell lines (A) Microarray analysis of LASP1 (3927_at) in CML compared to normal tissues, normal bone marrow-derived cells, and myeloid and lymphoblastic leukemias (AML, acute myeloid leukemia; cALL, common acute lymphoblastic leukemia; CLL, chronic lymphocytic leukemia), Mann-Whitney test. (B) Western blot analysis (gradient gel) of phospho/dephospho CRKL (p/CRKL), LASP1 and pLASP1-Y171 in different cancer cell lines (breast cancer: BT-20, MCF-7; cervical cancer: HeLa; epidermoid cancer: A-431; monocytes-macrophages: U-937; acute myeloid leukemia: MOLM-13; acute promyelocytic leukemia: NB4; acute monocytic leukemia MV4-11, THP-1; erythroleukemia: HEL; megakaryoblastic leukemia: M07e; T-cell leukemia: Jurkat; B-cell lymphoma: DOHH-2; acute lymphoblastic leukemia: CCRF-CEM; chronic myeloid leukemia: K562, BV173). Cell lines harboring BCR-ABL are marked red. β-actin served as a loading control.
    Figure Legend Snippet: LASP1 is overexpressed in CML and phosphorylated at Tyr-171 in leukemia cell lines (A) Microarray analysis of LASP1 (3927_at) in CML compared to normal tissues, normal bone marrow-derived cells, and myeloid and lymphoblastic leukemias (AML, acute myeloid leukemia; cALL, common acute lymphoblastic leukemia; CLL, chronic lymphocytic leukemia), Mann-Whitney test. (B) Western blot analysis (gradient gel) of phospho/dephospho CRKL (p/CRKL), LASP1 and pLASP1-Y171 in different cancer cell lines (breast cancer: BT-20, MCF-7; cervical cancer: HeLa; epidermoid cancer: A-431; monocytes-macrophages: U-937; acute myeloid leukemia: MOLM-13; acute promyelocytic leukemia: NB4; acute monocytic leukemia MV4-11, THP-1; erythroleukemia: HEL; megakaryoblastic leukemia: M07e; T-cell leukemia: Jurkat; B-cell lymphoma: DOHH-2; acute lymphoblastic leukemia: CCRF-CEM; chronic myeloid leukemia: K562, BV173). Cell lines harboring BCR-ABL are marked red. β-actin served as a loading control.

    Techniques Used: Microarray, Derivative Assay, MANN-WHITNEY, Western Blot

    19) Product Images from "EVA-1 Functions as an UNC-40 Co-receptor to Enhance Attraction to the MADD-4 Guidance Cue in Caenorhabditis elegans"

    Article Title: EVA-1 Functions as an UNC-40 Co-receptor to Enhance Attraction to the MADD-4 Guidance Cue in Caenorhabditis elegans

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1004521

    EVA-1 functions cell-autonomously in muscles and interacts with MADD-4. A . Muscle-expressed EVA-1::CFP rescues the muscle extension defects of eva-1 mutants. B . A summary of EVA-1 domain function that is fully detailed in Figure S1 . C D . FLAG-tagged receptors were expressed from HEK293 cells, bathed in conditioned media from other HEK293 cells that express HA- and Gaussia luciferase-tagged MADD-4 or SLT-1 ligands, and immunoprecipitated to determine the relative amounts of ligand that co-immunoprecipitates with the receptor (see the materials and methods section for more details). C . The western blot on the left shows the five immunoprecipitated FLAG-tagged receptors. The western blot on the right shows the two HA- and Gaussia luciferase-tagged ligands that were collected from cell culture. D . The normalized relative levels of luciferase signal that immunoprecipitated with each potential ligand-receptor complex. E–I . Shown are animals harbouring one of three different transgenes that drive the expression of either neuronally-expressed MADD-4::YFP (from the trIs66 transgenic array) ( E ), muscle-expressed MADD-4::YFP (from the trIs78 transgenic array) ( F ), or muscle-expressed EVA-1::CFP (from the trIs89 transgenic array) ( G ), or animals harbouring two of the transgenes; trIs66 and trIs89 ( H ) and trIs78 and trIs89 ( I ). The relative levels of MADD-4::YFP expression from trIs66 and trIs78 is shown in Figure S2a . Images show either the CFP channel (top), YFP channel (middle) or a merged view (bottom). Arrows in ‘H’ indicate the localization of MADD-4::YFP to EVA-1::CFP expressing muscles; arrows in ‘I’ indicate the vesicularization of MADD-4::YFP and EVA-1::CFP in the muscle cells. J . The quantification of neuronally-secreted MADD-4::YFP localization to muscles over-expressing the indicated receptor. K . The quantification of CFP vesicles in animals that over-express the indicated CFP-tagged receptors (x-axis) in muscles in either the presence of MADD-4::YFP expressed from dorsal muscles (mMADD-4) or pan-neuronally (nMADD-4). The colocalization of MADD-4 and EVA-1 with the RAB-11 and RAB-5 endosomal markers are shown in Figure S2b and S2c . L M . MADD-4::YFP fails to induce obvious vesicularization of UNC-40::CFP in a wild type background (L), but YFP-CFP vesicles are obvious in animals that lack UNC-6 (M). In A, J, and K, statistical significance ( p
    Figure Legend Snippet: EVA-1 functions cell-autonomously in muscles and interacts with MADD-4. A . Muscle-expressed EVA-1::CFP rescues the muscle extension defects of eva-1 mutants. B . A summary of EVA-1 domain function that is fully detailed in Figure S1 . C D . FLAG-tagged receptors were expressed from HEK293 cells, bathed in conditioned media from other HEK293 cells that express HA- and Gaussia luciferase-tagged MADD-4 or SLT-1 ligands, and immunoprecipitated to determine the relative amounts of ligand that co-immunoprecipitates with the receptor (see the materials and methods section for more details). C . The western blot on the left shows the five immunoprecipitated FLAG-tagged receptors. The western blot on the right shows the two HA- and Gaussia luciferase-tagged ligands that were collected from cell culture. D . The normalized relative levels of luciferase signal that immunoprecipitated with each potential ligand-receptor complex. E–I . Shown are animals harbouring one of three different transgenes that drive the expression of either neuronally-expressed MADD-4::YFP (from the trIs66 transgenic array) ( E ), muscle-expressed MADD-4::YFP (from the trIs78 transgenic array) ( F ), or muscle-expressed EVA-1::CFP (from the trIs89 transgenic array) ( G ), or animals harbouring two of the transgenes; trIs66 and trIs89 ( H ) and trIs78 and trIs89 ( I ). The relative levels of MADD-4::YFP expression from trIs66 and trIs78 is shown in Figure S2a . Images show either the CFP channel (top), YFP channel (middle) or a merged view (bottom). Arrows in ‘H’ indicate the localization of MADD-4::YFP to EVA-1::CFP expressing muscles; arrows in ‘I’ indicate the vesicularization of MADD-4::YFP and EVA-1::CFP in the muscle cells. J . The quantification of neuronally-secreted MADD-4::YFP localization to muscles over-expressing the indicated receptor. K . The quantification of CFP vesicles in animals that over-express the indicated CFP-tagged receptors (x-axis) in muscles in either the presence of MADD-4::YFP expressed from dorsal muscles (mMADD-4) or pan-neuronally (nMADD-4). The colocalization of MADD-4 and EVA-1 with the RAB-11 and RAB-5 endosomal markers are shown in Figure S2b and S2c . L M . MADD-4::YFP fails to induce obvious vesicularization of UNC-40::CFP in a wild type background (L), but YFP-CFP vesicles are obvious in animals that lack UNC-6 (M). In A, J, and K, statistical significance ( p

    Techniques Used: Luciferase, Immunoprecipitation, Western Blot, Cell Culture, Expressing, Transgenic Assay

    20) Product Images from "Retroviral Integration Mutagenesis in Mice and Comparative Analysis in Human AML Identify Reduced PTP4A3 Expression as a Prognostic Indicator"

    Article Title: Retroviral Integration Mutagenesis in Mice and Comparative Analysis in Human AML Identify Reduced PTP4A3 Expression as a Prognostic Indicator

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0026537

    Identification of mVIS. Strategy outline for identification of regions flanking DNA methylated viral integration sites (mVIS) within murine leukemias. Genomic DNA was digested with DpnII (step 1), followed by methylated DNA immunoprecipitation (MeDIP, step 2). MeDIP enriched fragments were ligated (step 3) and amplified using primers within the LTR (step 4). These fragments were hybridized on a DNA promoter array (step 5). Hypergeometric Analysis of Tiling Arrays (HAT) was used to identify regions flanking mVIS (step 6).
    Figure Legend Snippet: Identification of mVIS. Strategy outline for identification of regions flanking DNA methylated viral integration sites (mVIS) within murine leukemias. Genomic DNA was digested with DpnII (step 1), followed by methylated DNA immunoprecipitation (MeDIP, step 2). MeDIP enriched fragments were ligated (step 3) and amplified using primers within the LTR (step 4). These fragments were hybridized on a DNA promoter array (step 5). Hypergeometric Analysis of Tiling Arrays (HAT) was used to identify regions flanking mVIS (step 6).

    Techniques Used: Methylation, Immunoprecipitation, Methylated DNA Immunoprecipitation, Amplification, HAT Assay

    21) Product Images from "Identification of Outer Membrane Vesicles Derived from Orientia tsutsugamushi"

    Article Title: Identification of Outer Membrane Vesicles Derived from Orientia tsutsugamushi

    Journal: Journal of Korean Medical Science

    doi: 10.3346/jkms.2015.30.7.866

    Western blot analysis of purified and enriched OMVs derived from O. tsutsugamushi . ( A ) Blots were revealed with FS15 monoclonal antibody against OMVs and had similar patterns with blots of bacterial lysates. ( B ) Immunoblot of OMVs with polyclonal antibody showed a prominent 56-kDa protein band. ( C ) OMVs immunoenriched with FS15 monoclonal antibody revealed major surface antigens. ECV304, lysates of host cells; OT, lysates of purified O. tsutsugamushi ; OMVs, outer membrane vesicles; FS15, mouse monoclonal antibody of O. tsutsugamushi ; poly Ab, human polyclonal antibody purified from scrub typhus patient`s serum; IP, immunoprecipitation; IB, Immuno blot.
    Figure Legend Snippet: Western blot analysis of purified and enriched OMVs derived from O. tsutsugamushi . ( A ) Blots were revealed with FS15 monoclonal antibody against OMVs and had similar patterns with blots of bacterial lysates. ( B ) Immunoblot of OMVs with polyclonal antibody showed a prominent 56-kDa protein band. ( C ) OMVs immunoenriched with FS15 monoclonal antibody revealed major surface antigens. ECV304, lysates of host cells; OT, lysates of purified O. tsutsugamushi ; OMVs, outer membrane vesicles; FS15, mouse monoclonal antibody of O. tsutsugamushi ; poly Ab, human polyclonal antibody purified from scrub typhus patient`s serum; IP, immunoprecipitation; IB, Immuno blot.

    Techniques Used: Western Blot, Purification, Derivative Assay, Immunoprecipitation

    Transmission electron micrographs of outer membrane vesicles of O. tsutsugamushi . ( A ) Blebs of vesicles (arrow) before they are liberated from O. tsutsugamushi (arrow). ( B ) Microvesicles are shown on the surface of purified O. tsutsugamushi . ( C ) Clusters of purified microvesicles are observed. They vary in size ranging from 50 to 150 nm and are made of monolayer membranes. Scale bars indicate 0.1 µm.
    Figure Legend Snippet: Transmission electron micrographs of outer membrane vesicles of O. tsutsugamushi . ( A ) Blebs of vesicles (arrow) before they are liberated from O. tsutsugamushi (arrow). ( B ) Microvesicles are shown on the surface of purified O. tsutsugamushi . ( C ) Clusters of purified microvesicles are observed. They vary in size ranging from 50 to 150 nm and are made of monolayer membranes. Scale bars indicate 0.1 µm.

