triton x 100  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    New England Biolabs triton x 100
    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Triton X 100, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/triton x 100/product/New England Biolabs
    Average 93 stars, based on 49 article reviews
    Price from $9.99 to $1999.99
    triton x 100 - by Bioz Stars, 2020-09
    93/100 stars

    Images

    1) Product Images from "LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space"

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space

    Journal: bioRxiv

    doi: 10.1101/2020.04.06.025635

    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Figure Legend Snippet: Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Techniques Used: Sequencing, Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Standard Deviation

    2) Product Images from "A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm"

    Article Title: A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm

    Journal: Molecular Biology of the Cell

    doi:

    Mutations in the transmembrane region  increase the proportion of  Ctm PrP, and reveal that this  form is slightly larger than  Sec PrP. mRNA encoding  wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte  lysate supplemented with canine pancreatic microsomes. Aliquots of the  reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or  without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or  absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples  were then analyzed by SDS-PAGE and autoradiography. Note the presence  of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7,  corresponding to  Sec PrP (white arrowheads) and  Ctm PrP (shaded arrowheads). The protease-protected  forms of  Sec PrP and  Ctm PrP are indicated by the  white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular  size markers are given in kilodaltons.
    Figure Legend Snippet: Mutations in the transmembrane region increase the proportion of Ctm PrP, and reveal that this form is slightly larger than Sec PrP. mRNA encoding wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte lysate supplemented with canine pancreatic microsomes. Aliquots of the reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples were then analyzed by SDS-PAGE and autoradiography. Note the presence of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7, corresponding to Sec PrP (white arrowheads) and Ctm PrP (shaded arrowheads). The protease-protected forms of Sec PrP and Ctm PrP are indicated by the white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular size markers are given in kilodaltons.

    Techniques Used: Size-exclusion Chromatography, Incubation, SDS Page, Autoradiography

    3) Product Images from "Erythrocyte membrane-coated nanogel for combinatorial antivirulence and responsive antimicrobial delivery against Staphylococcus aureus infection"

    Article Title: Erythrocyte membrane-coated nanogel for combinatorial antivirulence and responsive antimicrobial delivery against Staphylococcus aureus infection

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    doi: 10.1016/j.jconrel.2017.01.016

    The formulation and characterization of RBC-nanogels. (A) RBC-nanogels loaded with rhodamine B were formulated and subjected to (i) no treatment, (ii) treated with Triton X-100 and proteinase K, or (iii) Triton X-100 and proteinase K followed by tris(2-carboxyethyl) phosphine (TCEP). The RBC-nanogels were then filtered to collect the released dye, which was further measured by a UV-vis spectrophotometer. (B) A representative TEM image of RBC-nanogels (scale bar = 100 nm). (C) Dynamic light scattering (DLS) measurements of the size and size distribution of RBC-vesicles, RBC-nanogels, and non-responsive RBC nanogels (Control nanogels) subjected to the same treatment as in (A).
    Figure Legend Snippet: The formulation and characterization of RBC-nanogels. (A) RBC-nanogels loaded with rhodamine B were formulated and subjected to (i) no treatment, (ii) treated with Triton X-100 and proteinase K, or (iii) Triton X-100 and proteinase K followed by tris(2-carboxyethyl) phosphine (TCEP). The RBC-nanogels were then filtered to collect the released dye, which was further measured by a UV-vis spectrophotometer. (B) A representative TEM image of RBC-nanogels (scale bar = 100 nm). (C) Dynamic light scattering (DLS) measurements of the size and size distribution of RBC-vesicles, RBC-nanogels, and non-responsive RBC nanogels (Control nanogels) subjected to the same treatment as in (A).

    Techniques Used: Spectrophotometry, Transmission Electron Microscopy

    The cumulative release profiles of vancomycin from (A) RBC-nanogels and (B) non-responsive RBC-nanogels (Control nanogels). The nanogels were treated with Triton X-100, treated with Triton X-100 followed by TCEP, or not treated by anything.
    Figure Legend Snippet: The cumulative release profiles of vancomycin from (A) RBC-nanogels and (B) non-responsive RBC-nanogels (Control nanogels). The nanogels were treated with Triton X-100, treated with Triton X-100 followed by TCEP, or not treated by anything.

    Techniques Used:

    4) Product Images from "Receptor palmitoylation and ubiquitination regulate anthrax toxin endocytosis"

    Article Title: Receptor palmitoylation and ubiquitination regulate anthrax toxin endocytosis