    Techniques Used: Transmission Assay, Purification

    22) Product Images from "DIAGNOSING INFECTION LEVELS OF FOUR HUMAN MALARIA PARASITE SPECIES BY A POLYMERASE CHAIN REACTION/LIGASE DETECTION REACTION FLUORESCENT MICROSPHERE-BASED ASSAY"

    Article Title: DIAGNOSING INFECTION LEVELS OF FOUR HUMAN MALARIA PARASITE SPECIES BY A POLYMERASE CHAIN REACTION/LIGASE DETECTION REACTION FLUORESCENT MICROSPHERE-BASED ASSAY

    Journal: The American journal of tropical medicine and hygiene

    doi:

    Plasmodium species-specific post-PCR multiplex LDR
    Figure Legend Snippet: Plasmodium species-specific post-PCR multiplex LDR

    Techniques Used: Polymerase Chain Reaction, Multiplex Assay

    Post-polymerase chain reaction (PCR) ligase detection reaction-fluorescent microsphere assay (LDR-FMA) for diagnosis of human Plasmodium parasite species. A , Components of the Plasmodium species LDR-FMA. Species-specific TAG sequence-labeled primers (F
    Figure Legend Snippet: Post-polymerase chain reaction (PCR) ligase detection reaction-fluorescent microsphere assay (LDR-FMA) for diagnosis of human Plasmodium parasite species. A , Components of the Plasmodium species LDR-FMA. Species-specific TAG sequence-labeled primers (F

    Techniques Used: Polymerase Chain Reaction, Sequencing, Labeling

    23) Product Images from "A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm"

    Article Title: A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm

    Journal: Molecular Biology of the Cell

    doi:

    Mutations in the transmembrane region  increase the proportion of  Ctm PrP, and reveal that this  form is slightly larger than  Sec PrP. mRNA encoding  wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte  lysate supplemented with canine pancreatic microsomes. Aliquots of the  reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or  without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or  absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples  were then analyzed by SDS-PAGE and autoradiography. Note the presence  of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7,  corresponding to  Sec PrP (white arrowheads) and  Ctm PrP (shaded arrowheads). The protease-protected  forms of  Sec PrP and  Ctm PrP are indicated by the  white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular  size markers are given in kilodaltons.
    Figure Legend Snippet: Mutations in the transmembrane region increase the proportion of Ctm PrP, and reveal that this form is slightly larger than Sec PrP. mRNA encoding wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte lysate supplemented with canine pancreatic microsomes. Aliquots of the reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples were then analyzed by SDS-PAGE and autoradiography. Note the presence of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7, corresponding to Sec PrP (white arrowheads) and Ctm PrP (shaded arrowheads). The protease-protected forms of Sec PrP and Ctm PrP are indicated by the white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular size markers are given in kilodaltons.

    Techniques Used: Size-exclusion Chromatography, Incubation, SDS Page, Autoradiography

    24) Product Images from "SNaPshot Assay in Quantitative Detection of Allelic Nondisjunction in Down Syndrome"

    Article Title: SNaPshot Assay in Quantitative Detection of Allelic Nondisjunction in Down Syndrome

    Journal: Genetic Testing and Molecular Biomarkers

    doi: 10.1089/gtmb.2012.0083

    Multiplexed SNaPshot ™ assay-based genotyping of rs363484, rs36506, rs2834235, and rs7283354 markers. (A) The peak at 48 nt denotes the AA genotype for rs36484, which is nonpolymorphic. The peaks at 58, 64, and 78 nt denote the
    Figure Legend Snippet: Multiplexed SNaPshot ™ assay-based genotyping of rs363484, rs36506, rs2834235, and rs7283354 markers. (A) The peak at 48 nt denotes the AA genotype for rs36484, which is nonpolymorphic. The peaks at 58, 64, and 78 nt denote the

    Techniques Used:

    25) Product Images from "Immunolabeling of Gamma-glutamyl transferase 5 in Normal Human Tissues Reveals Expression and Localization Differs from Gamma-glutamyl transferase 1"

    Article Title: Immunolabeling of Gamma-glutamyl transferase 5 in Normal Human Tissues Reveals Expression and Localization Differs from Gamma-glutamyl transferase 1

    Journal: Histochemistry and cell biology

    doi: 10.1007/s00418-014-1295-x

    GGT5-Ab797 specifically recognizes the large subunit of human GGT5. Western immunoblot analysis (A) of purified hGGT1 expressed in yeast (Lane 1), hGGT1 deglycosylated with EndoH (Lane 2), whole cell lysate of NIH3T3 cells (Lane 3) or NIH3T3 cells expressing
    Figure Legend Snippet: GGT5-Ab797 specifically recognizes the large subunit of human GGT5. Western immunoblot analysis (A) of purified hGGT1 expressed in yeast (Lane 1), hGGT1 deglycosylated with EndoH (Lane 2), whole cell lysate of NIH3T3 cells (Lane 3) or NIH3T3 cells expressing

    Techniques Used: Western Blot, Purification, Expressing

    26) Product Images from "Pin1 is overexpressed in breast cancer and cooperates with Ras signaling in increasing the transcriptional activity of c-Jun towards cyclin D1"

    Article Title: Pin1 is overexpressed in breast cancer and cooperates with Ras signaling in increasing the transcriptional activity of c-Jun towards cyclin D1

    Journal: The EMBO Journal

    doi: 10.1093/emboj/20.13.3459

    Fig. 4. Pin1 binds to c-Jun phosphorylated on Ser 63/73 -Pro. ( A and B ) Modulation of c-Jun phosphorylation by Ras or JNK. HeLa cells were co-transfected with c-Jun or c-Jun S63/73A and Ha-Ras, DN-Ras, activated JNK or control vector. Cells were harvested and cellular proteins were subjected to immunoblotting analysis with antibodies against c-Jun (A) or phosphorylated Ser 63/73 -c-Jun (B). ( C and D ) Interaction between Pin1 and c-Jun phosphorylated on Ser 63/73 -Pro. The same cellular proteins as those described in (A) were incubated with GST–agarose beads that had been pre-incubated with either GST alone or GST–Pin1. Proteins associated with the beads were subjected to immunoblotting analysis with antibodies against c-Jun (C) or phosphorylated Ser 63/73 ). ( E and F ) No interaction between Pin1 and c-Jun S63/73A . The same cellular proteins as those described in the (A) were incubated with GST–agarose beads containing GST or GST–Pin1, and bound proteins were subjected to immunoblotting analysis with antibodies against c-Jun (E) or phosphorylated Ser 63/73 -c-Jun (F). ( G and H ) Co-immunoprecipitation of transfected (G) or endogenous (H) c-Jun with endogenous Pin1. HeLa cells were co-transfected with c-Jun and Ha-Ras or JNK. c-Jun was immunoprecipitated from transfected HeLa cells (G) or non-transfected breast cancer cell lines (H) with polyclonal c-Jun antibodies or non-related antibodies (Control), and then subjected to immunoblotting using monoclonal anti-c-Jun antibodies (upper panel) or anti-Pin1 antibodies (lower panel).
    Figure Legend Snippet: Fig. 4. Pin1 binds to c-Jun phosphorylated on Ser 63/73 -Pro. ( A and B ) Modulation of c-Jun phosphorylation by Ras or JNK. HeLa cells were co-transfected with c-Jun or c-Jun S63/73A and Ha-Ras, DN-Ras, activated JNK or control vector. Cells were harvested and cellular proteins were subjected to immunoblotting analysis with antibodies against c-Jun (A) or phosphorylated Ser 63/73 -c-Jun (B). ( C and D ) Interaction between Pin1 and c-Jun phosphorylated on Ser 63/73 -Pro. The same cellular proteins as those described in (A) were incubated with GST–agarose beads that had been pre-incubated with either GST alone or GST–Pin1. Proteins associated with the beads were subjected to immunoblotting analysis with antibodies against c-Jun (C) or phosphorylated Ser 63/73 ). ( E and F ) No interaction between Pin1 and c-Jun S63/73A . The same cellular proteins as those described in the (A) were incubated with GST–agarose beads containing GST or GST–Pin1, and bound proteins were subjected to immunoblotting analysis with antibodies against c-Jun (E) or phosphorylated Ser 63/73 -c-Jun (F). ( G and H ) Co-immunoprecipitation of transfected (G) or endogenous (H) c-Jun with endogenous Pin1. HeLa cells were co-transfected with c-Jun and Ha-Ras or JNK. c-Jun was immunoprecipitated from transfected HeLa cells (G) or non-transfected breast cancer cell lines (H) with polyclonal c-Jun antibodies or non-related antibodies (Control), and then subjected to immunoblotting using monoclonal anti-c-Jun antibodies (upper panel) or anti-Pin1 antibodies (lower panel).

    Techniques Used: Transfection, Plasmid Preparation, Incubation, Immunoprecipitation

    27) Product Images from "A Disease-causing Point Mutation in Human Mitochondrial tRNAMet Results in tRNA Misfolding Leading to Defects in Translational Initiation and Elongation *"

    Article Title: A Disease-causing Point Mutation in Human Mitochondrial tRNAMet Results in tRNA Misfolding Leading to Defects in Translational Initiation and Elongation *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M806992200

    Effect of Mg 2 + on the thermal stabilities of the normal and 8U → C mutated hmtRNA Met D-half-molecules and the normal T-half-molecule. Normal U8 ( A ), 8U→C ( U8C ) mutated D-half-molecules ( B ), and normal T-half-molecule ( C ) were subjected
    Figure Legend Snippet: Effect of Mg 2 + on the thermal stabilities of the normal and 8U → C mutated hmtRNA Met D-half-molecules and the normal T-half-molecule. Normal U8 ( A ), 8U→C ( U8C ) mutated D-half-molecules ( B ), and normal T-half-molecule ( C ) were subjected

    Techniques Used:

    Stability of the normal and 8U → C mutated hmtRNA Met in a mitochondrial extract. The percentage of trichloroacetic acid-precipitable counts for the normal U8 transcript ( diamonds ) and the 8U→C mutated ( squares ) hmtRNA Met remaining after
    Figure Legend Snippet: Stability of the normal and 8U → C mutated hmtRNA Met in a mitochondrial extract. The percentage of trichloroacetic acid-precipitable counts for the normal U8 transcript ( diamonds ) and the 8U→C mutated ( squares ) hmtRNA Met remaining after

    Techniques Used:

    28) Product Images from "Core-glycosylated Mucin-like Repeats from MUC1 Are an Apical Targeting Signal *"

    Article Title: Core-glycosylated Mucin-like Repeats from MUC1 Are an Apical Targeting Signal *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.289504

    Polarized delivery of MUC1 in MDCK cells is not Gal-3-dependent. A , pathways and enzymes involved in synthesis of O -linked glycans. Note that PNA recognizes non-sialyated core 1, whereas LEA recognizes poly- N -acetyllactosamine on core 2 (see boxed structures ). ST6GalNAc-1 ( ST6 ) competes with T-synthase and core 3 synthase ( C3GnT ) for the substrate GalNAcα-Ser/Thr. B , MDCK cells stably expressing MUC1 were treated with siRNA duplexes directed to firefly luciferase (control) or Gal-3 and plated on permeable supports. After 4 days in culture, the polarized delivery of MUC1 was assessed by metabolic labeling for 30 min with [ 35 S]Met/Cys. After varying chase times, apical and basolateral surfaces were treated with sulfo-NHS-SS-biotin. Biotinylated MUC1 was recovered with avidin-conjugated beads from the MUC1 immunoprecipitates and analyzed with a Bio-Rad imager after SDS-PAGE. MUC1 delivery to the apical or basolateral surface is presented as the fraction of the total immunoprecipitate found on the cell surface (one representative experiment is shown, n = 2). Immunoblots for Gal-3 and β-actin in cell extracts after treatment with control ( Con ), Gal-3 ( G-3 ), or no ( NA ) siRNAs indicate efficient depletion of Gal-3 in this experiment. C , polarized MDCK cells expressing MUC1–22TR, 22TR-Tac, 0TR-Tac, or Tac were metabolically labeled for 30 min with [ 35 S]Met/Cys and chased for 90 min before detergent extraction and immunoprecipitation. Immunoprecipitates were resuspended, and equal aliquots were incubated overnight with beads conjugated to WGA ( W ) or LEA ( L ) or reserved as total ( T ) before analysis after SDS-PAGE with a Bio-Rad Imager. Note that the order of total, WGA, and LEA varies between gel profiles. The numbers below the gel profiles indicate the percentage of total bound to each lectin (percentage bound = (amount of construct recovered from immobilized lectin/total construct added) × 100). Results from one representative experiment are shown ( n = 2).
    Figure Legend Snippet: Polarized delivery of MUC1 in MDCK cells is not Gal-3-dependent. A , pathways and enzymes involved in synthesis of O -linked glycans. Note that PNA recognizes non-sialyated core 1, whereas LEA recognizes poly- N -acetyllactosamine on core 2 (see boxed structures ). ST6GalNAc-1 ( ST6 ) competes with T-synthase and core 3 synthase ( C3GnT ) for the substrate GalNAcα-Ser/Thr. B , MDCK cells stably expressing MUC1 were treated with siRNA duplexes directed to firefly luciferase (control) or Gal-3 and plated on permeable supports. After 4 days in culture, the polarized delivery of MUC1 was assessed by metabolic labeling for 30 min with [ 35 S]Met/Cys. After varying chase times, apical and basolateral surfaces were treated with sulfo-NHS-SS-biotin. Biotinylated MUC1 was recovered with avidin-conjugated beads from the MUC1 immunoprecipitates and analyzed with a Bio-Rad imager after SDS-PAGE. MUC1 delivery to the apical or basolateral surface is presented as the fraction of the total immunoprecipitate found on the cell surface (one representative experiment is shown, n = 2). Immunoblots for Gal-3 and β-actin in cell extracts after treatment with control ( Con ), Gal-3 ( G-3 ), or no ( NA ) siRNAs indicate efficient depletion of Gal-3 in this experiment. C , polarized MDCK cells expressing MUC1–22TR, 22TR-Tac, 0TR-Tac, or Tac were metabolically labeled for 30 min with [ 35 S]Met/Cys and chased for 90 min before detergent extraction and immunoprecipitation. Immunoprecipitates were resuspended, and equal aliquots were incubated overnight with beads conjugated to WGA ( W ) or LEA ( L ) or reserved as total ( T ) before analysis after SDS-PAGE with a Bio-Rad Imager. Note that the order of total, WGA, and LEA varies between gel profiles. The numbers below the gel profiles indicate the percentage of total bound to each lectin (percentage bound = (amount of construct recovered from immobilized lectin/total construct added) × 100). Results from one representative experiment are shown ( n = 2).