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200507067

    Palmitoylation events are required for DRM association and internalization of PA.  (A and B) Control BHK cells were pretreated or untreated with bromopalmitate and were incubated with 500 ng/ml nicked PA63 and 20 ng/ml aerolysin for 1 h at 4°C followed by 10 min at 37°C. (A) Cell extracts were submitted to SDS-PAGE followed by Western blotting to reveal PA63, aerolysin, and caveolin-1 (Cav-1). (B) Cells were solubilized in 1% Triton X-100, run on an OptiPrep gradient, and each fraction was analyzed by SDS-PAGE followed by Western blotting against PA, aerolysin, and caveolin-1. (C) BHK cells were pretreated with bromopalmitate and incubated with 500 ng/ml nicked PA63 for 1 h at 4°C followed by different times at 37°C. Cell extracts (40 μg of protein) were analyzed by SDS-PAGE and Western blotting to reveal the SDS-resistant PA 7mer  pore and MEK1 (NH 2 -terminal directed). To detect the prepore (SDS-sensitive nonmembrane-inserted PA 7mer ), cell extracts were submitted to an acid pulse before SDS analysis.
    Figure Legend Snippet: Palmitoylation events are required for DRM association and internalization of PA. (A and B) Control BHK cells were pretreated or untreated with bromopalmitate and were incubated with 500 ng/ml nicked PA63 and 20 ng/ml aerolysin for 1 h at 4°C followed by 10 min at 37°C. (A) Cell extracts were submitted to SDS-PAGE followed by Western blotting to reveal PA63, aerolysin, and caveolin-1 (Cav-1). (B) Cells were solubilized in 1% Triton X-100, run on an OptiPrep gradient, and each fraction was analyzed by SDS-PAGE followed by Western blotting against PA, aerolysin, and caveolin-1. (C) BHK cells were pretreated with bromopalmitate and incubated with 500 ng/ml nicked PA63 for 1 h at 4°C followed by different times at 37°C. Cell extracts (40 μg of protein) were analyzed by SDS-PAGE and Western blotting to reveal the SDS-resistant PA 7mer pore and MEK1 (NH 2 -terminal directed). To detect the prepore (SDS-sensitive nonmembrane-inserted PA 7mer ), cell extracts were submitted to an acid pulse before SDS analysis.

    Techniques Used: Incubation, SDS Page, Western Blot

    Endocytosis of anthrax toxin receptor requires DRM-mediated ubiquitination and the E3 ligase Cbl.  (A) CHO ΔATR  cells transfected for 48 h with WT TEM8/1-HA were incubated with 1 μg/ml PA83 for 1 h at 4°C followed by 40 min at 37°C, solubilized in Triton X-100 at 4°C, and separated on an OptiPrep gradient. TEM8/1-HA was immunoprecipitated from each fraction and analyzed by SDS-PAGE and Western blotting using anti-Ub, anti-HA, and anti-PA antibodies. (B) CHO ΔATR  cells transfected for 48 h with WT TEM8/1-HA were treated with βMCD to extract cholesterol, incubated with 1 μg/ml PA83 for 1 h at 4°C, and shifted for different times at 37°C. After immunoprecipitation with anti-HA beads, samples were analyzed by Western blotting using anti-Ub and anti-HA antibodies. (C) HeLa cells were transfected or untransfected with siRNAs against Cbl for 72 h and incubated with 500 ng/ml PA83 for different times at 37°C. Cell extracts were blotted for Cbl, tubulin (as an equal loading marker), and PA. (D) HeLa cells were untransfected or transfected with siRNAs against Cbl for a total of 72 h in total. 24 h later, these cells were additionally transfected with TEM8/1-HA for 48 h and incubated with 500 ng/ml PA83 for different times at 37°C. TEM8/1-HA was immunoprecipitated from each fraction and analyzed by SDS-PAGE and Western blotting using anti-Ub and anti-HA antibodies.
    Figure Legend Snippet: Endocytosis of anthrax toxin receptor requires DRM-mediated ubiquitination and the E3 ligase Cbl. (A) CHO ΔATR cells transfected for 48 h with WT TEM8/1-HA were incubated with 1 μg/ml PA83 for 1 h at 4°C followed by 40 min at 37°C, solubilized in Triton X-100 at 4°C, and separated on an OptiPrep gradient. TEM8/1-HA was immunoprecipitated from each fraction and analyzed by SDS-PAGE and Western blotting using anti-Ub, anti-HA, and anti-PA antibodies. (B) CHO ΔATR cells transfected for 48 h with WT TEM8/1-HA were treated with βMCD to extract cholesterol, incubated with 1 μg/ml PA83 for 1 h at 4°C, and shifted for different times at 37°C. After immunoprecipitation with anti-HA beads, samples were analyzed by Western blotting using anti-Ub and anti-HA antibodies. (C) HeLa cells were transfected or untransfected with siRNAs against Cbl for 72 h and incubated with 500 ng/ml PA83 for different times at 37°C. Cell extracts were blotted for Cbl, tubulin (as an equal loading marker), and PA. (D) HeLa cells were untransfected or transfected with siRNAs against Cbl for a total of 72 h in total. 24 h later, these cells were additionally transfected with TEM8/1-HA for 48 h and incubated with 500 ng/ml PA83 for different times at 37°C. TEM8/1-HA was immunoprecipitated from each fraction and analyzed by SDS-PAGE and Western blotting using anti-Ub and anti-HA antibodies.

    Techniques Used: Transfection, Incubation, Immunoprecipitation, SDS Page, Western Blot, Marker

    5) Product Images from "Expansion Sequencing: Spatially Precise In Situ Transcriptomics in Intact Biological Systems"

    Article Title: Expansion Sequencing: Spatially Precise In Situ Transcriptomics in Intact Biological Systems