    Techniques Used: Stable Transfection, Expressing, Luciferase, Labeling, Avidin-Biotin Assay, SDS Page, Western Blot, Metabolic Labelling, Immunoprecipitation, Incubation, Whole Genome Amplification, Construct

    Core 1 O -glycans are present on the imperfect repeats of 0TR-Tac. Polarized MDCK cells expressing MUC1–22TR, 22TR-Tac, 0TR-Tac, or Tac were metabolically labeled for 30 min with [ 35 S]Met/Cys and chased for 90 min before detergent extraction and immunoprecipitation. Immunoprecipitates were treated (+) or mock-treated (−) with neuraminidase ( N'ase ) prior to resuspension and incubation overnight with beads conjugated to PNA ( P ) or no beads as total ( T ; note different totals for with and without neuraminidase) and analysis after SDS-PAGE with a Bio-Rad imager. The numbers below the gel profiles indicate the percentage of the total bound to PNA (percentage bound = (amount of construct recovered from immobilized lectin/total construct added) × 100). Results from one representative experiment are shown ( n = 2).
    Figure Legend Snippet: Core 1 O -glycans are present on the imperfect repeats of 0TR-Tac. Polarized MDCK cells expressing MUC1–22TR, 22TR-Tac, 0TR-Tac, or Tac were metabolically labeled for 30 min with [ 35 S]Met/Cys and chased for 90 min before detergent extraction and immunoprecipitation. Immunoprecipitates were treated (+) or mock-treated (−) with neuraminidase ( N'ase ) prior to resuspension and incubation overnight with beads conjugated to PNA ( P ) or no beads as total ( T ; note different totals for with and without neuraminidase) and analysis after SDS-PAGE with a Bio-Rad imager. The numbers below the gel profiles indicate the percentage of the total bound to PNA (percentage bound = (amount of construct recovered from immobilized lectin/total construct added) × 100). Results from one representative experiment are shown ( n = 2).

    Techniques Used: Expressing, Metabolic Labelling, Labeling, Immunoprecipitation, Incubation, SDS Page, Construct

    29) Product Images from "A murine tumor progression model for pancreatic cancer recapitulating the genetic alterations of the human disease"

    Article Title: A murine tumor progression model for pancreatic cancer recapitulating the genetic alterations of the human disease

    Journal: Genes & Development

    doi: 10.1101/gad.184701

    Proliferating cells are detected by immunofluorescence analysis of BrdU labeling in the pancreas of TGF-α transgenic mice with developing tubular complexes ( A ) or developed complexes ( B ) and in littermate controls ( C ). Arrowheads indicate BrdU-positive nuclei. ( D,E ) Comparison of immunohistochemical staining for p53 in the premalignant lesions in 180-day-old TGF-α transgenic mice ( D ) with littermate controls ( E ). ( F ) Relative mRNA levels of p21 Cip1 , p16 Ink4a , p19 Arf , and p27 Kip1 . Controls were performed with wild-type pancreas for each time point and target individually. One representative control is shown (WT). ( G ) Cumulative tumor incidence of TGF-α, TGF-α/p53 +/− , TGF-α/p53 −/− , p53 +/− , and p53 −/− . Details are described in Materials and Methods.
    Figure Legend Snippet: Proliferating cells are detected by immunofluorescence analysis of BrdU labeling in the pancreas of TGF-α transgenic mice with developing tubular complexes ( A ) or developed complexes ( B ) and in littermate controls ( C ). Arrowheads indicate BrdU-positive nuclei. ( D,E ) Comparison of immunohistochemical staining for p53 in the premalignant lesions in 180-day-old TGF-α transgenic mice ( D ) with littermate controls ( E ). ( F ) Relative mRNA levels of p21 Cip1 , p16 Ink4a , p19 Arf , and p27 Kip1 . Controls were performed with wild-type pancreas for each time point and target individually. One representative control is shown (WT). ( G ) Cumulative tumor incidence of TGF-α, TGF-α/p53 +/− , TGF-α/p53 −/− , p53 +/− , and p53 −/− . Details are described in Materials and Methods.

    Techniques Used: Immunofluorescence, Labeling, Transgenic Assay, Mouse Assay, Immunohistochemistry, Staining

    30) Product Images from "The peroxisomal matrix protein translocon is a large cavity-forming protein assembly into which PEX5 protein enters to release its cargo"

    Article Title: The peroxisomal matrix protein translocon is a large cavity-forming protein assembly into which PEX5 protein enters to release its cargo

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M117.805044

    DTM-bound PEX5(1–125;C11K/A) is accessible to PK. A , PEX5(1–125;C11K) is correctly monoubiquitinated but does not acquire a PK-protected status. A primed PNS (see “Experimental procedures”) was used in AMP-PNP-supplemented in vitro assays programmed with radiolabeled PEX5(1–197;C11K) ( lanes 1 and 2 ; C11K ), PEX5(1–197;C11A) ( lanes 3 and 4 ; C11A ), PEX5(1–125;C11K) ( lanes 5 and 6 ; C11K ), or PEX5(1–125;C11A) ( lanes 7 and 8 ; C11A ). One-half of each reaction was treated with PK as indicated. Organelle fractions were analyzed by SDS-PAGE/Western blotting/autoradiography. The autoradiograph ( upper panel ) and the corresponding nitrocellulose membrane probed with an antibody directed to sterol carrier protein x ( SCPx ; lower panel ) are shown. The exposure time of the PEX5(1–125;C11K/A) panel was 4-fold longer than that of PEX5(1–197;C11K/A) to obtain similar intensities of the ubiquitinated species. Note that PEX5(1–197;C11K/A) and PEX5(1–125;C11K/A) have the same number of methionines. Lanes In K and In A , RRL containing the C11K and C11A versions of the indicated 35 S-proteins, respectively. B , Ub-PEX5(1–125;C11K), but not PEX5(1–125;C11K), is tightly bound to organelles. Radiolabeled PEX5(1–125;C11K) was incubated with a primed PNS in AMP-PNP-containing import buffer for 30 min at 37 °C. The organelles were then recovered by centrifugation, resuspended in import buffer, and divided into three tubes. One tube was kept on ice ( lane T ), and the other two tubes were incubated for 15 min at 37 °C in the presence of 10 μg of either recombinant PEX5(1–324) or PEX19 as indicated. Organelles ( P ) and the corresponding supernatants ( S ) were separated by centrifugation and analyzed by SDS-PAGE/autoradiography. Lane In , RRL containing the radiolabeled protein. The autoradiograph ( upper panel ) and a portion of the corresponding Ponceau S-stained membrane ( lower panel ) are shown. C , Ub-PEX5(1–125;C11K) is a substrate for the REM. Radiolabeled PEX5(1–197;C11K) ( left panels ) or PEX5(1–125;C11K) ( right panels ) was incubated with a primed PNS in import buffer supplemented with ubiquitin aldehyde and AMP-PNP. The reactions were then centrifuged to separate supernatant fraction ( S i ) from organelles ( P i ). The organelles were resuspended in an ATP- or AMP-PNP-containing import buffer and further incubated for 15 min at 37 °C. The organelle suspensions were again centrifuged to obtain a supernatant ( S e ) and an organelle pellet ( P e ). Samples were analyzed by SDS-PAGE/Western blotting/autoradiography. The autoradiographs ( upper panels ) and the behavior of endogenous PEX13 ( lower panels ) are shown. S i , equivalent to 50 μg of PNS; P i , P e , and S e , equivalent to 600 μg of PNS. Lanes In , RRL containing the radiolabeled protein. In B and C , a and b indicate monoubiquitinated and non-ubiquitinated PEX5 species, respectively. D , radiolabeled PEX5(1–125;C11K)-clv is partially processed in the PNS-based in vitro assay. Radiolabeled PEX5(1–125;C11K)-clv and PEX5(1–125;C11K)-nclv were subjected to PNS-based in vitro assays in the presence of AMP-PNP for 60 min. The reactions were then centrifuged to separate organelles ( lanes P ) from soluble proteins ( lanes S ). Organelles and soluble fractions from 600 and 100 μg of PNS, respectively, were subjected to SDS-PAGE/Western blotting/autoradiography. Lanes In clv and In nclv , RRL containing the indicated 35 S-labeled proteins. The autoradiograph ( upper panel ) and the corresponding Ponceau S-stained membrane ( lower panel ) are shown. The cleaved species is indicated by an arrowhead. Numbers to the left indicate the molecular mass (kDa) of protein standards.
    Figure Legend Snippet: DTM-bound PEX5(1–125;C11K/A) is accessible to PK. A , PEX5(1–125;C11K) is correctly monoubiquitinated but does not acquire a PK-protected status. A primed PNS (see “Experimental procedures”) was used in AMP-PNP-supplemented in vitro assays programmed with radiolabeled PEX5(1–197;C11K) ( lanes 1 and 2 ; C11K ), PEX5(1–197;C11A) ( lanes 3 and 4 ; C11A ), PEX5(1–125;C11K) ( lanes 5 and 6 ; C11K ), or PEX5(1–125;C11A) ( lanes 7 and 8 ; C11A ). One-half of each reaction was treated with PK as indicated. Organelle fractions were analyzed by SDS-PAGE/Western blotting/autoradiography. The autoradiograph ( upper panel ) and the corresponding nitrocellulose membrane probed with an antibody directed to sterol carrier protein x ( SCPx ; lower panel ) are shown. The exposure time of the PEX5(1–125;C11K/A) panel was 4-fold longer than that of PEX5(1–197;C11K/A) to obtain similar intensities of the ubiquitinated species. Note that PEX5(1–197;C11K/A) and PEX5(1–125;C11K/A) have the same number of methionines. Lanes In K and In A , RRL containing the C11K and C11A versions of the indicated 35 S-proteins, respectively. B , Ub-PEX5(1–125;C11K), but not PEX5(1–125;C11K), is tightly bound to organelles. Radiolabeled PEX5(1–125;C11K) was incubated with a primed PNS in AMP-PNP-containing import buffer for 30 min at 37 °C. The organelles were then recovered by centrifugation, resuspended in import buffer, and divided into three tubes. One tube was kept on ice ( lane T ), and the other two tubes were incubated for 15 min at 37 °C in the presence of 10 μg of either recombinant PEX5(1–324) or PEX19 as indicated. Organelles ( P ) and the corresponding supernatants ( S ) were separated by centrifugation and analyzed by SDS-PAGE/autoradiography. Lane In , RRL containing the radiolabeled protein. The autoradiograph ( upper panel ) and a portion of the corresponding Ponceau S-stained membrane ( lower panel ) are shown. C , Ub-PEX5(1–125;C11K) is a substrate for the REM. Radiolabeled PEX5(1–197;C11K) ( left panels ) or PEX5(1–125;C11K) ( right panels ) was incubated with a primed PNS in import buffer supplemented with ubiquitin aldehyde and AMP-PNP. The reactions were then centrifuged to separate supernatant fraction ( S i ) from organelles ( P i ). The organelles were resuspended in an ATP- or AMP-PNP-containing import buffer and further incubated for 15 min at 37 °C. The organelle suspensions were again centrifuged to obtain a supernatant ( S e ) and an organelle pellet ( P e ). Samples were analyzed by SDS-PAGE/Western blotting/autoradiography. The autoradiographs ( upper panels ) and the behavior of endogenous PEX13 ( lower panels ) are shown. S i , equivalent to 50 μg of PNS; P i , P e , and S e , equivalent to 600 μg of PNS. Lanes In , RRL containing the radiolabeled protein. In B and C , a and b indicate monoubiquitinated and non-ubiquitinated PEX5 species, respectively. D , radiolabeled PEX5(1–125;C11K)-clv is partially processed in the PNS-based in vitro assay. Radiolabeled PEX5(1–125;C11K)-clv and PEX5(1–125;C11K)-nclv were subjected to PNS-based in vitro assays in the presence of AMP-PNP for 60 min. The reactions were then centrifuged to separate organelles ( lanes P ) from soluble proteins ( lanes S ). Organelles and soluble fractions from 600 and 100 μg of PNS, respectively, were subjected to SDS-PAGE/Western blotting/autoradiography. Lanes In clv and In nclv , RRL containing the indicated 35 S-labeled proteins. The autoradiograph ( upper panel ) and the corresponding Ponceau S-stained membrane ( lower panel ) are shown. The cleaved species is indicated by an arrowhead. Numbers to the left indicate the molecular mass (kDa) of protein standards.