    Journal: bioRxiv

    doi: 10.1101/2020.05.13.094268

    Demonstration of untargeted ExSeq with C. elegans (A), a Drosophila embryo (B) and the HeLa human cell lin e (C). The first in situ sequencing round is shown and the different colors (blue, magenta, green, and red) reveal the current base of the amplified cDNA (SOLiD sequencing was used). Scale bars: 20, 10 and 30 microns for panels A, B and C, respectively, in post-expansion (e.g., actual size) units. Methods used to generate this figure: Worm fixation and cuticle reduction was adopted from the published Bouin’s tube fixation protocol (  127 ). The strain used in the figure was CZ1632: juIs76 [unc-25p::GFP + lin-15(+)] II. The strain was maintained at 20°C under standard conditions (  128 ). The worms were collected from agar plates with M9 buffer (3g KH 2 PO 4 , 6g Na 2 HPO 4 , 5g NaCl, 1ml 1M MgSO 4 , water to 1 liter, sterilized by autoclaving) into a 15 mL tube. The tube was spun down at 1000g for 2 min, and the supernatant was replaced with 10 mL of fresh M9. The M9 wash step was repeated 2 more times. The worms were then transferred to a 1.5 mL tube and spun down to remove as much supernatant as possible without disturbing the worm pellet. The worms were placed on ice for 5 min. 1 mL of Bouin’s Fixative (0.46% picric acid, 4.4% paraformaldehyde, 2.4% acetic acid, 50% methanol, 1.2% 2-mercaptoethanol; as prepared in the published protocol), prepared fresh and pre-chilled to 4°C, was then added. The pellet was resuspended and mixed well. The sample was then placed on a tube rotator and mixed vigorously for 30 min at 25°C, followed by 4 hours of incubation at 4°C. The sample was then washed 3 times with 1mL Borate Triton β-mercaptoethanol solution (BTB; see recipe below); each time the sample was spun down, the supernatant was removed, the buffer was added and the sample was mixed thoroughly. BTB was prepared fresh using 1 mL 40x Borate Buffer Stock (3.1g boric acid, 1g NaOH, water to 50 mL), 1 mL 20% Triton X-100, 0.8 mL 2-mercaptoethanol, and 37.2 mL water. The sample was then further incubated three times, for 1 hour each, in 1 mL fresh BTB on a tube rotator at 25°C. Finally, the sample was washed six times: twice with 1 mL BT (1 mL 40x Borate Buffer Stock, 1 mL 20% Triton X-100, 38 mL water), twice with 1 mL 1x PBST (1x PBS, 0.5% Triton X-100), and twice with 1x PBS. The worms were permeabilized for 1 hour with 0.25% Triton X-100 in 1X PBS at 25°C. Drosophila larvae w1118 (BL#5905) were kindly provided by the lab of Aravinthan DT Samuel (Harvard University). Drosophila were raised in vials or bottles with standard yeast-containing medium at 22°C with alternating 12-h cycles of dark and light. HeLa (ATCC CCL-2) cells were cultured on CultureWell Chambered 16 wells Coverglass (Invitrogen) in D10 medium (Cellgro) supplemented with 10% fetal bovine serum (FBS) (Invitrogen), 1% penicillin–streptomycin (Cellgro), and 1% sodium pyruvate (BioWhittaker). Cultured cells were washed once with DPBS (Cellgro), fixed with 10% formalin in PBS for 15 min at 25°C, and washed three times with 1× PBS. Fixed cells were then stored in 70% ethanol at 4°C until use. ExSeq experimental procedures for the worms, Drosophila and HeLa cells were performed according to the following  Methods  sections: ‘RNA anchoring’, ‘Gelling, digestion and expansion’, ‘Re-embedding’, ‘Passivation’, and ‘Library preparation for  in situ  sequencing’. For the reverse transcription, instead of SSIV, M-MuLV (10U/µl; Enzymatics, cat. no. P7040L) was used for the worms and HeLa cells, whereas Maxima (10U/µl; Thermo Scientific, cat. no. EP0741) was used for Drosophila. Aminoallyl-dUTP was not included in the reverse transcription mix (and therefore the cDNA were not formalin-fixed), and the following primer sequence was used: /5Phos/ACTTCAGCTGCCCCGGGTGAAGANNNNNNNN. For the worms and HeLa cells, 2U/µl CircLigase II were used for circularization. To account for possible self-circularization of the primers, control samples with no reverse transcription enzyme were also processed for the worms, Drosophila, and HeLa cells, and as expected produced only a weak signal with hybridization probe after the library preparation.  In situ  sequencing was performed manually using the reagents and the enzymatic reactions outlined in the  Methods  section ‘Automated  in situ  sequencing’. Imaging was performed on a Zeiss Laser Scanning Confocal (LSM710) with Nikon 40X CFI Apo, water immersion with long working distance, NA 1.15 objective, and excitation light sources and emission filters as in (  23 ).
    Figure Legend Snippet: Demonstration of untargeted ExSeq with C. elegans (A), a Drosophila embryo (B) and the HeLa human cell lin e (C). The first in situ sequencing round is shown and the different colors (blue, magenta, green, and red) reveal the current base of the amplified cDNA (SOLiD sequencing was used). Scale bars: 20, 10 and 30 microns for panels A, B and C, respectively, in post-expansion (e.g., actual size) units. Methods used to generate this figure: Worm fixation and cuticle reduction was adopted from the published Bouin’s tube fixation protocol ( 127 ). The strain used in the figure was CZ1632: juIs76 [unc-25p::GFP + lin-15(+)] II. The strain was maintained at 20°C under standard conditions ( 128 ). The worms were collected from agar plates with M9 buffer (3g KH 2 PO 4 , 6g Na 2 HPO 4 , 5g NaCl, 1ml 1M MgSO 4 , water to 1 liter, sterilized by autoclaving) into a 15 mL tube. The tube was spun down at 1000g for 2 min, and the supernatant was replaced with 10 mL of fresh M9. The M9 wash step was repeated 2 more times. The worms were then transferred to a 1.5 mL tube and spun down to remove as much supernatant as possible without disturbing the worm pellet. The worms were placed on ice for 5 min. 1 mL of Bouin’s Fixative (0.46% picric acid, 4.4% paraformaldehyde, 2.4% acetic acid, 50% methanol, 1.2% 2-mercaptoethanol; as prepared in the published protocol), prepared fresh and pre-chilled to 4°C, was then added. The pellet was resuspended and mixed well. The sample was then placed on a tube rotator and mixed vigorously for 30 min at 25°C, followed by 4 hours of incubation at 4°C. The sample was then washed 3 times with 1mL Borate Triton β-mercaptoethanol solution (BTB; see recipe below); each time the sample was spun down, the supernatant was removed, the buffer was added and the sample was mixed thoroughly. BTB was prepared fresh using 1 mL 40x Borate Buffer Stock (3.1g boric acid, 1g NaOH, water to 50 mL), 1 mL 20% Triton X-100, 0.8 mL 2-mercaptoethanol, and 37.2 mL water. The sample was then further incubated three times, for 1 hour each, in 1 mL fresh BTB on a tube rotator at 25°C. Finally, the sample was washed six times: twice with 1 mL BT (1 mL 40x Borate Buffer Stock, 1 mL 20% Triton X-100, 38 mL water), twice with 1 mL 1x PBST (1x PBS, 0.5% Triton X-100), and twice with 1x PBS. The worms were permeabilized for 1 hour with 0.25% Triton X-100 in 1X PBS at 25°C. Drosophila larvae w1118 (BL#5905) were kindly provided by the lab of Aravinthan DT Samuel (Harvard University). Drosophila were raised in vials or bottles with standard yeast-containing medium at 22°C with alternating 12-h cycles of dark and light. HeLa (ATCC CCL-2) cells were cultured on CultureWell Chambered 16 wells Coverglass (Invitrogen) in D10 medium (Cellgro) supplemented with 10% fetal bovine serum (FBS) (Invitrogen), 1% penicillin–streptomycin (Cellgro), and 1% sodium pyruvate (BioWhittaker). Cultured cells were washed once with DPBS (Cellgro), fixed with 10% formalin in PBS for 15 min at 25°C, and washed three times with 1× PBS. Fixed cells were then stored in 70% ethanol at 4°C until use. ExSeq experimental procedures for the worms, Drosophila and HeLa cells were performed according to the following Methods sections: ‘RNA anchoring’, ‘Gelling, digestion and expansion’, ‘Re-embedding’, ‘Passivation’, and ‘Library preparation for in situ sequencing’. For the reverse transcription, instead of SSIV, M-MuLV (10U/µl; Enzymatics, cat. no. P7040L) was used for the worms and HeLa cells, whereas Maxima (10U/µl; Thermo Scientific, cat. no. EP0741) was used for Drosophila. Aminoallyl-dUTP was not included in the reverse transcription mix (and therefore the cDNA were not formalin-fixed), and the following primer sequence was used: /5Phos/ACTTCAGCTGCCCCGGGTGAAGANNNNNNNN. For the worms and HeLa cells, 2U/µl CircLigase II were used for circularization. To account for possible self-circularization of the primers, control samples with no reverse transcription enzyme were also processed for the worms, Drosophila, and HeLa cells, and as expected produced only a weak signal with hybridization probe after the library preparation. In situ sequencing was performed manually using the reagents and the enzymatic reactions outlined in the Methods section ‘Automated in situ sequencing’. Imaging was performed on a Zeiss Laser Scanning Confocal (LSM710) with Nikon 40X CFI Apo, water immersion with long working distance, NA 1.15 objective, and excitation light sources and emission filters as in ( 23 ).