    Techniques Used: In Vitro, SDS Page, Western Blot, Autoradiography, Incubation, Centrifugation, Recombinant, Staining, Labeling

    31) Product Images from "Dynein light chain interaction with the peroxisomal import docking complex modulates peroxisome biogenesis in yeast"

    Article Title: Dynein light chain interaction with the peroxisomal import docking complex modulates peroxisome biogenesis in yeast

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.129056

    Growth of strains on oleic-acid-containing medium. (A) Ability of the Pex17p mutations Pex17pΔ102–106 and Pex17p mut to restore growth to the pex17 Δ strain on oleic-acid-containing YPBO medium. (B) Deletion of the DYN2 gene enhances
    Figure Legend Snippet: Growth of strains on oleic-acid-containing medium. (A) Ability of the Pex17p mutations Pex17pΔ102–106 and Pex17p mut to restore growth to the pex17 Δ strain on oleic-acid-containing YPBO medium. (B) Deletion of the DYN2 gene enhances

    Techniques Used:

    Dyn2p interacts in vitro with the peroxisomal docking complex proteins Pex14p and Pex17p. (A) Glutathione–Sepharose beads containing GST alone or GST fused to Dyn2p, Pex14p, or Pex17p were incubated with extracts of E. coli synthesizing MBP, MBP–Dyn2p,
    Figure Legend Snippet: Dyn2p interacts in vitro with the peroxisomal docking complex proteins Pex14p and Pex17p. (A) Glutathione–Sepharose beads containing GST alone or GST fused to Dyn2p, Pex14p, or Pex17p were incubated with extracts of E. coli synthesizing MBP, MBP–Dyn2p,

    Techniques Used: In Vitro, Incubation

    32) Product Images from "Dynein light chain interaction with the peroxisomal import docking complex modulates peroxisome biogenesis in yeast"

    Article Title: Dynein light chain interaction with the peroxisomal import docking complex modulates peroxisome biogenesis in yeast

    Journal: Journal of Cell Science

    doi: 10.1242/jcs.129056

    Growth of strains on oleic-acid-containing medium. (A) Ability of the Pex17p mutations Pex17pΔ102–106 and Pex17p mut to restore growth to the pex17 Δ strain on oleic-acid-containing YPBO medium. (B) Deletion of the DYN2 gene enhances
    Figure Legend Snippet: Growth of strains on oleic-acid-containing medium. (A) Ability of the Pex17p mutations Pex17pΔ102–106 and Pex17p mut to restore growth to the pex17 Δ strain on oleic-acid-containing YPBO medium. (B) Deletion of the DYN2 gene enhances

    Techniques Used:

    Dyn2p interacts in vitro with the peroxisomal docking complex proteins Pex14p and Pex17p. (A) Glutathione–Sepharose beads containing GST alone or GST fused to Dyn2p, Pex14p, or Pex17p were incubated with extracts of E. coli synthesizing MBP, MBP–Dyn2p,
    Figure Legend Snippet: Dyn2p interacts in vitro with the peroxisomal docking complex proteins Pex14p and Pex17p. (A) Glutathione–Sepharose beads containing GST alone or GST fused to Dyn2p, Pex14p, or Pex17p were incubated with extracts of E. coli synthesizing MBP, MBP–Dyn2p,

    Techniques Used: In Vitro, Incubation

    33) Product Images from "Receptor guanylyl cyclases in Inka cells targeted by eclosion hormone"

    Article Title: Receptor guanylyl cyclases in Inka cells targeted by eclosion hormone

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.0812593106

    BdmGC-1 and -1B exhibit different sensitivities to EH. ( A ) HEK-293T cells transiently expressing FLAG·BdmGC-1 or FLAG·BdmGC-1B were incubated with increasing concentrations of EH, i.e., 64 fM, 320 fM, 1.6 pM, 8 pM, 40 pM, 200 pM, and 1 nM, for 30 min at 37 °C. Total cGMP mobilized was measured as described in the Materials and Methods and results are expressed as mean ± SEM ( n = 3). Cell lysates were immunoblotted with anti-FLAG antibodies to confirm similar expression levels of BdmGC-1 and -1B. ( B ) Relative increase of cGMP production in response to physiological (8 pM) or pharmacological (1,000 pM) concentrations of EH for BdmGC-1 and -1B.
    Figure Legend Snippet: BdmGC-1 and -1B exhibit different sensitivities to EH. ( A ) HEK-293T cells transiently expressing FLAG·BdmGC-1 or FLAG·BdmGC-1B were incubated with increasing concentrations of EH, i.e., 64 fM, 320 fM, 1.6 pM, 8 pM, 40 pM, 200 pM, and 1 nM, for 30 min at 37 °C. Total cGMP mobilized was measured as described in the Materials and Methods and results are expressed as mean ± SEM ( n = 3). Cell lysates were immunoblotted with anti-FLAG antibodies to confirm similar expression levels of BdmGC-1 and -1B. ( B ) Relative increase of cGMP production in response to physiological (8 pM) or pharmacological (1,000 pM) concentrations of EH for BdmGC-1 and -1B.

    Techniques Used: Expressing, Incubation

    HEK-293T cells transiently expressing BdmGC-1 or -1B generate cGMP in response to EH exposure. Cells transiently expressing FLAG·BdmGC-1 or FLAG·BdmGC-1B were incubated with serum-free medium for 1 h. Before assay, cells were washed twice with PBS and then incubated in PBS supplemented with IBMX for 10 min at room temperature. Thereafter, 200 pM EH was added and incubated for 30 min at 37 °C. Total cGMP content was measured as described in the Materials and Methods . GC activity was measured in HEK cells transiently transfected with empty vector as control. Results are expressed as means ± SEM ( n = 3). Cell lysates were immunoblotted with anti-FLAG antibodies to confirm similar expression levels of BdmGC-1 and -1B form.
    Figure Legend Snippet: HEK-293T cells transiently expressing BdmGC-1 or -1B generate cGMP in response to EH exposure. Cells transiently expressing FLAG·BdmGC-1 or FLAG·BdmGC-1B were incubated with serum-free medium for 1 h. Before assay, cells were washed twice with PBS and then incubated in PBS supplemented with IBMX for 10 min at room temperature. Thereafter, 200 pM EH was added and incubated for 30 min at 37 °C. Total cGMP content was measured as described in the Materials and Methods . GC activity was measured in HEK cells transiently transfected with empty vector as control. Results are expressed as means ± SEM ( n = 3). Cell lysates were immunoblotted with anti-FLAG antibodies to confirm similar expression levels of BdmGC-1 and -1B form.

    Techniques Used: Expressing, Incubation, Activity Assay, Transfection, Plasmid Preparation

    BdmGC-1s are N-glycosylated in HEK-293T cells. Cells transiently expressing FLAG·BdmGC-1 or FLAG·BdmGC-1Β were lysed in buffer containing protease inhibitors and incubated in G7 reaction buffer in the presence or absence of PNgaseF for 30 min at 37 °C. Western blot analysis using an anti-FLAG M2 antibody was performed.
    Figure Legend Snippet: BdmGC-1s are N-glycosylated in HEK-293T cells. Cells transiently expressing FLAG·BdmGC-1 or FLAG·BdmGC-1Β were lysed in buffer containing protease inhibitors and incubated in G7 reaction buffer in the presence or absence of PNgaseF for 30 min at 37 °C. Western blot analysis using an anti-FLAG M2 antibody was performed.

    Techniques Used: Expressing, Incubation, Western Blot

    Diagrammatic comparison of BdmGC-1 and -1B. Both BdmGC-1 isoforms exhibit all of the characteristics of receptor GCs, including (from left to right) an extracellular domain (ECD; 82–443 of BdmGC-1 and 82–489 of BdmGC-1B), a transmembrane region (TM; 504–524 of BdmGC-1 and 550–570 of BdmGC-1B), a kinase-homology domain (KHD; 584–845 of BdmGC-1 and 630–891 of BdmGC-1B), and a cyclase catalytic region (CYC; 911-1097 of BdmGC-1 957-1143 of BdmGC-1B). An extra insertion (347–392) with 4 additional cysteines in the ECD and absence of a C-terminal sequence are distinctive characteristics of BdmGC-1B.
    Figure Legend Snippet: Diagrammatic comparison of BdmGC-1 and -1B. Both BdmGC-1 isoforms exhibit all of the characteristics of receptor GCs, including (from left to right) an extracellular domain (ECD; 82–443 of BdmGC-1 and 82–489 of BdmGC-1B), a transmembrane region (TM; 504–524 of BdmGC-1 and 550–570 of BdmGC-1B), a kinase-homology domain (KHD; 584–845 of BdmGC-1 and 630–891 of BdmGC-1B), and a cyclase catalytic region (CYC; 911-1097 of BdmGC-1 957-1143 of BdmGC-1B). An extra insertion (347–392) with 4 additional cysteines in the ECD and absence of a C-terminal sequence are distinctive characteristics of BdmGC-1B.

    Techniques Used: Sequencing

    Model for EH-mediated ETH secretion by Inka cells. EH evokes cGMP synthesis by binding to its receptor, BdmGC-1. EH may act via 2 distinct pathways: A direct action on BdmGC-1 elevates cGMP content; a second signal transduction pathway functions via calcium mobilization, which regulates BdmGC-1B activity, a common regulation phenomenon in sensory GCs of mammals.
    Figure Legend Snippet: Model for EH-mediated ETH secretion by Inka cells. EH evokes cGMP synthesis by binding to its receptor, BdmGC-1. EH may act via 2 distinct pathways: A direct action on BdmGC-1 elevates cGMP content; a second signal transduction pathway functions via calcium mobilization, which regulates BdmGC-1B activity, a common regulation phenomenon in sensory GCs of mammals.

    Techniques Used: Binding Assay, Activated Clotting Time Assay, Transduction, Activity Assay

    34) Product Images from "Increased adenine nucleotide translocator 1 in reactive astrocytes facilitates glutamate transport"

    Article Title: Increased adenine nucleotide translocator 1 in reactive astrocytes facilitates glutamate transport

    Journal: Experimental neurology

    doi:

    TGF-β1 stimulates Ant1 mRNA expression in reactive astrocytes of the glial scar (A) In situ hybridization to a brain tissue section containing a nitrocellulose filter glial scar implant (i) reveals strong Ant1 mRNA expression in and around the glial scar filter implant. The intensity of the hybridization signal is diminished with increasing distance from the glial scar filter implant (bottom left). Ant1 mRNA expression is also demonstrated in neurons of the CA1 region of the hippocampus (bottom right). c.c. = corpus callosum. (B) Immunohistochemistry for GFAP on a section from brain implanted with a nitrocellulose filter demonstrates the localized reactive astrogliosis that occurs within and surrounding the filter implant (i) in this in vivo model for the glial scar. (C) High magnification view of GFAP immunohistochemistry in an in vivo glial scar filter implant illustrates reactive astrocyte cell bodies and processes (e.g., arrowhead) of the glial scar that have invaded the filter implant (i). The cortical tissue dorsal to this implant separated from the filter during tissue processing (top). (D) In situ hybridization for Ant1 mRNA on the same section as shown in (C) demonstrates Ant1 mRNA within GFAP-immunopositive reactive astrocyte cell bodies and processes (arrowhead) invading the filter. (E) In situ hybridization for Ant1 mRNA reveals that the intense Ant1 mRNA hybridization is eliminated in reactive astrocytes in and around the glial scar filter implant (i) formed in the presence of TGF-β-neutralizing antibodies. Ant1 mRNA hybridization distant from the implant and in other adjacent cells types is unaffected by TGF-β neutralization. Scale bars in A and B equal 100 μm; bars in C, D, and E equal 50 μm.
    Figure Legend Snippet: TGF-β1 stimulates Ant1 mRNA expression in reactive astrocytes of the glial scar (A) In situ hybridization to a brain tissue section containing a nitrocellulose filter glial scar implant (i) reveals strong Ant1 mRNA expression in and around the glial scar filter implant. The intensity of the hybridization signal is diminished with increasing distance from the glial scar filter implant (bottom left). Ant1 mRNA expression is also demonstrated in neurons of the CA1 region of the hippocampus (bottom right). c.c. = corpus callosum. (B) Immunohistochemistry for GFAP on a section from brain implanted with a nitrocellulose filter demonstrates the localized reactive astrogliosis that occurs within and surrounding the filter implant (i) in this in vivo model for the glial scar. (C) High magnification view of GFAP immunohistochemistry in an in vivo glial scar filter implant illustrates reactive astrocyte cell bodies and processes (e.g., arrowhead) of the glial scar that have invaded the filter implant (i). The cortical tissue dorsal to this implant separated from the filter during tissue processing (top). (D) In situ hybridization for Ant1 mRNA on the same section as shown in (C) demonstrates Ant1 mRNA within GFAP-immunopositive reactive astrocyte cell bodies and processes (arrowhead) invading the filter. (E) In situ hybridization for Ant1 mRNA reveals that the intense Ant1 mRNA hybridization is eliminated in reactive astrocytes in and around the glial scar filter implant (i) formed in the presence of TGF-β-neutralizing antibodies. Ant1 mRNA hybridization distant from the implant and in other adjacent cells types is unaffected by TGF-β neutralization. Scale bars in A and B equal 100 μm; bars in C, D, and E equal 50 μm.

    Techniques Used: Expressing, In Situ Hybridization, Hybridization, Immunohistochemistry, In Vivo, Neutralization

    Increased Ant1 mRNA level in reactive astrocytes is regulated by TGF-β1. (A) Semi-quantitative RT-PCR analysis of GAPDH and Ant1 mRNA expression levels in astrocyte primary cultures (A), uninjured cerebral cortex (C), and glial scar filter implants (F) demonstrates that Ant1 mRNA levels are increased in the chronic glial scar filter implant. Neutralization of TGF-β1 in and around the filter implant in vivo (αTF) eliminates the increase in Ant1 mRNA. Equal amounts of cDNA, relative to GAPDH expression, were included for each reaction. (B) RT-PCR analysis demonstrates that TGF-β1 also regulates expression of Ant1 in primary astrocyte cell culture. GAPDH amplification (with primer set 2) again indicates that equivalent amounts of cDNA were analyzed. Three days of treatment with 10 ng/ml TGF-β1 (TGF-β) increases Ant1 mRNA levels compared with untreated astrocytes (Ast). The level of mRNA encoding the closely related isoform Ant2 is not elevated in response to TGF-β1 treatment. TGF-β1 treatment increases GFAP mRNA levels, validating the relative quantitation of mRNA levels and the efficacy of the cytokine treatment. All RT-PCR reactions were sampled in the exponential phase of amplification. (C) A luciferase reporter construct driven by the full-length (7 kb) mouse Ant1 promoter is induced 1.8-fold by 24 h of TGF-β1 treatment following transfection into primary astrocyte cell cultures. Luciferase activity is given in relative light units (RLU) and corrected for transfection efficiency with a cotransfected β-galactosidase transcription reporter construct. Transfection with Ant1 promoter-containing constructs results in a significant 80% increase in TGF-β1 stimulated luciferase activity ( P = 0.0394, two-tailed Student’s t test, error bar indicates SEM).
    Figure Legend Snippet: Increased Ant1 mRNA level in reactive astrocytes is regulated by TGF-β1. (A) Semi-quantitative RT-PCR analysis of GAPDH and Ant1 mRNA expression levels in astrocyte primary cultures (A), uninjured cerebral cortex (C), and glial scar filter implants (F) demonstrates that Ant1 mRNA levels are increased in the chronic glial scar filter implant. Neutralization of TGF-β1 in and around the filter implant in vivo (αTF) eliminates the increase in Ant1 mRNA. Equal amounts of cDNA, relative to GAPDH expression, were included for each reaction. (B) RT-PCR analysis demonstrates that TGF-β1 also regulates expression of Ant1 in primary astrocyte cell culture. GAPDH amplification (with primer set 2) again indicates that equivalent amounts of cDNA were analyzed. Three days of treatment with 10 ng/ml TGF-β1 (TGF-β) increases Ant1 mRNA levels compared with untreated astrocytes (Ast). The level of mRNA encoding the closely related isoform Ant2 is not elevated in response to TGF-β1 treatment. TGF-β1 treatment increases GFAP mRNA levels, validating the relative quantitation of mRNA levels and the efficacy of the cytokine treatment. All RT-PCR reactions were sampled in the exponential phase of amplification. (C) A luciferase reporter construct driven by the full-length (7 kb) mouse Ant1 promoter is induced 1.8-fold by 24 h of TGF-β1 treatment following transfection into primary astrocyte cell cultures. Luciferase activity is given in relative light units (RLU) and corrected for transfection efficiency with a cotransfected β-galactosidase transcription reporter construct. Transfection with Ant1 promoter-containing constructs results in a significant 80% increase in TGF-β1 stimulated luciferase activity ( P = 0.0394, two-tailed Student’s t test, error bar indicates SEM).

    Techniques Used: Quantitative RT-PCR, Expressing, Neutralization, In Vivo, Reverse Transcription Polymerase Chain Reaction, Cell Culture, Amplification, AST Assay, Quantitation Assay, Luciferase, Construct, Transfection, Activity Assay, Two Tailed Test

    Ant1 protein levels are elevated in the in vivo glial scar. (A) Thirty micrograms of protein extracted from heart (H), skeletal muscle (M), uninjured cerebral cortex (C), glial scar filter implant (F), and liver (L) was subjected to immunoblot analysis with Ant1 and Ant2 specific antisera. Ant1-is readily detected in heart and skeletal muscle and expression is apparently increased in gliotic tissue compared with the uninjured cortex. Ant2 is detected in all tissues examined except skeletal muscle and is weakly expressed in reactive astrocytes of the glial scar filter implant, especially when compared to the robust, presumably neuronal expression in the uninjured cortex. Both Ant isoforms are ~31kDa. (B) Independent filter implant and uninjured cerebral cortex protein extracts were simultaneously immunoblotted for Ant1 and for p42/44 MAPK as a loading control. A representative blot from three independent analyses is shown. Densitometric analyses of these immunoblots (values given in rows of the table) reveals that, relative to MAPK expression levels, Ant1 protein is elevated by 79% in the in vivo glial scar filter implant. (*This difference is statistically significant, P = 0.00095, Student’s t test).
    Figure Legend Snippet: Ant1 protein levels are elevated in the in vivo glial scar. (A) Thirty micrograms of protein extracted from heart (H), skeletal muscle (M), uninjured cerebral cortex (C), glial scar filter implant (F), and liver (L) was subjected to immunoblot analysis with Ant1 and Ant2 specific antisera. Ant1-is readily detected in heart and skeletal muscle and expression is apparently increased in gliotic tissue compared with the uninjured cortex. Ant2 is detected in all tissues examined except skeletal muscle and is weakly expressed in reactive astrocytes of the glial scar filter implant, especially when compared to the robust, presumably neuronal expression in the uninjured cortex. Both Ant isoforms are ~31kDa. (B) Independent filter implant and uninjured cerebral cortex protein extracts were simultaneously immunoblotted for Ant1 and for p42/44 MAPK as a loading control. A representative blot from three independent analyses is shown. Densitometric analyses of these immunoblots (values given in rows of the table) reveals that, relative to MAPK expression levels, Ant1 protein is elevated by 79% in the in vivo glial scar filter implant. (*This difference is statistically significant, P = 0.00095, Student’s t test).

    Techniques Used: In Vivo, Expressing, Western Blot

    Ant1 mRNA increase in reactive gliosis. RT-PCR analysis of mitochondrial gene expression in primary astrocyte cultures (A), uninjured cerebral cortex (C), and glial scar filter implants (F). GAPDH amplification indicates that approximately equivalent amounts of mRNA were examined. Ant1 mRNA expression is elevated in glial scar. mRNA expression levels of the nuclear DNA-encoded ATP synthase β and COIV genes and of the mitochondrial DNA-encoded ATP8 gene are unchanged in the glial scar filter implant compared with uninjured cortex. RT-PCR reactions were analyzed in the exponential phase of amplification.
    Figure Legend Snippet: Ant1 mRNA increase in reactive gliosis. RT-PCR analysis of mitochondrial gene expression in primary astrocyte cultures (A), uninjured cerebral cortex (C), and glial scar filter implants (F). GAPDH amplification indicates that approximately equivalent amounts of mRNA were examined. Ant1 mRNA expression is elevated in glial scar. mRNA expression levels of the nuclear DNA-encoded ATP synthase β and COIV genes and of the mitochondrial DNA-encoded ATP8 gene are unchanged in the glial scar filter implant compared with uninjured cortex. RT-PCR reactions were analyzed in the exponential phase of amplification.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Expressing, Amplification

    Reactive astrocytes of the CNS glial scar increase Ant1 to mobilize mitochondrial energy stores. Schematic illustration of Ant1 on the inner mitochondrial membrane (cylinder) distal to the ATP synthase activity of complex V. Ant1 transports ATP from the mitochondrial matrix, which then crosses the outer mitochondrial membrane (OMM) to the cytoplasm. Astrocyte-specific glutamate transporters (Glt-1/GLAST) cotransport extracellular glutamate with sodium, and Na + /K + ATPase activity is required to maintain the sodium gradient necessary for transporter function. Ant1 may mobilize mitochondrial ATP to provide energy for this and other reactive astrocyte energy-consuming processes.
    Figure Legend Snippet: Reactive astrocytes of the CNS glial scar increase Ant1 to mobilize mitochondrial energy stores. Schematic illustration of Ant1 on the inner mitochondrial membrane (cylinder) distal to the ATP synthase activity of complex V. Ant1 transports ATP from the mitochondrial matrix, which then crosses the outer mitochondrial membrane (OMM) to the cytoplasm. Astrocyte-specific glutamate transporters (Glt-1/GLAST) cotransport extracellular glutamate with sodium, and Na + /K + ATPase activity is required to maintain the sodium gradient necessary for transporter function. Ant1 may mobilize mitochondrial ATP to provide energy for this and other reactive astrocyte energy-consuming processes.

    Techniques Used: Activity Assay

    Glial scar formation in Ant1 null mutant mice. (A) Fourteen days following filter implantation robust reactive astrogliosis is evidenced by GFAP immunohistochemistry in brain tissue sections containing the filter implants (i) from wild-type (wt) and Ant1 null mutant “knockout” (ko) mice. Arrows indicate reactive astrocytes surrounding the implant and arrowheads denote astrocytic processes within the implant. The double-headed arrows indicate the (roughly horizontal) borders between the filter implant and cerebral cortex. Scale bar = 50 μm. (B) Glial scar filter implants from Ant1 null mutant (ko) and genetically matched wild-type (wt) control mice were retrieved for immunoblot analysis of equal amounts of protein 14 days following the injury and implantation. GFAP expression indicates that these mouse strains mount a similar astrogliotic response to the filter implant. Ant1 is expressed in the wild-type, but not in the Ant1 knockout glial scar, as expected. Ant2 is detected in the glial scar filter implant in both mouse strains but the level of this isoform is not apparently different in the null mutant compared with the wild-type strain.
    Figure Legend Snippet: Glial scar formation in Ant1 null mutant mice. (A) Fourteen days following filter implantation robust reactive astrogliosis is evidenced by GFAP immunohistochemistry in brain tissue sections containing the filter implants (i) from wild-type (wt) and Ant1 null mutant “knockout” (ko) mice. Arrows indicate reactive astrocytes surrounding the implant and arrowheads denote astrocytic processes within the implant. The double-headed arrows indicate the (roughly horizontal) borders between the filter implant and cerebral cortex. Scale bar = 50 μm. (B) Glial scar filter implants from Ant1 null mutant (ko) and genetically matched wild-type (wt) control mice were retrieved for immunoblot analysis of equal amounts of protein 14 days following the injury and implantation. GFAP expression indicates that these mouse strains mount a similar astrogliotic response to the filter implant. Ant1 is expressed in the wild-type, but not in the Ant1 knockout glial scar, as expected. Ant2 is detected in the glial scar filter implant in both mouse strains but the level of this isoform is not apparently different in the null mutant compared with the wild-type strain.

    Techniques Used: Mutagenesis, Mouse Assay, Immunohistochemistry, Expressing, Knock-Out

    35) Product Images from "Reovirus ?NS Protein Is Required for Nucleation of Viral Assembly Complexes and Formation of Viral Inclusions"

    Article Title: Reovirus ?NS Protein Is Required for Nucleation of Viral Assembly Complexes and Formation of Viral Inclusions

    Journal: Journal of Virology

    doi: 10.1128/JVI.75.3.1459-1475.2001

    Subcellular localization of ςNS and μ2 proteins in cells infected with T3D, determined at different times postinfection. L cells were infected with T3D at an MOI of 10 PFU per cell and incubated at 37°C for the time periods shown. Cells were stained for ςNS by using a ςNS-specific polyclonal antiserum directly conjugated to Alexa Fluor 546 and for μ2 by using a μ2-specific polyclonal antiserum directly conjugated to Alexa Fluor 488. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the μ2 protein is colored red. A DIC image of each field was obtained. In the merged image, colocalization of ςNS and μ2 is indicated by the yellow color. Images were processed using Adobe Photoshop. Bars, 25 μm.
    Figure Legend Snippet: Subcellular localization of ςNS and μ2 proteins in cells infected with T3D, determined at different times postinfection. L cells were infected with T3D at an MOI of 10 PFU per cell and incubated at 37°C for the time periods shown. Cells were stained for ςNS by using a ςNS-specific polyclonal antiserum directly conjugated to Alexa Fluor 546 and for μ2 by using a μ2-specific polyclonal antiserum directly conjugated to Alexa Fluor 488. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the μ2 protein is colored red. A DIC image of each field was obtained. In the merged image, colocalization of ςNS and μ2 is indicated by the yellow color. Images were processed using Adobe Photoshop. Bars, 25 μm.