    Techniques Used: In Situ, Sequencing, Amplification, Incubation, Cell Culture, Produced, Hybridization, Imaging

    6) Product Images from "Synthesis of Nanogels via Cell Membrane-Templated Polymerization"

    Article Title: Synthesis of Nanogels via Cell Membrane-Templated Polymerization

    Journal: Small (Weinheim an der Bergstrasse, Germany)

    doi: 10.1002/smll.201500987

    Confirming the formation of RBC membrane-coated nanogels. (A) Representative TEM images RBC membrane-coated nanogels and the nanogel cores after the treatment with Triton X-100 and proteinase K (scale bar = 100 nm). (B) RBC membrane-derived vesicles and
    Figure Legend Snippet: Confirming the formation of RBC membrane-coated nanogels. (A) Representative TEM images RBC membrane-coated nanogels and the nanogel cores after the treatment with Triton X-100 and proteinase K (scale bar = 100 nm). (B) RBC membrane-derived vesicles and

    Techniques Used: Transmission Electron Microscopy, Derivative Assay

    7) Product Images from "Enterohemorrhagic Escherichia coli O157:H7 Produces Tir, Which Is Translocated to the Host Cell Membrane but Is Not Tyrosine Phosphorylated"

    Article Title: Enterohemorrhagic Escherichia coli O157:H7 Produces Tir, Which Is Translocated to the Host Cell Membrane but Is Not Tyrosine Phosphorylated

    Journal: Infection and Immunity

    doi:

    EHEC Tir is translocated to the host cell but not tyrosine phosphorylated. HeLa cells were infected with either EHEC UMD619 or EPEC CVD206, and Triton X-100-soluble membrane fractions were prepared, treated with alkaline phosphatase (Alk Phos), and resolved by SDS–8% PAGE. After being blotted to nitrocellulose, the samples were probed with anti-EHEC Tir (a), anti-EPEC Tir (b), or anti-PY (c) antisera. Molecular mass markers are in kilodaltons.
    Figure Legend Snippet: EHEC Tir is translocated to the host cell but not tyrosine phosphorylated. HeLa cells were infected with either EHEC UMD619 or EPEC CVD206, and Triton X-100-soluble membrane fractions were prepared, treated with alkaline phosphatase (Alk Phos), and resolved by SDS–8% PAGE. After being blotted to nitrocellulose, the samples were probed with anti-EHEC Tir (a), anti-EPEC Tir (b), or anti-PY (c) antisera. Molecular mass markers are in kilodaltons.

    Techniques Used: Infection, Polyacrylamide Gel Electrophoresis

    Related Articles

    Transfection:

    Article Title: A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm
    Article Snippet: .. To test the glycosidase sensitivity of PrP, lysates of transfected cells prepared in 0.5% Triton X-100, 0.5% deoxycholate, 50 mM Tris-HCl (pH 7.5) were treated with endoglycosidase H ( New England Biolabs ) or PNGase F according to the manufacturer's directions before methanol precipitation and Western blotting with 3F4. .. To test the effect of proteasome inhibitors, transfected cells were treated for 18 h with 20 μM of Z-Ile-Glu(OtBu)-Ala-Leu-CHO (proteasome inhibitor 1 [PSI 1]; Calbiochem, San Diego, CA).

    Amplification:

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space
    Article Snippet: .. Suggested Protocol A fresh swab sample is inserted into a 500 μ l RT-LAMP reaction, containing the following components: 1x Isothermal Amplification buffer (NEB), 6 mM MgSO4 , 1.4 mM dNTP mix, 0.5 μ l Triton X-100 (amount to be optimized), 1.6 μM total of a unique set of one to five barcoded FIP primers (B-FIP-Barcode, TCTGGCCCAGTTCCTAGGTAGT NNNNNNNNNN CCAGACGAATTCGTGGTGG), where Ns denote a specific barcode sequence, 1.6 μM B-BIP primer (AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT), 0.2 μM B-F3 primer (TGGCTACTACCGAAGAGCT), 0.2 μM B-B3 primer (TGCAGCATTGTTAGCAGGAT), 0.4 μM B-LF primer (GGACTGAGATCTTTCATTTTACCGT), 0.4 μM B-LB primer (ACTGAGGGAGCCTTGAATACA), 160 units Bst 3.0 DNA polymerase (NEB), optionally, a dilute control template DNA or RNA differing from the target viral sequence, but sharing all primer binding sites, water. ..

    Ligation:

    Article Title: Development and Evaluation of Isothermal Amplification Methods for Rapid Detection of Lethal Amanita Species
    Article Snippet: .. HRCA Reaction and Product Detection The ligation was carried out in a 10 μL mixture containing: 1 × Taq DNA ligase buffer (20 mM Tris–HCl, 25 mM KAc, 10 mM Mg(Ac)2 , 10 mM DTT, 1 mM NAD, 0.1% Triton X-100), 10 pM linear padlock probe, 12 U of Taq DNA ligase (NEB, United States) and 1 μL of DNA template (10 ng). .. The ligation mixture was incubated at 65°C for 1 h. After ligation, 1 μL of ligation product was added into an HRCA reaction mixture containing 1 × ThermoPol buffer (20 mM Tris–HCl, 10 mM (NH4 )2 SO4 , 10 mM KCl, 2 mM MgSO4 , 0.1% Triton X-100), 0.4 mM dNTP mix, 0.5 μM of each HRCA primers and 1.6 U Bst DNA polymerase (NEB, United States) with a total 10 μL volume.

    Modification:

    Article Title: Expansion Sequencing: Spatially Precise In Situ Transcriptomics in Intact Biological Systems
    Article Snippet: .. The digestion buffer was modified to include guanidine hydrochloride; final composition 50 mM Tris pH 8.0, 1 mM EDTA, 0.5% Triton X-100, 0.8 M guanidine hydrochloride, 8 U/mL Proteinase-K (NEB). ..

    Incubation:

    Article Title: Receptor palmitoylation and ubiquitination regulate anthrax toxin endocytosis
    Article Snippet: .. For N -deglycosylation, cell extracts were boiled for 5 min with 1% SDS and 1% β-mercaptoethanol, diluted fivefold in 40 mM phosphate buffer, pH 7.0, containing 10 mM EDTA, 1% Triton X-100, 2.5 mM PMSF, and 1% β-mercaptoethanol, and were incubated for 16 h at 37°C with 10 U/ml N -glycosidase F. Endo H treatment was performed according to the manufacturer's instructions (New England Biolabs, Inc.). .. Palmitoylation was inhibited by pretreating cells with 100 μM 2-bromopalmitate (Sigma-Aldrich) for 1 h at 37°C .