    Techniques Used: Infection, Incubation, Staining, Microscopy

    Subcellular localization of reovirus ςNS and μ2 proteins in cells infected with reovirus strain T3D. L cells were infected with T3D at an MOI of 10 PFU per cell and incubated at 37°C for 18 h. Cells were stained for ςNS by using ςNS-specific MAb 2H7 (B) and for μ2 by using a μ2-specific polyclonal antiserum (C) as primary antibodies followed by Alexa Fluor 546 goat anti-mouse IgG and Alexa Fluor 488 goat anti-rabbit IgG, respectively, as secondary antibodies. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the μ2 protein is colored red. (A) A DIC image of the field was obtained. (D) In the merged image, colocalization of ςNS and μ2 is indicated by the yellow color. The arrow indicates a viral inclusion in which three different zones of viral proteins are evident: a red (μ2) center, a yellow (ςNS and μ2) intermediate zone, and a narrow peripheral zone of green (ςNS). Images were processed using Adobe Photoshop. Bars, 25 μm.
    Figure Legend Snippet: Subcellular localization of reovirus ςNS and μ2 proteins in cells infected with reovirus strain T3D. L cells were infected with T3D at an MOI of 10 PFU per cell and incubated at 37°C for 18 h. Cells were stained for ςNS by using ςNS-specific MAb 2H7 (B) and for μ2 by using a μ2-specific polyclonal antiserum (C) as primary antibodies followed by Alexa Fluor 546 goat anti-mouse IgG and Alexa Fluor 488 goat anti-rabbit IgG, respectively, as secondary antibodies. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the μ2 protein is colored red. (A) A DIC image of the field was obtained. (D) In the merged image, colocalization of ςNS and μ2 is indicated by the yellow color. The arrow indicates a viral inclusion in which three different zones of viral proteins are evident: a red (μ2) center, a yellow (ςNS and μ2) intermediate zone, and a narrow peripheral zone of green (ςNS). Images were processed using Adobe Photoshop. Bars, 25 μm.

    Techniques Used: Infection, Incubation, Staining, Microscopy

    Subcellular localization of reovirus ςNS and μ1/μ1C proteins in cells infected with reovirus strain T3D. L cells were infected with T3D at an MOI of 10 PFU per cell and incubated at 37°C for 18 h. Cells were stained for ςNS by using a ςNS-specific polyclonal antiserum (B) and for μ1/μ1C by using μ1/μ1C-specific MAb 8H6 (C) as primary antibodies followed by Alexa Fluor 488 goat anti-rabbit IgG and Alexa Fluor 546 goat anti-mouse IgG, respectively, as secondary antibodies. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the μ1/μ1C protein is colored red. (A) A DIC image of the field was obtained. (D) In the merged image, colocalization of ςNS and μ1/μ1C is indicated by the yellow color. Images were processed using Adobe Photoshop. Bars, 25 μm.
    Figure Legend Snippet: Subcellular localization of reovirus ςNS and μ1/μ1C proteins in cells infected with reovirus strain T3D. L cells were infected with T3D at an MOI of 10 PFU per cell and incubated at 37°C for 18 h. Cells were stained for ςNS by using a ςNS-specific polyclonal antiserum (B) and for μ1/μ1C by using μ1/μ1C-specific MAb 8H6 (C) as primary antibodies followed by Alexa Fluor 488 goat anti-rabbit IgG and Alexa Fluor 546 goat anti-mouse IgG, respectively, as secondary antibodies. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the μ1/μ1C protein is colored red. (A) A DIC image of the field was obtained. (D) In the merged image, colocalization of ςNS and μ1/μ1C is indicated by the yellow color. Images were processed using Adobe Photoshop. Bars, 25 μm.

    Techniques Used: Infection, Incubation, Staining, Microscopy

    Stability of reovirus ςNS protein in cells infected with T3D or tsE320 at a nonpermissive temperature. L cells were either mock infected or infected with either T3D or tsE320 at an MOI of 10 PFU per cell and incubated at 39.5°C. At 6 h postinfection, cells were pulse-labeled with [ 35 S]methionine-[ 35 S]cysteine for 1 h and then incubated in the absence of radiolabeled methionine-cysteine for the time periods shown. The ςNS protein was immunoprecipitated from cell lysates by using polyclonal ςNS-specific antiserum, resolved by SDS-PAGE, visualized by autoradiography, and quantitated by phosphorimager analysis. (A) Representative autoradiogram. (B) Band densities corresponding to ςNS protein, quantitated with a phosphorimager and normalized to the 0-h time point. The results are presented as the mean relative protein units for three independent experiments. Error bars indicate standard deviations of the means.
    Figure Legend Snippet: Stability of reovirus ςNS protein in cells infected with T3D or tsE320 at a nonpermissive temperature. L cells were either mock infected or infected with either T3D or tsE320 at an MOI of 10 PFU per cell and incubated at 39.5°C. At 6 h postinfection, cells were pulse-labeled with [ 35 S]methionine-[ 35 S]cysteine for 1 h and then incubated in the absence of radiolabeled methionine-cysteine for the time periods shown. The ςNS protein was immunoprecipitated from cell lysates by using polyclonal ςNS-specific antiserum, resolved by SDS-PAGE, visualized by autoradiography, and quantitated by phosphorimager analysis. (A) Representative autoradiogram. (B) Band densities corresponding to ςNS protein, quantitated with a phosphorimager and normalized to the 0-h time point. The results are presented as the mean relative protein units for three independent experiments. Error bars indicate standard deviations of the means.

    Techniques Used: Infection, Incubation, Labeling, Immunoprecipitation, SDS Page, Autoradiography

    Subcellular localization of ςNS and reovirus proteins in cells infected with wt T3D or mutant tsE320 at a nonpermissive temperature. L cells were infected with either T3D (A to D) or tsE320 (E to H) at an MOI of 10 PFU per cell and incubated at 37°C (T3D) or 39.5°C ( tsE320 ) for 24 h. Cells were stained for ςNS by using ςNS-specific MAb 2H7 (B and F) and for reovirus proteins by using a polyclonal antiserum raised against T3D (C and G) as primary antibodies followed by Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 546 goat anti-rabbit IgG, respectively, as secondary antibodies. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the reovirus proteins are colored red. (A and E) A DIC image of each field was obtained. (D and H) In the merged images, colocalization of ςNS and reovirus proteins is indicated by the yellow color. Images were processed using Adobe Photoshop. Bars, 25 μm.
    Figure Legend Snippet: Subcellular localization of ςNS and reovirus proteins in cells infected with wt T3D or mutant tsE320 at a nonpermissive temperature. L cells were infected with either T3D (A to D) or tsE320 (E to H) at an MOI of 10 PFU per cell and incubated at 37°C (T3D) or 39.5°C ( tsE320 ) for 24 h. Cells were stained for ςNS by using ςNS-specific MAb 2H7 (B and F) and for reovirus proteins by using a polyclonal antiserum raised against T3D (C and G) as primary antibodies followed by Alexa Fluor 488 goat anti-mouse IgG and Alexa Fluor 546 goat anti-rabbit IgG, respectively, as secondary antibodies. Images were obtained by using a confocal microscope. The ςNS protein is colored green, and the reovirus proteins are colored red. (A and E) A DIC image of each field was obtained. (D and H) In the merged images, colocalization of ςNS and reovirus proteins is indicated by the yellow color. Images were processed using Adobe Photoshop. Bars, 25 μm.

    Techniques Used: Infection, Mutagenesis, Incubation, Staining, Microscopy

    36) Product Images from "The Receptor-Like Kinase SIT1 Mediates Salt Sensitivity by Activating MAPK3/6 and Regulating Ethylene Homeostasis in Rice [C]The Receptor-Like Kinase SIT1 Mediates Salt Sensitivity by Activating MAPK3/6 and Regulating Ethylene Homeostasis in Rice [C] [W]"

    Article Title: The Receptor-Like Kinase SIT1 Mediates Salt Sensitivity by Activating MAPK3/6 and Regulating Ethylene Homeostasis in Rice [C]The Receptor-Like Kinase SIT1 Mediates Salt Sensitivity by Activating MAPK3/6 and Regulating Ethylene Homeostasis in Rice [C] [W]

    Journal: The Plant Cell

    doi: 10.1105/tpc.114.125187

    The SIT1-MPK3/6 Phosphorylation Cascade Mediates Salt Sensitivity in Rice.
    Figure Legend Snippet: The SIT1-MPK3/6 Phosphorylation Cascade Mediates Salt Sensitivity in Rice.

    Techniques Used:

    SIT1 and SIT2 Contribute to Salt Sensitivity in Rice.
    Figure Legend Snippet: SIT1 and SIT2 Contribute to Salt Sensitivity in Rice.

    Techniques Used:

    SIT1 Kinase Activity Confers Salt Sensitivity.
    Figure Legend Snippet: SIT1 Kinase Activity Confers Salt Sensitivity.

    Techniques Used: Activity Assay

    SIT1 Mediates Salt Sensitivity by Activating Rice MPK3/6.
    Figure Legend Snippet: SIT1 Mediates Salt Sensitivity by Activating Rice MPK3/6.

    Techniques Used:

    SIT1 Positively Regulates Ethylene Synthesis.
    Figure Legend Snippet: SIT1 Positively Regulates Ethylene Synthesis.

    Techniques Used:

    37) Product Images from "Conserved endoplasmic reticulum-associated degradation system to eliminate mutated receptor-like kinases in Arabidopsis"

    Article Title: Conserved endoplasmic reticulum-associated degradation system to eliminate mutated receptor-like kinases in Arabidopsis

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1013251108

    An ebs5 mutation suppresses the dwarf phenotype of bri1-9 by blocking the ERAD of the mutated BR receptor. ( A ) Immunoblot analysis of bri1-9. Total proteins extracted from 2-wk-old seedlings were treated with Endo H, separated by SDS/PAGE, and analyzed by immunoblotting with anti-BRI1 antibody. bri1-9 HM and bri1-9 CT denote the HM- and C-type N-glycan–carrying form of bri1-9, respectively. Coomassie blue staining of the small subunit of the Arabidopsis Rubisco (RbcS) serves as a loading control. ( B ) Immunoblot analysis of the bri1-9 degradation. Two-week-old seedlings were transferred into liquid 1/2 MS medium containing 180 μM CHX. Equal amounts of seedlings were removed at indicated incubation times to extract total proteins in 2× SDS sample buffer, which were analyzed by immunoblotting with the anti-BRI1 antibody. Asterisk indicates a nonspecific band for loading control. ( C–E ) Shown here, from left to right, are 2-wk-old ( C ), 5-d-old ( D ), and 2-mo-old ( E ) plants of wild type, bri1-9 , and ebs5-1 bri1-9 . ( F ) The root-growth inhibition assay. Root lengths of 7-d-old seedlings grown on BL-containing medium were measured and presented as the relative value of the average root length of BL-treated seedlings to that of untreated seedlings of the same genotype. Each data point represents the average of ∼40 seedlings of duplicated experiments. Error bars represent SE. ( G ) Immunoblot analysis of BES1 phosphorylation in 2-wk-old seedlings treated with or without 1 μM BL. Total protein extracts were separated by SDS/PAGE and analyzed by immunoblotting with an anti-BES1 antibody. Asterisk indicates a nonspecific band for loading control. ( H ) Phenotypic comparison between ebs5-1 bri1-9 and a representative ebs5-1 bri1-9 transgenic line expressing a genomic EBS2 transgene.
    Figure Legend Snippet: An ebs5 mutation suppresses the dwarf phenotype of bri1-9 by blocking the ERAD of the mutated BR receptor. ( A ) Immunoblot analysis of bri1-9. Total proteins extracted from 2-wk-old seedlings were treated with Endo H, separated by SDS/PAGE, and analyzed by immunoblotting with anti-BRI1 antibody. bri1-9 HM and bri1-9 CT denote the HM- and C-type N-glycan–carrying form of bri1-9, respectively. Coomassie blue staining of the small subunit of the Arabidopsis Rubisco (RbcS) serves as a loading control. ( B ) Immunoblot analysis of the bri1-9 degradation. Two-week-old seedlings were transferred into liquid 1/2 MS medium containing 180 μM CHX. Equal amounts of seedlings were removed at indicated incubation times to extract total proteins in 2× SDS sample buffer, which were analyzed by immunoblotting with the anti-BRI1 antibody. Asterisk indicates a nonspecific band for loading control. ( C–E ) Shown here, from left to right, are 2-wk-old ( C ), 5-d-old ( D ), and 2-mo-old ( E ) plants of wild type, bri1-9 , and ebs5-1 bri1-9 . ( F ) The root-growth inhibition assay. Root lengths of 7-d-old seedlings grown on BL-containing medium were measured and presented as the relative value of the average root length of BL-treated seedlings to that of untreated seedlings of the same genotype. Each data point represents the average of ∼40 seedlings of duplicated experiments. Error bars represent SE. ( G ) Immunoblot analysis of BES1 phosphorylation in 2-wk-old seedlings treated with or without 1 μM BL. Total protein extracts were separated by SDS/PAGE and analyzed by immunoblotting with an anti-BES1 antibody. Asterisk indicates a nonspecific band for loading control. ( H ) Phenotypic comparison between ebs5-1 bri1-9 and a representative ebs5-1 bri1-9 transgenic line expressing a genomic EBS2 transgene.