    Sequencing:

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space
    Article Snippet: .. Suggested Protocol A fresh swab sample is inserted into a 500 μ l RT-LAMP reaction, containing the following components: 1x Isothermal Amplification buffer (NEB), 6 mM MgSO4 , 1.4 mM dNTP mix, 0.5 μ l Triton X-100 (amount to be optimized), 1.6 μM total of a unique set of one to five barcoded FIP primers (B-FIP-Barcode, TCTGGCCCAGTTCCTAGGTAGT NNNNNNNNNN CCAGACGAATTCGTGGTGG), where Ns denote a specific barcode sequence, 1.6 μM B-BIP primer (AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT), 0.2 μM B-F3 primer (TGGCTACTACCGAAGAGCT), 0.2 μM B-B3 primer (TGCAGCATTGTTAGCAGGAT), 0.4 μM B-LF primer (GGACTGAGATCTTTCATTTTACCGT), 0.4 μM B-LB primer (ACTGAGGGAGCCTTGAATACA), 160 units Bst 3.0 DNA polymerase (NEB), optionally, a dilute control template DNA or RNA differing from the target viral sequence, but sharing all primer binding sites, water. ..

    Western Blot:

    Article Title: A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm
    Article Snippet: .. To test the glycosidase sensitivity of PrP, lysates of transfected cells prepared in 0.5% Triton X-100, 0.5% deoxycholate, 50 mM Tris-HCl (pH 7.5) were treated with endoglycosidase H ( New England Biolabs ) or PNGase F according to the manufacturer's directions before methanol precipitation and Western blotting with 3F4. .. To test the effect of proteasome inhibitors, transfected cells were treated for 18 h with 20 μM of Z-Ile-Glu(OtBu)-Ala-Leu-CHO (proteasome inhibitor 1 [PSI 1]; Calbiochem, San Diego, CA).

    Binding Assay:

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space
    Article Snippet: .. Suggested Protocol A fresh swab sample is inserted into a 500 μ l RT-LAMP reaction, containing the following components: 1x Isothermal Amplification buffer (NEB), 6 mM MgSO4 , 1.4 mM dNTP mix, 0.5 μ l Triton X-100 (amount to be optimized), 1.6 μM total of a unique set of one to five barcoded FIP primers (B-FIP-Barcode, TCTGGCCCAGTTCCTAGGTAGT NNNNNNNNNN CCAGACGAATTCGTGGTGG), where Ns denote a specific barcode sequence, 1.6 μM B-BIP primer (AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT), 0.2 μM B-F3 primer (TGGCTACTACCGAAGAGCT), 0.2 μM B-B3 primer (TGCAGCATTGTTAGCAGGAT), 0.4 μM B-LF primer (GGACTGAGATCTTTCATTTTACCGT), 0.4 μM B-LB primer (ACTGAGGGAGCCTTGAATACA), 160 units Bst 3.0 DNA polymerase (NEB), optionally, a dilute control template DNA or RNA differing from the target viral sequence, but sharing all primer binding sites, water. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    New England Biolabs triton x 100
    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.
    Triton X 100, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 93/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/triton x 100/product/New England Biolabs
    Average 93 stars, based on 50 article reviews
    Price from $9.99 to $1999.99
    triton x 100 - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25  μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Journal: bioRxiv

    Article Title: LAMP-Seq: Population-Scale COVID-19 Diagnostics Using a Compressed Barcode Space

    doi: 10.1101/2020.04.06.025635

    Figure Lengend Snippet: Scalable deep-sequencing based approach for SARS-CoV-2 detection. (A) Schematic outline of a proposed scalable testing procedure. (B) Schematic of anticipated enzymatic reactions and reaction products. (C) Schematic illustration of a compressed barcode space allowing unique identification of millions of samples while minimizing barcode primer logistics. (D) Experimental validation of LAMP-Seq. All steps were performed as described in the Suggested Protocol section, with the exception that plasmid DNA containing the SARS-CoV-2 N-gene (IDT) was used as template instead of a swab sample, 1 ng/ μ l pX330 plasmid DNA was present as unspecific decoy DNA, 1x WarmStart LAMP Master Mix (NEB) was used instead of buffer, MgSO 4 , dNTPs, Triton X-100, and polymerase, and the reaction was scaled down to a volume of 25 μ l. Samples were run on an 1% agarose gel and visualized using ethidium bromide. (E) Barcoded LAMP reactions templated with either 100 or 10,000 dsDNA molecules were combined after heat inactivation, PCR amplified, and sequenced on an Illumina MiSeq sequencer. Relative read counts with respect to template amounts are shown as mean and standard deviation from two experimental replicates. (F) Base frequencies observed by sequencing a barcoded LAMP-Seq amplicon on a MiSeq without applying any read filtering are shown as a color-coded sequence logo.

    Article Snippet: Suggested Protocol A fresh swab sample is inserted into a 500 μ l RT-LAMP reaction, containing the following components: 1x Isothermal Amplification buffer (NEB), 6 mM MgSO4 , 1.4 mM dNTP mix, 0.5 μ l Triton X-100 (amount to be optimized), 1.6 μM total of a unique set of one to five barcoded FIP primers (B-FIP-Barcode, TCTGGCCCAGTTCCTAGGTAGT NNNNNNNNNN CCAGACGAATTCGTGGTGG), where Ns denote a specific barcode sequence, 1.6 μM B-BIP primer (AGACGGCATCATATGGGTTGCACGGGTGCCAATGTGATCT), 0.2 μM B-F3 primer (TGGCTACTACCGAAGAGCT), 0.2 μM B-B3 primer (TGCAGCATTGTTAGCAGGAT), 0.4 μM B-LF primer (GGACTGAGATCTTTCATTTTACCGT), 0.4 μM B-LB primer (ACTGAGGGAGCCTTGAATACA), 160 units Bst 3.0 DNA polymerase (NEB), optionally, a dilute control template DNA or RNA differing from the target viral sequence, but sharing all primer binding sites, water.