    Techniques Used: Mutagenesis, Blocking Assay, SDS Page, Staining, Mass Spectrometry, Incubation, Growth Inhibition Assay, Transgenic Assay, Expressing

    EBS5 encodes the Arabidopsis homolog of the yeast Hrd3/mammalian Sel1L protein. ( A ) Identified nucleotide change and predicted molecular defects of five ebs5 alleles. ( B ) Shown here are pictures of bri1-9 and four transgenic ebs5-1 bri1-9 lines carrying the pPZP222 vector or a genomic EBS5 transgene. ( C ) Immunoblot analysis of EBS5 abundance in 2-wk-old seedlings of bri1-9 and 4 transgenic ebs5-1 bri1-9 lines shown in B . ( D ) Immunoblot analysis of the bri1-9 abundance in 2-wk-old seedlings of bri1-9 , ebs5-1 bri1-9 , and four ebs5-1 bri1-9 transgenic lines shown in B . For C and D , equal amounts of total proteins extracted from 2-wk-old seedlings were separated by SDS/PAGE and analyzed by immunoblotting with anti-EBS5 ( C ) or anti-BRI1 ( D ). Coomassie blue staining of a duplicate gel showing the relative amount of RbcS served as loading control. ( E ) Immunoblot analysis of the CPY* abundance in the wild-type yeast cells transformed with a CPY* plasmid or the yeast Δhrd3 CPY* strain transformed with the indicated plasmid. Equal amounts of total proteins extracted from yeast cells of midlog growth phase treated with or without CHX were separated by SDS/PAGE and analyzed by immunoblotting with anti-HA antibody. Asterisk indicates two cross-reacting bands used for loading control. ( F ) Coimmunoprecipitation of bri1-5/bri1-9 with EBS5. Equal amounts of total proteins and anti-GFP immunoprecipitates from control/coinfiltrated tobacco leaves were separated by SDS/PAGE and analyzed by immunoblotting with anti-GFP or anti-EBS5 antibodies.
    Figure Legend Snippet: EBS5 encodes the Arabidopsis homolog of the yeast Hrd3/mammalian Sel1L protein. ( A ) Identified nucleotide change and predicted molecular defects of five ebs5 alleles. ( B ) Shown here are pictures of bri1-9 and four transgenic ebs5-1 bri1-9 lines carrying the pPZP222 vector or a genomic EBS5 transgene. ( C ) Immunoblot analysis of EBS5 abundance in 2-wk-old seedlings of bri1-9 and 4 transgenic ebs5-1 bri1-9 lines shown in B . ( D ) Immunoblot analysis of the bri1-9 abundance in 2-wk-old seedlings of bri1-9 , ebs5-1 bri1-9 , and four ebs5-1 bri1-9 transgenic lines shown in B . For C and D , equal amounts of total proteins extracted from 2-wk-old seedlings were separated by SDS/PAGE and analyzed by immunoblotting with anti-EBS5 ( C ) or anti-BRI1 ( D ). Coomassie blue staining of a duplicate gel showing the relative amount of RbcS served as loading control. ( E ) Immunoblot analysis of the CPY* abundance in the wild-type yeast cells transformed with a CPY* plasmid or the yeast Δhrd3 CPY* strain transformed with the indicated plasmid. Equal amounts of total proteins extracted from yeast cells of midlog growth phase treated with or without CHX were separated by SDS/PAGE and analyzed by immunoblotting with anti-HA antibody. Asterisk indicates two cross-reacting bands used for loading control. ( F ) Coimmunoprecipitation of bri1-5/bri1-9 with EBS5. Equal amounts of total proteins and anti-GFP immunoprecipitates from control/coinfiltrated tobacco leaves were separated by SDS/PAGE and analyzed by immunoblotting with anti-GFP or anti-EBS5 antibodies.

    Techniques Used: Transgenic Assay, Plasmid Preparation, SDS Page, Staining, Transformation Assay

    38) Product Images from "Nuclear import of APOBEC3F-labeled HIV-1 preintegration complexes"

    Article Title: Nuclear import of APOBEC3F-labeled HIV-1 preintegration complexes

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    doi: 10.1073/pnas.1315996110

    Nuclear A3F-YFP–labeled PICs colocalize with viral RNA. ( A ) Schematic of the FISH probes used to detect HIV-1 RNA. ( B ) Representative confocal images of A3F-YFP particles in the nuclei of HeLa cells that colocalize with viral RNA 6 h after infection. Infection with wild-type A3F-YFP–labeled virus of HeLa cells treated without (WT) or with 5 μM nevirapine (WT + NVP), or RT − virus (D110E). The NE was immunostained using an anti-Lamin A/C antibody (followed by an Alexa Fluor 405-labeled secondary antibody; blue), and viral RNA (red) was detected by FISH. Confocal z-stacks were acquired of the entire cells, and the YFP and RNA signals in the nuclei were quantified. Green arrows indicate an A3F-YFP particle that does not colocalize with viral RNA; white arrows indicate A3F-YFP particles that colocalize with viral RNA. Images are from a single slice obtained from a confocal z-stack. (Scale bars, 2 µm.) ( C ) Percentage of nuclear A3F-YFP particles associated with HIV-1 RNA. *Significantly different from the WT sample ( P ≤ 0.05; t test). ( D ) Comparison of HIV-1 RNA particles in the nuclei of HeLa cells infected with A3F-YFP labeled particles or viruses that do not contain A3F-YFP. *Significantly different from the WT samples ( P ≤ 0.05; t test). ( E ) Quantitation of A3F-YFP particles in the nuclei of untreated or aphidicolin-arrested HeLa cells. Untreated HeLa cells or cells treated with aphidicolin were infected with WT virus or D110E virus and fixed 6 h after infection. Confocal z-stacks were acquired of the entire cells, and the YFP signals in the nuclei were quantified. For C–E , ∼230 nuclei from three to four independent infections were analyzed for each sample; error bars indicate SD.
    Figure Legend Snippet: Nuclear A3F-YFP–labeled PICs colocalize with viral RNA. ( A ) Schematic of the FISH probes used to detect HIV-1 RNA. ( B ) Representative confocal images of A3F-YFP particles in the nuclei of HeLa cells that colocalize with viral RNA 6 h after infection. Infection with wild-type A3F-YFP–labeled virus of HeLa cells treated without (WT) or with 5 μM nevirapine (WT + NVP), or RT − virus (D110E). The NE was immunostained using an anti-Lamin A/C antibody (followed by an Alexa Fluor 405-labeled secondary antibody; blue), and viral RNA (red) was detected by FISH. Confocal z-stacks were acquired of the entire cells, and the YFP and RNA signals in the nuclei were quantified. Green arrows indicate an A3F-YFP particle that does not colocalize with viral RNA; white arrows indicate A3F-YFP particles that colocalize with viral RNA. Images are from a single slice obtained from a confocal z-stack. (Scale bars, 2 µm.) ( C ) Percentage of nuclear A3F-YFP particles associated with HIV-1 RNA. *Significantly different from the WT sample ( P ≤ 0.05; t test). ( D ) Comparison of HIV-1 RNA particles in the nuclei of HeLa cells infected with A3F-YFP labeled particles or viruses that do not contain A3F-YFP. *Significantly different from the WT samples ( P ≤ 0.05; t test). ( E ) Quantitation of A3F-YFP particles in the nuclei of untreated or aphidicolin-arrested HeLa cells. Untreated HeLa cells or cells treated with aphidicolin were infected with WT virus or D110E virus and fixed 6 h after infection. Confocal z-stacks were acquired of the entire cells, and the YFP signals in the nuclei were quantified. For C–E , ∼230 nuclei from three to four independent infections were analyzed for each sample; error bars indicate SD.

    Techniques Used: Labeling, Fluorescence In Situ Hybridization, Infection, Quantitation Assay

    39) Product Images from "Dual Roles for c-Jun N-Terminal Kinase in Developmental and Stress Responses in Cerebellar Granule Neurons"

    Article Title: Dual Roles for c-Jun N-Terminal Kinase in Developmental and Stress Responses in Cerebellar Granule Neurons

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.20-20-07602.2000

    Cerebellar granule neuron-derived JNK activity is elevated above that of stressed U937 cells, whereas p38 activity from neurons is low and responds to stress. A , Equal amounts of protein (25 μg) from 1 DIV cerebellar granule neuron ( CBG ) or U937
    Figure Legend Snippet: Cerebellar granule neuron-derived JNK activity is elevated above that of stressed U937 cells, whereas p38 activity from neurons is low and responds to stress. A , Equal amounts of protein (25 μg) from 1 DIV cerebellar granule neuron ( CBG ) or U937

    Techniques Used: Derivative Assay, Activity Assay

    40) Product Images from "Identification of AKAP79 as a Protein Phosphatase 1 catalytic binding protein"

    Article Title: Identification of AKAP79 as a Protein Phosphatase 1 catalytic binding protein

    Journal: Biochemistry

    doi: 10.1021/bi200089z

    PP1 Binds AKAP79 in the presence of PKC and calmodulin
    Figure Legend Snippet: PP1 Binds AKAP79 in the presence of PKC and calmodulin

    Techniques Used:

    Deletion of the conserved PP1 binding domain on AKAP79 increased the inhibition of PP1 activity
    Figure Legend Snippet: Deletion of the conserved PP1 binding domain on AKAP79 increased the inhibition of PP1 activity

    Techniques Used: Binding Assay, Inhibition, Activity Assay

    Mapping the PP1 inhibition domain on AKAP79
    Figure Legend Snippet: Mapping the PP1 inhibition domain on AKAP79

    Techniques Used: Inhibition

    AKAP79 directs PP1 activity towards phospho-PSD-95
    Figure Legend Snippet: AKAP79 directs PP1 activity towards phospho-PSD-95

    Techniques Used: Activity Assay

    Regulation of PP1 activity by AKAP79
    Figure Legend Snippet: Regulation of PP1 activity by AKAP79

    Techniques Used: Activity Assay

    Mapping the binding site of PP1 on AKAP79
    Figure Legend Snippet: Mapping the binding site of PP1 on AKAP79

    Techniques Used: Binding Assay

    Identification of a conserved PP1 binding motif on AKAP79
    Figure Legend Snippet: Identification of a conserved PP1 binding motif on AKAP79

    Techniques Used: Binding Assay

    Peptide competition of PP1 binding to AKAP79
    Figure Legend Snippet: Peptide competition of PP1 binding to AKAP79

    Techniques Used: Binding Assay

    Identification of AKAP79 as a PP1 binding protein
    Figure Legend Snippet: Identification of AKAP79 as a PP1 binding protein

    Techniques Used: Binding Assay

    Related Articles

    Mutagenesis:

    Article Title: DISSECT Method Using PNA-LNA Clamp Improves Detection of EGFR T790m Mutation
    Article Snippet: .. Alternatively, to apply the DISSECT-PNA-LNA PCR approach directly from mixed genomic DNA (as opposed to mixing PCR products from mutant and WT) we used Phusion Hi-Fidelity™ DNA polymerase (New England Biolabs, Ipswich, MA) for the pre-amplification from 300 ng of genomic wild type DNA and H1975 mutant DNA (10%, 1%, 0.1%, and 0.01% mixtures). .. Pre-amplification was done in 25 µl reaction volume for a total of 20 cycles according to manufacturer's protocol (New England Biolabs).

    Labeling:

    Article Title: Reconstitution of a 26-Subunit Human Kinetochore Reveals Cooperative Microtubule Binding by CENP-OPQUR and NDC80
    Article Snippet: .. SNAP-CENP-C pull-down experiments CENP-C1-544 -SNAP was covalently labeled with biotinylated benzylguanin (“Snap-biotin” reagent, New England Biolabs) according to manufacturer’s protocols. .. In a typical assay, 20 μl of streptavidin (STV)-coated beads (Pierce Streptavidin UltraLink Resin, Thermo Scientific) were used, per sample, and washed two times with 300 μl bead buffer (10 mM Hepes pH 7.5, 300 mM NaCl, 5% glycerol, 2 mM TCEP and 0.05% Triton X-100).