    Techniques: Sequencing, Plasmid Preparation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Standard Deviation

    Mutations in the transmembrane region  increase the proportion of  Ctm PrP, and reveal that this  form is slightly larger than  Sec PrP. mRNA encoding  wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte  lysate supplemented with canine pancreatic microsomes. Aliquots of the  reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or  without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or  absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples  were then analyzed by SDS-PAGE and autoradiography. Note the presence  of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7,  corresponding to  Sec PrP (white arrowheads) and  Ctm PrP (shaded arrowheads). The protease-protected  forms of  Sec PrP and  Ctm PrP are indicated by the  white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular  size markers are given in kilodaltons.

    Journal: Molecular Biology of the Cell

    Article Title: A Transmembrane Form of the Prion Protein Contains an Uncleaved Signal Peptide and Is Retained in the Endoplasmic Reticululm

    doi:

    Figure Lengend Snippet: Mutations in the transmembrane region increase the proportion of Ctm PrP, and reveal that this form is slightly larger than Sec PrP. mRNA encoding wild-type (WT), A116V, or 3AV PrP was translated in rabbit reticulocyte lysate supplemented with canine pancreatic microsomes. Aliquots of the reaction were then incubated with (lanes 2, 3, 5, 6, 8, and 9) or without (lanes 1, 4, and 7) PK in the presence (lanes 3, 6, and 9) or absence (lanes 1, 2, 4, 5, 7, and 8) of Triton X-100 (Det). Samples were then analyzed by SDS-PAGE and autoradiography. Note the presence of a closely spaced doublet of glycosylated PrP in lanes 1, 4, and 7, corresponding to Sec PrP (white arrowheads) and Ctm PrP (shaded arrowheads). The protease-protected forms of Sec PrP and Ctm PrP are indicated by the white and shaded arrows, respectively, in lanes 2, 5, and 8. Molecular size markers are given in kilodaltons.

    Article Snippet: To test the glycosidase sensitivity of PrP, lysates of transfected cells prepared in 0.5% Triton X-100, 0.5% deoxycholate, 50 mM Tris-HCl (pH 7.5) were treated with endoglycosidase H ( New England Biolabs ) or PNGase F according to the manufacturer's directions before methanol precipitation and Western blotting with 3F4.

    Techniques: Size-exclusion Chromatography, Incubation, SDS Page, Autoradiography

    Ability of mutant Rep proteins to introduce ITR plasmid into AAVS1. Two micrograms of pCMVR78, mutant Rep expression plasmids, or blank vector was transfected into 2 × 10 5  293 cells/well in six-well plates along with 2 μg of pW1, harboring a  lacZ  expression cassette flanked by ITRs, by a standard calcium phosphate precipitation method. Twenty-four hours later, total cellular DNA was isolated and suspended finally in 200 μl of TE. PCR to detect site-specific integration was carried out as reported previously with minor modifications: 1 μl of isolated genomic DNA was subjected to a thermal cycling reaction in a 20-μl reaction mixture containing 1× thermophilic DNA polymerase buffer [10 mM KCl, 20 mM Tris-HCl (pH 8.8), 10 mM (NH 4 ) 2 SO 4 , 4 mM MgSO 4 , 0.1% Triton X-100 (NEB)], 1 μM 5′-CGGCCTCAGTGAGCGAGCGAGC and 5′-CGGGGAGGATCCGCTCAGAGGACA, and 2 U of Deep Vent Exo(−) DNA polymerase (NEB). The cycling conditions were 99°C for 1 min followed by 35 cycles of 99°C for 10 s and 72°C for 4 min. Ten microliters of the PCR mixture was transferred to a hybridization membrane (Hybond-N + ; Amersham) by using a dot blot apparatus and hybridized with a  32 P-labeled AAVS1 probe. The membranes were then analyzed on a BAS-1500 imaging analyzer. The assay was repeated at least four times. p, positive control for hybridization.

    Journal: Journal of Virology

    Article Title: Charged-to-Alanine Scanning Mutagenesis of the N-Terminal Half of Adeno-Associated Virus Type 2 Rep78 Protein

    doi:

    Figure Lengend Snippet: Ability of mutant Rep proteins to introduce ITR plasmid into AAVS1. Two micrograms of pCMVR78, mutant Rep expression plasmids, or blank vector was transfected into 2 × 10 5 293 cells/well in six-well plates along with 2 μg of pW1, harboring a lacZ expression cassette flanked by ITRs, by a standard calcium phosphate precipitation method. Twenty-four hours later, total cellular DNA was isolated and suspended finally in 200 μl of TE. PCR to detect site-specific integration was carried out as reported previously with minor modifications: 1 μl of isolated genomic DNA was subjected to a thermal cycling reaction in a 20-μl reaction mixture containing 1× thermophilic DNA polymerase buffer [10 mM KCl, 20 mM Tris-HCl (pH 8.8), 10 mM (NH 4 ) 2 SO 4 , 4 mM MgSO 4 , 0.1% Triton X-100 (NEB)], 1 μM 5′-CGGCCTCAGTGAGCGAGCGAGC and 5′-CGGGGAGGATCCGCTCAGAGGACA, and 2 U of Deep Vent Exo(−) DNA polymerase (NEB). The cycling conditions were 99°C for 1 min followed by 35 cycles of 99°C for 10 s and 72°C for 4 min. Ten microliters of the PCR mixture was transferred to a hybridization membrane (Hybond-N + ; Amersham) by using a dot blot apparatus and hybridized with a 32 P-labeled AAVS1 probe. The membranes were then analyzed on a BAS-1500 imaging analyzer. The assay was repeated at least four times. p, positive control for hybridization.

    Article Snippet: One microliter of isolated genomic DNA was subjected to a thermal cycling reaction in a 20-μl reaction mixture containing 1× thermophilic DNA polymerase buffer [10 mM KCl, 20 mM Tris-HCl (pH 8.8), 10 mM (NH4 )2 SO4 , 4 mM MgSO4 , 0.1% Triton X-100 (New England Biolabs {NEB})], 1 μM 5′-CGGCCTCAGTGAGCGAGCGAGC and 5′-CGGGGAGGATCCGCTCAGAGGACA, and 2 U of Deep Vent Exo(−) DNA polymerase (NEB).

    Techniques: Mutagenesis, Introduce, Plasmid Preparation, Expressing, Transfection, Isolation, Polymerase Chain Reaction, Hybridization, Dot Blot, Labeling, Imaging, Positive Control

    Pex14p is multiply phosphorylated  in vivo . ( A ) TPA-tagged Pex14p (Pex14p TPA ) expressed from its native chromosomal location was affinity-purified from a Triton X-100-solubilized crude membrane fraction of yeast cells grown in oleic acid-containing medium. Affinity chromatography was performed using IgG-coupled Sepharose and proteins were eluted with glycine (pH 2.4). Proteins from phosphatase (λ-PPase)-treated (+) and untreated (-) samples were analyzed by Phos-tag SDS-PAGE and immunoblotting using anti-Pex14p antibodies. Note that also non-phosphorylated proteins generally migrate slower in Phos-tag gels compared to normal SDS gels (  Kinoshita et al., 2009 ). *, Pex14p degradation band. ( B ) Representative MS/MS spectrum showing phosphorylation of Pex14p at S310 (AREQTIDpSNASIPEWQK;  m/z  1027.474; z = +2). *, fragment ion with neutral loss of H 3 PO 4 . ( C ) Schematic representation of Pex14p showing the localization of  in vivo  phosphorylation sites. Phosphorylation at S6, S15, S76, T263, and S327 are reported here for the first time. MD, predicted membrane domain (according to   Azevedo and Schliebs, 2006 ). Pex5p-, Pex7p-, and Pex13p-binding regions are depicted according to   Azevedo and Schliebs (2006) . Please note that alternative Pex14p-Pex13p binding sites have been proposed (  Schell-Steven et al., 2005 ). While a second Pex14p interaction site has been mapped for Pex13p (  Schell-Steven et al., 2005 ;   Williams and Distel, 2006 ), an additional Pex13p binding site in Pex14p has not yet been reported. Coiled-coil (CC) domains were predicted using PredictProtein (  Rost et al., 2004 ).

    Journal: bioRxiv

    Article Title: Pex14p phosphorylation modulates import of citrate synthase 2 into peroxisomes in Saccharomyces cerevisiae

    doi: 10.1101/2020.07.03.186833

    Figure Lengend Snippet: Pex14p is multiply phosphorylated in vivo . ( A ) TPA-tagged Pex14p (Pex14p TPA ) expressed from its native chromosomal location was affinity-purified from a Triton X-100-solubilized crude membrane fraction of yeast cells grown in oleic acid-containing medium. Affinity chromatography was performed using IgG-coupled Sepharose and proteins were eluted with glycine (pH 2.4). Proteins from phosphatase (λ-PPase)-treated (+) and untreated (-) samples were analyzed by Phos-tag SDS-PAGE and immunoblotting using anti-Pex14p antibodies. Note that also non-phosphorylated proteins generally migrate slower in Phos-tag gels compared to normal SDS gels ( Kinoshita et al., 2009 ). *, Pex14p degradation band. ( B ) Representative MS/MS spectrum showing phosphorylation of Pex14p at S310 (AREQTIDpSNASIPEWQK; m/z 1027.474; z = +2). *, fragment ion with neutral loss of H 3 PO 4 . ( C ) Schematic representation of Pex14p showing the localization of in vivo phosphorylation sites. Phosphorylation at S6, S15, S76, T263, and S327 are reported here for the first time. MD, predicted membrane domain (according to Azevedo and Schliebs, 2006 ). Pex5p-, Pex7p-, and Pex13p-binding regions are depicted according to Azevedo and Schliebs (2006) . Please note that alternative Pex14p-Pex13p binding sites have been proposed ( Schell-Steven et al., 2005 ). While a second Pex14p interaction site has been mapped for Pex13p ( Schell-Steven et al., 2005 ; Williams and Distel, 2006 ), an additional Pex13p binding site in Pex14p has not yet been reported. Coiled-coil (CC) domains were predicted using PredictProtein ( Rost et al., 2004 ).

    Article Snippet: Dephosphorylation of Pex14p and Phos-tag SDS-PAGE Pex14pTPA affinity-purified from Triton X-100 extracts was mixed with 10x phosphatase buffer (0.5 M HEPES, 1 M NaCl, 20 mM DTT, 0.1% Brij 35, pH 7.5), MnCl2 (1 mM final concentration), and 800 units of lambda protein phosphatase (λ-PPase; New England Biolabs) and incubated for 20 min at 30°C under slight agitation.

    Techniques: In Vivo, Affinity Purification, Affinity Chromatography, SDS Page, Tandem Mass Spectroscopy, Binding Assay