    Incubation:

    Article Title: Non-Secreted Clusterin Isoforms Are Translated in Rare Amounts from Distinct Human mRNA Variants and Do Not Affect Bax-Mediated Apoptosis or the NF-?B Signaling Pathway
    Article Snippet: .. Deglycosylation of proteins was carried out by incubation of 40 µg total protein with 1,000 units PNGase F (NEB) according to the manufacturer’s protocol. .. For Western blot analyses 40-150 µg of total protein or 30-40 µl of culture medium were subjected to reducing SDS-PAGE and blotted onto nitrocellulose membranes.

    Expressing:

    Article Title: AKT1/PKB? Kinase Is Frequently Elevated in Human Cancers and Its Constitutive Activation Is Required for Oncogenic Transformation in NIH3T3 Cells
    Article Snippet: .. Protein expression was determined by probing Western blots of immunoprecipitates with phospho-Ser473 Akt (New England Biolabs, Beverly, MA) or anti-AKT1 (Santa Cruz Biotechnology, Santa Cruz, CA) antibody. .. Detection of antigen-bound antibody was performed with the ECL Western blotting analysis system (Amersham, Arlington Heights, IL).

    Polymerase Chain Reaction:

    Article Title: DISSECT Method Using PNA-LNA Clamp Improves Detection of EGFR T790m Mutation
    Article Snippet: .. Alternatively, to apply the DISSECT-PNA-LNA PCR approach directly from mixed genomic DNA (as opposed to mixing PCR products from mutant and WT) we used Phusion Hi-Fidelity™ DNA polymerase (New England Biolabs, Ipswich, MA) for the pre-amplification from 300 ng of genomic wild type DNA and H1975 mutant DNA (10%, 1%, 0.1%, and 0.01% mixtures). .. Pre-amplification was done in 25 µl reaction volume for a total of 20 cycles according to manufacturer's protocol (New England Biolabs).

    Article Title: Homologous Recombination Occurs in Entamoeba and Is Enhanced during Growth Stress and Stage Conversion
    Article Snippet: .. The probes were prepared by PCR using the primers described in Table S1in and E. histolytica and E. invadens genomic DNA as template and labelled with α32 P dATP (BRIT) by using NEblot KIT (NEB). ..

    Western Blot:

    Article Title: AKT1/PKB? Kinase Is Frequently Elevated in Human Cancers and Its Constitutive Activation Is Required for Oncogenic Transformation in NIH3T3 Cells
    Article Snippet: .. Protein expression was determined by probing Western blots of immunoprecipitates with phospho-Ser473 Akt (New England Biolabs, Beverly, MA) or anti-AKT1 (Santa Cruz Biotechnology, Santa Cruz, CA) antibody. .. Detection of antigen-bound antibody was performed with the ECL Western blotting analysis system (Amersham, Arlington Heights, IL).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs triton x 100
    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Triton X 100, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/triton x 100/product/New England Biolabs
    Average 93 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    triton x 100 - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results


    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Journal: bioRxiv

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space

    doi: 10.1101/2020.04.06.025635

    Figure Lengend Snippet: Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Article Snippet: Suggested Protocol A fresh swab sample is inserted into a 500 μ l RT-LAMP reaction, containing the following components: 1x Isothermal Amplification buffer (NEB), 6 mM MgSO4 , 1.4 mM dNTP mix, 0.5 μ l Triton X-100 (amount to be optimized), 1.6 μM total of a unique set of one to five barcoded FIP primers (B-FIP-Barcode, TCTGGCCCAGTTCCTAGGTAGT NNNNNNNNNN CCAGACGAATTCGTGGTGG), where Ns denote a specific barcode sequence, 1.6 μM B-BIP primer (AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT), 0.2 μM B-F3 primer (TGGCTACTACCGAAGAGCT), 0.2 μM B-B3 primer (TGCAGCATTGTTAGCAGGAT), 0.4 μM B-LF primer (GGACTGAGATCTTTCATTTTACCGT), 0.4 μM B-LB primer (ACTGAGGGAGCCTTGAATACA), 160 units Bst 3.0 DNA polymerase (NEB), optionally, a dilute control template DNA or RNA differing from the target viral sequence, but sharing all primer binding sites, water.

    Techniques: Sequencing, Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Standard Deviation

    Mutations in the transmembrane region  increase the proportion of  Ctm PrP, and reveal that this  form is slightly larger than  Sec PrP. mRNA encoding  wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte  lysate supplemented with canine pancreatic microsomes. Aliquots of the  reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or  without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or  absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples  were then analyzed by SDS-PAGE and autoradiography. Note the presence  of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7,  corresponding to  Sec PrP (white arrowheads) and  Ctm PrP (shaded arrowheads). The protease-protected  forms of  Sec PrP and  Ctm PrP are indicated by the  white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular  size markers are given in kilodaltons.

    Journal: Molecular Biology of the Cell

    Article Title: A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm

    doi:

    Figure Lengend Snippet: Mutations in the transmembrane region increase the proportion of Ctm PrP, and reveal that this form is slightly larger than Sec PrP. mRNA encoding wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte lysate supplemented with canine pancreatic microsomes. Aliquots of the reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples were then analyzed by SDS-PAGE and autoradiography. Note the presence of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7, corresponding to Sec PrP (white arrowheads) and Ctm PrP (shaded arrowheads). The protease-protected forms of Sec PrP and Ctm PrP are indicated by the white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular size markers are given in kilodaltons.

    Article Snippet: To test the glycosidase sensitivity of PrP, lysates of transfected cells prepared in 0.5% Triton X-100, 0.5% deoxycholate, 50 mM Tris-HCl (pH 7.5) were treated with endoglycosidase H ( New England Biolabs ) or PNGase F according to the manufacturer's directions before methanol precipitation and Western blotting with 3F4.

    Techniques: Size-exclusion Chromatography, Incubation, SDS Page, Autoradiography

    Ability of mutant Rep proteins to introduce ITR plasmid into AAVS1. Two micrograms of pCMVR78, mutant Rep expression plasmids, or blank vector was transfected into 2 × 10 5  293 cells/well in six-well plates along with 2 μg of pW1, harboring a  lacZ  expression cassette flanked by ITRs, by a standard calcium phosphate precipitation method. Twenty-four hours later, total cellular DNA was isolated and suspended finally in 200 μl of TE. PCR to detect site-specific integration was carried out as reported previously with minor modifications: 1 μl of isolated genomic DNA was subjected to a thermal cycling reaction in a 20-μl reaction mixture containing 1× thermophilic DNA polymerase buffer [10 mM KCl, 20 mM Tris-HCl (pH 8.8), 10 mM (NH 4 ) 2 SO 4 , 4 mM MgSO 4 , 0.1% Triton X-100 (NEB)], 1 μM 5′-CGGCCTCAGTGAGCGAGCGAGC and 5′-CGGGGAGGATCCGCTCAGAGGACA, and 2 U of Deep Vent Exo(−) DNA polymerase (NEB). The cycling conditions were 99°C for 1 min followed by 35 cycles of 99°C for 10 s and 72°C for 4 min. Ten microliters of the PCR mixture was transferred to a hybridization membrane (Hybond-N + ; Amersham) by using a dot blot apparatus and hybridized with a  32 P-labeled AAVS1 probe. The membranes were then analyzed on a BAS-1500 imaging analyzer. The assay was repeated at least four times. p, positive control for hybridization.

    Journal: Journal of Virology

    Article Title: Charged-to-Alanine Scanning Mutagenesis of the N-Terminal Half of Adeno-Associated Virus Type 2 Rep78 Protein

    doi:

    Figure Lengend Snippet: Ability of mutant Rep proteins to introduce ITR plasmid into AAVS1. Two micrograms of pCMVR78, mutant Rep expression plasmids, or blank vector was transfected into 2 × 10 5 293 cells/well in six-well plates along with 2 μg of pW1, harboring a lacZ expression cassette flanked by ITRs, by a standard calcium phosphate precipitation method. Twenty-four hours later, total cellular DNA was isolated and suspended finally in 200 μl of TE. PCR to detect site-specific integration was carried out as reported previously with minor modifications: 1 μl of isolated genomic DNA was subjected to a thermal cycling reaction in a 20-μl reaction mixture containing 1× thermophilic DNA polymerase buffer [10 mM KCl, 20 mM Tris-HCl (pH 8.8), 10 mM (NH 4 ) 2 SO 4 , 4 mM MgSO 4 , 0.1% Triton X-100 (NEB)], 1 μM 5′-CGGCCTCAGTGAGCGAGCGAGC and 5′-CGGGGAGGATCCGCTCAGAGGACA, and 2 U of Deep Vent Exo(−) DNA polymerase (NEB). The cycling conditions were 99°C for 1 min followed by 35 cycles of 99°C for 10 s and 72°C for 4 min. Ten microliters of the PCR mixture was transferred to a hybridization membrane (Hybond-N + ; Amersham) by using a dot blot apparatus and hybridized with a 32 P-labeled AAVS1 probe. The membranes were then analyzed on a BAS-1500 imaging analyzer. The assay was repeated at least four times. p, positive control for hybridization.

    Article Snippet: One microliter of isolated genomic DNA was subjected to a thermal cycling reaction in a 20-μl reaction mixture containing 1× thermophilic DNA polymerase buffer [10 mM KCl, 20 mM Tris-HCl (pH 8.8), 10 mM (NH4 )2 SO4 , 4 mM MgSO4 , 0.1% Triton X-100 (New England Biolabs {NEB})], 1 μM 5′-CGGCCTCAGTGAGCGAGCGAGC and 5′-CGGGGAGGATCCGCTCAGAGGACA, and 2 U of Deep Vent Exo(−) DNA polymerase (NEB).

    Techniques: Mutagenesis, Introduce, Plasmid Preparation, Expressing, Transfection, Isolation, Polymerase Chain Reaction, Hybridization, Dot Blot, Labeling, Imaging, Positive Control

    The formulation and characterization of RBC-nanogels. (A) RBC-nanogels loaded with rhodamine B were formulated and subjected to (i) no treatment, (ii) treated with Triton X-100 and proteinase K, or (iii) Triton X-100 and proteinase K followed by tris(2-carboxyethyl) phosphine (TCEP). The RBC-nanogels were then filtered to collect the released dye, which was further measured by a UV-vis spectrophotometer. (B) A representative TEM image of RBC-nanogels (scale bar = 100 nm). (C) Dynamic light scattering (DLS) measurements of the size and size distribution of RBC-vesicles, RBC-nanogels, and non-responsive RBC nanogels (Control nanogels) subjected to the same treatment as in (A).

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Erythrocyte membrane-coated nanogel for combinatorial antivirulence and responsive antimicrobial delivery against Staphylococcus aureus infection

    doi: 10.1016/j.jconrel.2017.01.016

    Figure Lengend Snippet: The formulation and characterization of RBC-nanogels. (A) RBC-nanogels loaded with rhodamine B were formulated and subjected to (i) no treatment, (ii) treated with Triton X-100 and proteinase K, or (iii) Triton X-100 and proteinase K followed by tris(2-carboxyethyl) phosphine (TCEP). The RBC-nanogels were then filtered to collect the released dye, which was further measured by a UV-vis spectrophotometer. (B) A representative TEM image of RBC-nanogels (scale bar = 100 nm). (C) Dynamic light scattering (DLS) measurements of the size and size distribution of RBC-vesicles, RBC-nanogels, and non-responsive RBC nanogels (Control nanogels) subjected to the same treatment as in (A).

    Article Snippet: Following the nanogel synthesis, samples were added with 0.25 mL 5% w/v Triton X-100 and 20 µg proteinase K (New England Biolabs, Inc., Beverly, USA) to dissolve RBC membranes.

    Techniques: Spectrophotometry, Transmission Electron Microscopy

    The cumulative release profiles of vancomycin from (A) RBC-nanogels and (B) non-responsive RBC-nanogels (Control nanogels). The nanogels were treated with Triton X-100, treated with Triton X-100 followed by TCEP, or not treated by anything.

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    Article Title: Erythrocyte membrane-coated nanogel for combinatorial antivirulence and responsive antimicrobial delivery against Staphylococcus aureus infection

    doi: 10.1016/j.jconrel.2017.01.016

    Figure Lengend Snippet: The cumulative release profiles of vancomycin from (A) RBC-nanogels and (B) non-responsive RBC-nanogels (Control nanogels). The nanogels were treated with Triton X-100, treated with Triton X-100 followed by TCEP, or not treated by anything.

    Article Snippet: Following the nanogel synthesis, samples were added with 0.25 mL 5% w/v Triton X-100 and 20 µg proteinase K (New England Biolabs, Inc., Beverly, USA) to dissolve RBC membranes.

    Techniques: