steponeplus system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    StepOnePlus™ Real-Time PCR System
    Description:
    The StepOnePlus Real-Time PCR System is a 96-well Real-Time PCR instrument perfect for both first-time and experienced users. The StepOnePlus Real-Time PCR System can be setup in a variety of configurations and comes ready to use, out of the box, with intuitive data analysis and instrument control software. Utilizing robust LED based 4-color optical recording, the StepOnePlus Real-Time PCR System is designed to deliver precise, quantitative Real-Time PCR results for a variety of genomic research applications.Features of the StepOnePlus Real-Time PCR System include:• Advanced software and instrumentation for performing a wide array of genomic assays• Sensitive 4-color optical LED recording system• Intuitive and robust software perfect for both first-time and advanced users• Simple and flexible instrument set-up and usageNew StepOne SoftwareThe StepOne Software included with the StepOnePlus Real-Time PCR System runs on the Windows XP operating system and provides instrument control, data collection, and data analysis capabilities (analysis software is also compatible with Windows 7). This latest version includes capabilities to collect melt curve data for High Resolution Melt (HRM) applications and the option to export in Real-Time PCR Data Markup Language (RDML) for compatibility with MIQE guidelines.Rapid and Simple Assay Set-UpThis remarkably simple Real-Time PCR system is designed with an LCD touchscreen and a user-friendly interface that brings the power of genetic studies to researchers new to Real-Time PCR (Fig 1). The intuitive software and protocol wizards help guide new users through their Real-Time PCR experiments. The StepOnePlus Real-Time PCR System also includes a quick-start setup so that you start a run immediately and enter plate information at a later time.Sensitive LED-Based 4 Color Fluorescence ReadingThe StepOnePlus Real-Time PCR System utilizes a long-life LED-based optical system that can record fluorescence from FAM/SYBR Green, VIC/JOE, NED/TAMRA, and ROX dyes. This cost-effective, 4-color, 96-well system delivers precise, quantitative Real-Time PCR results and saves data from all filters in every run without depending on a computer or plate setup. It can discriminate between 2 populations of 5,000 and 10,000 template copies of a TaqMan assay with 99.7% confidence.Compatible with Many Genomic Analysis TechniquesPerform a variety of standard and demanding genetic analysis research techniques on one instrument using the user friendly StepOnePlus Real-Time PCR System and StepOne Software.The StepOnePlus System supports many Real-Time PCR applications, including the following:• SNP Genotyping• Gene Expression Analysis• MicroRNA Expression• Protein Expression• Translocation Analysis• Gene Detection• Viral Load AnalysisThe included StepOne Software supports a variety of analysis methods, including the following:• Standard Curve (absolute quantitation)• Relative Standard Curve• Comparative Ct (ΔΔCt) (relative quantitation)• Genotyping and Presence/Absence• Melt Curve Analysis (as a standalone application)• High Resolution Melting (as a standalone application)Versatile Instrument Configuration OptionsThe ultra-compact footprint of a StepOnePlus System can be installed in multiple distinct configurations, providing unmatched flexibility and convenience that can allow a fit in any laboratory (Fig 2). The StepOnePlus Real-Time PCR System can be used via a PC, with a PC connected to a Local Area Network (LAN), or as a stand-alone instrument (PC-free). Each StepOnePlus Real-Time PCR System is factory-calibrated for optical and thermal accuracy, so simply remarkable Real-Time PCR results can be obtained right out of the box.Energy Efficiency and Space SavingThe StepOnePlus Real-Time PCR System draws 38% less energy to process one sample plate (when the instrument is in a heated state), compared to the Bio-Rad CFX96 Real-Time PCR Detection System. The StepOnePlus Real-Time PCR System also has advanced temperature control through use of VeriFlex Blocks technology and has a footprint nearly 15% smaller than Bio-Rad CFX96, which in today’s crowded laboratories helps you use your laboratory space even more efficiently. You also leave a smaller environmental footprint on the Earth.Real-Time Data Monitoring, Dissemination, and StorageThe system measures amplification as it occurs, allowing you to monitor the progress of your experiment cycle by cycle, either on the machine or remotely. Your data is stored on the instrument itself, and can be viewed and stored automatically via remote access, or transferred via email or a USB flash drive. Data can also be conveniently exported as PowerPoint, Excel, and graphical image files.Expanded Gene Expression CapabilitiesThe advanced software provided with the StepOnePlus Real-Time PCR System now includes the powerful Gene Expression Study Package. This software package allows for greater flexibility and accuracy in your gene expression assays through:• Analysis of an unlimited number of plates in one study• Sorting of data by biological or technical replicate group• Use of multiple endogenous controls• Assay efficiency correctionAdvanced High Resolution Melting CapabilityNow with High Resolution Melt Software v3.0, you can perform post-PCR sequence variation analysis with the StepOnePlus Real-Time PCR System. This separately purchased software simplifies set-up by maintaining assay specific settings and accepts pasted plate layout information directly from Excel. HRM Software v3.0 also has an improved clustering algorithm for increased sensitivity and accuracy, and the ability to conduct separate analyses of multiple assays run on a single plate.
    Catalog Number:
    4376600
    Price:
    None
    Applications:
    Genotyping & Genomic Profiling|PCR & Real-Time PCR|Real Time PCR (qPCR)|Real Time PCR-Based Gene Expression Profiling|Real-Time PCR Instruments, Software & Calibration|Gene Expression Analysis & Genotyping|Genotyping Instruments, Software & Calibration|High Resolution Melting (HRM) Analysis
    Size:
    1 instrument
    Category:
    Instruments and Equipment, Real-Time PCR Instruments & Accessories, Real-Time PCR Instruments
    Score:
    85
    Buy from Supplier
    Name:
    StepOnePlus Real-Time PCR System Spectral Calibration Kit
    Description:
    This easy-to-use kit establishes the pure dye spectra and multicomponent values for FAM/SYBR Green I, VIC/JOE, and NED/TAMRA/ROX dyes on the StepOnePlus Real-Time PCR System. The Applied Biosystems StepOnePlus Real-Time PCR System Spectral Calibration Kit contains one background plate and two preloaded, 96-well fast optical reaction plates containing seven dye standards.• 96-well optical reaction plates preloaded with dyes (FAM/SYBR Green I, VIC/JOE, NED/TAMRA/ROX) are provided for quick and easy calibration of the StepOnePlus Real-Time PCR System• Easy-to-use and provides accurate discrimination of the fluorescence signal of individual dyes in the reaction mixture• Includes the Passive Reference I dye standard for signal normalization in all real-time and endpoint reactionsSpend Your Time on Research—Not Instrument CalibrationThis kit's easy-to-use, preloaded, 96-well optical reaction plates enable users to calibrate the StepOnePlus Real-Time PCR System quickly and easily. Insert the reaction plates during system installation, and the system automatically collects the dye standard's spectral information. The system's application algorithm then uses the calibration information to ensure accurate data analysis.
    Catalog Number:
    4371435
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Real Time PCR (qPCR)|Real-Time PCR Instruments, Software & Calibration
    Conjugate:
    FAM|JOE|NED|ROX|TAMRA|VIC|SYBR Green
    Size:
    1 kit
    Category:
    Standards, Ladders & Controls, Instrument Calibration Kits, Standards & Reagents, Real-Time PCR Instrument Calibration Kits & Reagents
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher steponeplus system
    This easy-to-use kit establishes the pure dye spectra and multicomponent values for FAM/SYBR Green I, VIC/JOE, and NED/TAMRA/ROX dyes on the StepOnePlus Real-Time PCR System. The Applied Biosystems StepOnePlus Real-Time PCR System Spectral Calibration Kit contains one background plate and two preloaded, 96-well fast optical reaction plates containing seven dye standards.• 96-well optical reaction plates preloaded with dyes (FAM/SYBR Green I, VIC/JOE, NED/TAMRA/ROX) are provided for quick and easy calibration of the StepOnePlus Real-Time PCR System• Easy-to-use and provides accurate discrimination of the fluorescence signal of individual dyes in the reaction mixture• Includes the Passive Reference I dye standard for signal normalization in all real-time and endpoint reactionsSpend Your Time on Research—Not Instrument CalibrationThis kit's easy-to-use, preloaded, 96-well optical reaction plates enable users to calibrate the StepOnePlus Real-Time PCR System quickly and easily. Insert the reaction plates during system installation, and the system automatically collects the dye standard's spectral information. The system's application algorithm then uses the calibration information to ensure accurate data analysis.
    https://www.bioz.com/result/steponeplus system/product/Thermo Fisher
    Average 99 stars, based on 555 article reviews
    Price from $9.99 to $1999.99
    steponeplus system - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Transduction:

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: For ChIP in DT40 Aicda −/− ΔΨVλ cells, repeated retroviral transduction achieved ~75–90% GFP+ cells, and cells were expanded for 48 h. ChIP procedures have been described in detail . .. Plates were read in an Applied Biosystems StepOnePlus instrument.

    Amplification:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: For single IP assay 50 µl of bead solution was used. .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA). .. Input was used for normalization control.

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Synthesized:

    Article Title: BAP1 regulates IP3R3-mediated Ca2+ flux to mitochondria suppressing cell transformation
    Article Snippet: The RNA was treated with DNase (Promega) and its integrity and concentration was assessed using the Agilent 2100 BioAnalyzer. cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Invitrogen, cat no. 4368814) following the manufacturer's instructions. .. Quantitative real-time PCR was performed in triplicate using TaqMan® Universal Master Mix II (Invitrogen, cat no. 4440040) and commercially available TaqMan Probes (Invitrogen) on a StepOnePlus system (Applied Biosystem).

    Quantitative RT-PCR:

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Paragraph title: qRT-PCR analysis ... Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems).

    Article Title: Sequence-dependent but not sequence-specific piRNA adhesion traps mRNAs to the germ plasm
    Article Snippet: Paragraph title: qRT-PCR ... The reactions were run on a StepOnePlus™ System (Applied Biosystems) using the default program.

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: The data shown are the average qRT–PCR values (n =3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    Article Title: Alterations in microRNA-124 and AMPA receptors contribute to social behavioral deficits in frontotemporal dementia
    Article Snippet: Paragraph title: Quantitative RT-PCR ... We performed real-time quantitative PCR with a StepOnePlus system (Applied Biosystems).

    Article Title: Opposing effects of cancer type-specific SPOP mutations on BET protein degradation and sensitivity to BET inhibitors
    Article Snippet: Thereafter, resin was washed twice in the same buffer and samples were separated by SDS-PAGE and visualized through chemiluminescence using using anti-HA and anti-SPOP (see above). .. RNA was extracted using the Rnasy kit (Qiagen) and processed by Kapa SybrFAST one-Step qRT-PCR kit according to manufacturer`s instructions. q-PCR was undertaken on an Applied Biosystems StepOnePlus System. .. The target mRNA expression was quantified using ∆∆Ct method and normalized to Cyclophilin expression.

    Article Title: Rational combination of oncolytic vaccinia virus and PD-L1 blockade works synergistically to enhance therapeutic efficacy
    Article Snippet: Paragraph title: RT–qPCR ... One microgram of RNA was used for cDNA synthesis, and 25–50 ng of subsequent cDNA was used to conduct mRNA expression analysis by TaqMan analysis on the StepOnePlus system (Life Technologies, Grand Island, NY, USA).

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Paragraph title: QRT-PCR and Western Blotting ... Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems).

    SYBR Green Assay:

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Real-time qPCR was performed either with the TaqMan qPCR chemistry (Thermo Fisher Scientific Inc.) for mouse using Kras -specific primers and probes or with the SYBR® Green master mix (Thermo Fisher Scientific Inc.) using primers for human target genes VIM , CDH1 and MMP1 ( ). .. Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems).

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Real-time qPCR was performed either with the TaqMan qPCR chemistry (Thermo Fisher Scientific Inc.) for mouse using Kras -specific primers and probes or with the SYBR® Green master mix (Thermo Fisher Scientific Inc.) using primers for human target genes VIM , CDH1 and MMP1 ( ). .. Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems).

    Article Title: Sequence-dependent but not sequence-specific piRNA adhesion traps mRNAs to the germ plasm
    Article Snippet: Equal volume of the cDNA was mixed with primers (gcl , osk , hsp83 , dhd , cycB : Qiagen QuantiTect Assay; Renilla Luciferase (rLuc), F: 5′-CGCTGAAAGTGTAGTAGATGTG and R: 5′-TCCACGAAGAAGTTATTCTCCA) and Power SYBR Green reaction mix (Applied Biosystems 4367659). .. The reactions were run on a StepOnePlus™ System (Applied Biosystems) using the default program.

    Article Title: Intracellular α-ketoglutarate maintains the pluripotency of embryonic stem cells
    Article Snippet: The data shown are the average qRT-PCR values (n=3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix. .. ChIP samples were diluted 1:100 in H2 0 and 5 μL used per reaction.

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: The data shown are the average qRT–PCR values (n =3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix. .. ChIP samples were diluted 1:100 in H2 O and 5 μl was used per reaction.

    Article Title: Alterations in microRNA-124 and AMPA receptors contribute to social behavioral deficits in frontotemporal dementia
    Article Snippet: We performed real-time quantitative PCR with a StepOnePlus system (Applied Biosystems). .. We carried out reactions (in triplicate) with SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: DNA was purified and used as template in real-time PCR reactions containing 1× SYBR Green Mix (Applied Biosystems), 1/10 fraction ChIP-enriched DNA and 100 nM primers (see Supplementary Table for primer sequences). .. Plates were read in an Applied Biosystems StepOnePlus instrument.

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Tumor infiltrating macrophages and lymphocytes were positively isolated from single-cell suspensions with anti-mouse F4/80, CD8α or CD4 microbeads (Miltenyi) on a MACS column. .. Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems). .. Samples were run in technical triplicates.

    Incubation:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: After incubation, 50 μl of 50% slurry bead solution was added for another incubation period (2 hr), then beads were washed: four times for 15 min with RIPA lysis buffer, two times for 1 min with LiCl IP wash buffer (250 mM LiCl, 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.5% NP-40, 0.5% DOC, filtered through 0.2 micron filter unit), two times for 1 min with TE buffer (1 mM Tris–HCl pH 8.0, 1 mM EDTA, filtered through 0.2 micron filter unit). .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: Soluble material was incubated overnight at 4 °C after addition of 0.5–1 μg of antibody bound to 25 μl protein A Dynal magnetic beads (Catalog# 10006D, Invitrogen), with 5% kept as input DNA. .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    Article Title: Alterations in microRNA-124 and AMPA receptors contribute to social behavioral deficits in frontotemporal dementia
    Article Snippet: We performed real-time quantitative PCR with a StepOnePlus system (Applied Biosystems). .. We performed real-time quantitative PCR with a StepOnePlus system (Applied Biosystems).

    Luciferase:

    Article Title: Sequence-dependent but not sequence-specific piRNA adhesion traps mRNAs to the germ plasm
    Article Snippet: Equal volume of the cDNA was mixed with primers (gcl , osk , hsp83 , dhd , cycB : Qiagen QuantiTect Assay; Renilla Luciferase (rLuc), F: 5′-CGCTGAAAGTGTAGTAGATGTG and R: 5′-TCCACGAAGAAGTTATTCTCCA) and Power SYBR Green reaction mix (Applied Biosystems 4367659). .. The reactions were run on a StepOnePlus™ System (Applied Biosystems) using the default program.

    Expressing:

    Article Title: Modifying the cancer-immune set point using vaccinia virus expressing re-designed interleukin-2
    Article Snippet: Total RNA was extracted from viral-infected cells or tumour tissues using the RNeasy Kit (Qiagen, Valencia, CA). .. One microgram of RNA was used for cDNA synthesis, and 25 to 50 ng of subsequent cDNA was used to conduct mRNA expression analysis by TaqMan analysis on the StepOnePlus system (Life Technologies, Grand Island, NY). .. All the primers for the analysis were purchased from Thermo Fisher Scientific (Waltham, MA).

    Article Title: Targeting RalGAPα1 in skeletal muscle to simultaneously improve postprandial glucose and lipid control
    Article Snippet: Colocalization of CD36 and RalA was assessed via Manders’ overlap coefficient (R ) using Image-Pro Plus software. .. Real-time quantitative PCR was carried out to measure expression levels of target genes using an Applied Biosystems StepOnePlus system. .. The primers for real-time quantitative PCR are listed in table 2.

    Article Title: Rational combination of oncolytic vaccinia virus and PD-L1 blockade works synergistically to enhance therapeutic efficacy
    Article Snippet: Total RNA was extracted from virus-infected cells or tumour tissues using the RNeasy Kit (Qiagen, Valencia, CA, USA). .. One microgram of RNA was used for cDNA synthesis, and 25–50 ng of subsequent cDNA was used to conduct mRNA expression analysis by TaqMan analysis on the StepOnePlus system (Life Technologies, Grand Island, NY, USA). .. All the primers for the analysis were purchased from Thermo Fisher Scientific (Waltham, MA, USA).

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems). .. Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems).

    Western Blot:

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Paragraph title: QRT-PCR and Western Blotting ... Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems).

    Activation Assay:

    Article Title: BDNF rs6265 polymorphism methylation in Multiple Sclerosis: A possible marker of disease progression
    Article Snippet: We analyzed the BDNF rs6265 polymorphism using HRM technique that characterizes nucleic acid samples based on their disassociation (melting) behavior using StepOnePlus thermocycler (Applied Biosystems, Foster City, CA, USA). .. The amplification of BDNF rs6265 polymorphism was carried out as previously reported [ ]: in brief, the reaction mix (total volume of 20μl), contained 20 nanograms (ng) of genomic DNA, 0.5 μM of either forward/reverse primers and 1X of MeltDoctor HRM Master Mix (Applied Biosystems, Foster City, CA, USA).

    Protease Inhibitor:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: Nuclei were resuspended in RIPA lysis buffer (1 × PBS, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS + Roche Protease Inhibitor Cocktail Tablet, filtered through 0.2 micron filter unit). .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    other:

    Article Title: Alterations in microRNA-124 and AMPA receptors contribute to social behavioral deficits in frontotemporal dementia
    Article Snippet: For quantitative PCR, we designed and tested specific primers ( ) at different cDNA dilutions, and calculated their efficiency.

    Sequencing:

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Sonication:

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: Nuclei were lysed by brief sonication and dialysed into N-ChIP buffer (10 mM Tris pH 7.6, 1 mM EDTA, 0.1% SDS, 0.1% Na-Deoxycholate, 1% Triton X-100) for 2 h at 4 °C. .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: Briefly, cells fixed with 1% formaldehyde for 30 min, were lysed in RIPA buffer and sonicated to generate DNA fragments 500 bp. .. Plates were read in an Applied Biosystems StepOnePlus instrument.

    Magnetic Cell Separation:

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Tumor infiltrating macrophages and lymphocytes were positively isolated from single-cell suspensions with anti-mouse F4/80, CD8α or CD4 microbeads (Miltenyi) on a MACS column. .. Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems).

    DC Protein Assay:

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems). .. To calculate the gDNA deletion efficiency, total DNA was extracted with the DNeasy kit (Qiagen) and the primers shown in the were used in a Taqman RT-PCR mastermix (ThermoFisher).

    Fluorescence:

    Article Title: Two New Rapid SNP-Typing Methods for Classifying Mycobacterium tuberculosis Complex into the Main Phylogenetic Lineages
    Article Snippet: Primer and probe sequences are listed in . .. Reactions were run in a StepOnePlus thermocycler (Applied Biosystems; 60°C 30 sec; 95°C 10 min; 95°C 15 sec and 60°C 1 min for 40 cycles; 60°C 30 sec) and fluorescence intensity in the VIC and FAM channels measured at the end of every cycle. .. Results were analyzed with StepOne software (Applied Biosystems) and alleles called with the default algorithm.

    Magnetic Beads:

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: Magnetic beads were washed, chromatin was eluted and ChIP DNA was dissolved in 10 mM Tris pH 8 for quantitative PCR reactions (see later). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    Mutagenesis:

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Article Title: Two New Rapid SNP-Typing Methods for Classifying Mycobacterium tuberculosis Complex into the Main Phylogenetic Lineages
    Article Snippet: Briefly, in a 12 µL volume, 2 µL DNA sample were added to a mix of 5 µL TaqMan Universal MasterMix II (Applied Biosystems), 5 µL H2 O containing forward and reverse primer (0.21 µM each; Sigma-Aldrich), probe A for ancestral allele and probe B for mutant allele (0.83 µM each; Applied Biosystems). .. Reactions were run in a StepOnePlus thermocycler (Applied Biosystems; 60°C 30 sec; 95°C 10 min; 95°C 15 sec and 60°C 1 min for 40 cycles; 60°C 30 sec) and fluorescence intensity in the VIC and FAM channels measured at the end of every cycle.

    Isolation:

    Article Title: Myeloid-derived suppressor cells control B cell accumulation in the CNS during autoimmunity
    Article Snippet: The isolated RNA was transcribed into cDNA using the TaqMan Reverse Transcription Reagents Kit (Life Technologies, Carlsbad, USA) according to the manufacturer’s instructions. .. The real time PCR was performed on StepOnePlus system (Life Technologies).

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Tumor infiltrating macrophages and lymphocytes were positively isolated from single-cell suspensions with anti-mouse F4/80, CD8α or CD4 microbeads (Miltenyi) on a MACS column. .. Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: Washed beads were resuspended in 100 μl of IP elution buffer and subjected to overnight reverse cross-linking (RNase and proteinase K digestions) followed by DNA purification (DNA was purified using Minelute PCR purification kit from Qiagen, Germany). .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    Article Title: Intracellular α-ketoglutarate maintains the pluripotency of embryonic stem cells
    Article Snippet: The data shown are the average qRT-PCR values (n=3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix. .. ChIP samples were diluted 1:100 in H2 0 and 5 μL used per reaction.

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: The data shown are the average qRT–PCR values (n =3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix. .. ChIP samples were diluted 1:100 in H2 O and 5 μl was used per reaction.

    Article Title: Modifying the cancer-immune set point using vaccinia virus expressing re-designed interleukin-2
    Article Snippet: Paragraph title: Quantitative reverse transcription PCR ... One microgram of RNA was used for cDNA synthesis, and 25 to 50 ng of subsequent cDNA was used to conduct mRNA expression analysis by TaqMan analysis on the StepOnePlus system (Life Technologies, Grand Island, NY).

    Article Title: BDNF rs6265 polymorphism methylation in Multiple Sclerosis: A possible marker of disease progression
    Article Snippet: We analyzed the BDNF rs6265 polymorphism using HRM technique that characterizes nucleic acid samples based on their disassociation (melting) behavior using StepOnePlus thermocycler (Applied Biosystems, Foster City, CA, USA). .. The amplification of BDNF rs6265 polymorphism was carried out as previously reported [ ]: in brief, the reaction mix (total volume of 20μl), contained 20 nanograms (ng) of genomic DNA, 0.5 μM of either forward/reverse primers and 1X of MeltDoctor HRM Master Mix (Applied Biosystems, Foster City, CA, USA).

    Size-exclusion Chromatography:

    Article Title: Two New Rapid SNP-Typing Methods for Classifying Mycobacterium tuberculosis Complex into the Main Phylogenetic Lineages
    Article Snippet: Primer and probe sequences are listed in . .. Reactions were run in a StepOnePlus thermocycler (Applied Biosystems; 60°C 30 sec; 95°C 10 min; 95°C 15 sec and 60°C 1 min for 40 cycles; 60°C 30 sec) and fluorescence intensity in the VIC and FAM channels measured at the end of every cycle. .. Results were analyzed with StepOne software (Applied Biosystems) and alleles called with the default algorithm.

    Purification:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: For single IP assay 50 µl of bead solution was used. .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA). .. Input was used for normalization control.

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: DNA was purified and used as template in real-time PCR reactions containing 1× SYBR Green Mix (Applied Biosystems), 1/10 fraction ChIP-enriched DNA and 100 nM primers (see Supplementary Table for primer sequences). .. Plates were read in an Applied Biosystems StepOnePlus instrument.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Catechol-O-methyltransferase polymorphism is associated with the cortico-cerebellar functional connectivity of executive function in children with attention-deficit/hyperactivity disorder
    Article Snippet: Two children with ADHD underwent extraction from oral mucosa because they rejected blood sampling. .. COMT Val158Met polymorphism (rs4680) was genotyped by real-time polymerase chain reaction (RT-PCR) analysis using the StepOnePlus System (Applied Biosystems, Tokyo, Japan) in accordance with standard protocols provided by the manufacturer. .. Functional images were acquired with a T2*-weighted gradient-echo echo-planar imaging (EPI) sequence via a 3-T scanner (Discovery MR 750; General ElectricMedical Systems, Milwaukee, WI) and a 32-channnel head coil.

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems). .. Data was normalized to 18S rRNA or HPRT expression.

    Immunoprecipitation:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: Paragraph title: Immunoprecipitation assays (IP and ChIP) ... Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: Plates were read in an Applied Biosystems StepOnePlus instrument. .. Standard curves with different amounts of the input extracts were run in each plate for each individual amplicon and used to calculate input %.

    Chromatin Immunoprecipitation:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: Paragraph title: Immunoprecipitation assays (IP and ChIP) ... Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    Article Title: Intracellular α-ketoglutarate maintains the pluripotency of embryonic stem cells
    Article Snippet: Paragraph title: ChIP-qPCR ... All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: Paragraph title: Chromatin immunoprecipitation ... All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: Paragraph title: Chromatin immunoprecipitation ... Plates were read in an Applied Biosystems StepOnePlus instrument.

    SDS Page:

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems). .. To calculate the gDNA deletion efficiency, total DNA was extracted with the DNeasy kit (Qiagen) and the primers shown in the were used in a Taqman RT-PCR mastermix (ThermoFisher).

    Software:

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime
    Article Snippet: All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s). .. All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s).

    Article Title: BDNF rs6265 polymorphism methylation in Multiple Sclerosis: A possible marker of disease progression
    Article Snippet: We analyzed the BDNF rs6265 polymorphism using HRM technique that characterizes nucleic acid samples based on their disassociation (melting) behavior using StepOnePlus thermocycler (Applied Biosystems, Foster City, CA, USA). .. We analyzed the BDNF rs6265 polymorphism using HRM technique that characterizes nucleic acid samples based on their disassociation (melting) behavior using StepOnePlus thermocycler (Applied Biosystems, Foster City, CA, USA).

    Real-time Polymerase Chain Reaction:

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime
    Article Snippet: Paragraph title: Conventional qPCR ... All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s).

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: For single IP assay 50 µl of bead solution was used. .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA). .. Input was used for normalization control.

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Real-time qPCR was performed either with the TaqMan qPCR chemistry (Thermo Fisher Scientific Inc.) for mouse using Kras -specific primers and probes or with the SYBR® Green master mix (Thermo Fisher Scientific Inc.) using primers for human target genes VIM , CDH1 and MMP1 ( ). .. Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Article Title: Evolutionary routes and KRAS dosage define pancreatic cancer phenotypes
    Article Snippet: Real-time qPCR was performed either with the TaqMan qPCR chemistry (Thermo Fisher Scientific Inc.) for mouse using Kras -specific primers and probes or with the SYBR® Green master mix (Thermo Fisher Scientific Inc.) using primers for human target genes VIM , CDH1 and MMP1 ( ). .. Gapdh or GAPDH in combination with PPIA were used as housekeeping genes for normalization ( ). qPCR was conducted on a StepOnePlus system (Applied Biosystems). .. For analyses of mutant KrasG12D mRNA levels in mPDACs, first total (wild-type plus mutant) Kras mRNA levels were determined using qRT-PCR.

    Article Title: Intracellular α-ketoglutarate maintains the pluripotency of embryonic stem cells
    Article Snippet: The data shown are the average qRT-PCR values (n=3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix. .. ChIP samples were diluted 1:100 in H2 0 and 5 μL used per reaction.

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: The data shown are the average qRT–PCR values (n =3). .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix. .. ChIP samples were diluted 1:100 in H2 O and 5 μl was used per reaction.

    Article Title: BAP1 regulates IP3R3-mediated Ca2+ flux to mitochondria suppressing cell transformation
    Article Snippet: The RNA was treated with DNase (Promega) and its integrity and concentration was assessed using the Agilent 2100 BioAnalyzer. cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Invitrogen, cat no. 4368814) following the manufacturer's instructions. .. Quantitative real-time PCR was performed in triplicate using TaqMan® Universal Master Mix II (Invitrogen, cat no. 4440040) and commercially available TaqMan Probes (Invitrogen) on a StepOnePlus system (Applied Biosystem). .. The mRNA levels were normalized using the geometric mean of three reference genes (B2M, 18S and β-actin).

    Article Title: Alterations in microRNA-124 and AMPA receptors contribute to social behavioral deficits in frontotemporal dementia
    Article Snippet: For quantitative PCR, we designed and tested specific primers ( ) at different cDNA dilutions, and calculated their efficiency. .. We performed real-time quantitative PCR with a StepOnePlus system (Applied Biosystems). .. We carried out reactions (in triplicate) with SYBR Green PCR Master Mix (Applied Biosystems).

    Article Title: Myeloid-derived suppressor cells control B cell accumulation in the CNS during autoimmunity
    Article Snippet: Probes were purchased from Life Technologies and the assays were performed on 96-well reaction plates (Life Technologies). .. The real time PCR was performed on StepOnePlus system (Life Technologies). .. In all experiments Actb was used as reference gene to normalize gene expression, all samples were run as triplicates.

    Article Title: Targeting RalGAPα1 in skeletal muscle to simultaneously improve postprandial glucose and lipid control
    Article Snippet: Colocalization of CD36 and RalA was assessed via Manders’ overlap coefficient (R ) using Image-Pro Plus software. .. Real-time quantitative PCR was carried out to measure expression levels of target genes using an Applied Biosystems StepOnePlus system. .. The primers for real-time quantitative PCR are listed in table 2.

    Article Title: A licensing step links AID to transcription elongation for mutagenesis in B cells
    Article Snippet: DNA was purified and used as template in real-time PCR reactions containing 1× SYBR Green Mix (Applied Biosystems), 1/10 fraction ChIP-enriched DNA and 100 nM primers (see Supplementary Table for primer sequences). .. Plates were read in an Applied Biosystems StepOnePlus instrument.

    Article Title: Catechol-O-methyltransferase polymorphism is associated with the cortico-cerebellar functional connectivity of executive function in children with attention-deficit/hyperactivity disorder
    Article Snippet: Two children with ADHD underwent extraction from oral mucosa because they rejected blood sampling. .. COMT Val158Met polymorphism (rs4680) was genotyped by real-time polymerase chain reaction (RT-PCR) analysis using the StepOnePlus System (Applied Biosystems, Tokyo, Japan) in accordance with standard protocols provided by the manufacturer. .. Functional images were acquired with a T2*-weighted gradient-echo echo-planar imaging (EPI) sequence via a 3-T scanner (Discovery MR 750; General ElectricMedical Systems, Milwaukee, WI) and a 32-channnel head coil.

    Article Title: Two New Rapid SNP-Typing Methods for Classifying Mycobacterium tuberculosis Complex into the Main Phylogenetic Lineages
    Article Snippet: Paragraph title: TaqMan real-time PCR ... Reactions were run in a StepOnePlus thermocycler (Applied Biosystems; 60°C 30 sec; 95°C 10 min; 95°C 15 sec and 60°C 1 min for 40 cycles; 60°C 30 sec) and fluorescence intensity in the VIC and FAM channels measured at the end of every cycle.

    Article Title: An HIF-1α/VEGF-A Axis in Cytotoxic T Cells Regulates Tumor Progression
    Article Snippet: Tumor infiltrating macrophages and lymphocytes were positively isolated from single-cell suspensions with anti-mouse F4/80, CD8α or CD4 microbeads (Miltenyi) on a MACS column. .. Real time PCR was performed with SYBR green (Thermo) in a StepOnePlus system (Applied Biosystems). .. Samples were run in technical triplicates.

    Sampling:

    Article Title: Catechol-O-methyltransferase polymorphism is associated with the cortico-cerebellar functional connectivity of executive function in children with attention-deficit/hyperactivity disorder
    Article Snippet: Two children with ADHD underwent extraction from oral mucosa because they rejected blood sampling. .. COMT Val158Met polymorphism (rs4680) was genotyped by real-time polymerase chain reaction (RT-PCR) analysis using the StepOnePlus System (Applied Biosystems, Tokyo, Japan) in accordance with standard protocols provided by the manufacturer.

    Concentration Assay:

    Article Title: Correction of RT-qPCR data for genomic DNA-derived signals with ValidPrime
    Article Snippet: RT reactions were diluted 5–10-fold prior to qPCR. .. All reactions (except when indicated) were performed in duplicate 10 µl volumes using 20 ng reverse transcribed total RNA in a StepOnePlus system (Applied Biosystems) with the SsoFast EvaGreen Supermix (BioRad) and an assay concentration of 300 nM using the cycling parameters: 95°C (20 s) followed by 40 cycles at 95°C (3 s) and 60°C (20 s). .. Melting curve analysis: 95°C (15 s); 60°C (60 s) and a progressive increase up to 95°C (0.5°C/min).

    Article Title: BAP1 regulates IP3R3-mediated Ca2+ flux to mitochondria suppressing cell transformation
    Article Snippet: The RNA was treated with DNase (Promega) and its integrity and concentration was assessed using the Agilent 2100 BioAnalyzer. cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Invitrogen, cat no. 4368814) following the manufacturer's instructions. .. Quantitative real-time PCR was performed in triplicate using TaqMan® Universal Master Mix II (Invitrogen, cat no. 4440040) and commercially available TaqMan Probes (Invitrogen) on a StepOnePlus system (Applied Biosystem).

    N-ChIP:

    Article Title: Compartmentalized activities of the pyruvate dehydrogenase complex sustain lipogenesis in prostate cancer
    Article Snippet: Nuclei were lysed by brief sonication and dialysed into N-ChIP buffer (10 mM Tris pH 7.6, 1 mM EDTA, 0.1% SDS, 0.1% Na-Deoxycholate, 1% Triton X-100) for 2 h at 4 °C. .. All qPCR was performed using an Applied Biosystems StepOnePlus system and Power SYBR Green PCR master mix.

    DNA Purification:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: Washed beads were resuspended in 100 μl of IP elution buffer and subjected to overnight reverse cross-linking (RNase and proteinase K digestions) followed by DNA purification (DNA was purified using Minelute PCR purification kit from Qiagen, Germany). .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    Lysis:

    Article Title: MOF-associated complexes ensure stem cell identity and Xist repression
    Article Snippet: After incubation, 50 μl of 50% slurry bead solution was added for another incubation period (2 hr), then beads were washed: four times for 15 min with RIPA lysis buffer, two times for 1 min with LiCl IP wash buffer (250 mM LiCl, 10 mM Tris–HCl pH 8.0, 1 mM EDTA, 0.5% NP-40, 0.5% DOC, filtered through 0.2 micron filter unit), two times for 1 min with TE buffer (1 mM Tris–HCl pH 8.0, 1 mM EDTA, filtered through 0.2 micron filter unit). .. Purified ChIPed DNA was subjected to qPCR amplification (Applied Biosystems, Carlsbad, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher steponeplus real time pcr system
    Heparan sulfate induces necroptosis in cardiomyocytes. (A) Relative caspase 3 <t>mRNA</t> expressions of HL-1 cells exposed to HS for 16 h were analyzed by quantitative real-time <t>PCR,</t> compared to unstimulated cells. Expression was normalized to reference gene S7 and normalized to unstimulated cells. (B) HL-1 cells exposed to 10 μg/ml HSs for 16 h showed a significant increase in phosphorylation of RIP3 and (C) MLKL compared to unstimulated cells. Protein expression was normalized to unstimulated cells. The data represent the mean ± SD of triplicate samples for three independent experiments. HS, heparan sulfate; RIP, receptor-interacting protein; MLKL, mixed lineage kinase domain-like; TNF-α, tumor necrosis factor alpha; * p
    Steponeplus Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 194 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/steponeplus real time pcr system/product/Thermo Fisher
    Average 99 stars, based on 194 article reviews
    Price from $9.99 to $1999.99
    steponeplus real time pcr system - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Heparan sulfate induces necroptosis in cardiomyocytes. (A) Relative caspase 3 mRNA expressions of HL-1 cells exposed to HS for 16 h were analyzed by quantitative real-time PCR, compared to unstimulated cells. Expression was normalized to reference gene S7 and normalized to unstimulated cells. (B) HL-1 cells exposed to 10 μg/ml HSs for 16 h showed a significant increase in phosphorylation of RIP3 and (C) MLKL compared to unstimulated cells. Protein expression was normalized to unstimulated cells. The data represent the mean ± SD of triplicate samples for three independent experiments. HS, heparan sulfate; RIP, receptor-interacting protein; MLKL, mixed lineage kinase domain-like; TNF-α, tumor necrosis factor alpha; * p

    Journal: Frontiers in Immunology

    Article Title: Heparan Sulfate Induces Necroptosis in Murine Cardiomyocytes: A Medical-In silico Approach Combining In vitro Experiments and Machine Learning

    doi: 10.3389/fimmu.2018.00393

    Figure Lengend Snippet: Heparan sulfate induces necroptosis in cardiomyocytes. (A) Relative caspase 3 mRNA expressions of HL-1 cells exposed to HS for 16 h were analyzed by quantitative real-time PCR, compared to unstimulated cells. Expression was normalized to reference gene S7 and normalized to unstimulated cells. (B) HL-1 cells exposed to 10 μg/ml HSs for 16 h showed a significant increase in phosphorylation of RIP3 and (C) MLKL compared to unstimulated cells. Protein expression was normalized to unstimulated cells. The data represent the mean ± SD of triplicate samples for three independent experiments. HS, heparan sulfate; RIP, receptor-interacting protein; MLKL, mixed lineage kinase domain-like; TNF-α, tumor necrosis factor alpha; * p

    Article Snippet: The following primers were used to analyze the relative mRNA expression of caspase 3 and TNF-α in the quantitative real-time PCR (StepOnePlus Real-Time PCR System; Thermo Fisher Scientific, MA, USA): caspase 3, 5′ CCAACCTCAGAGAGACATTC 3′ (for) and 5′ TTTCGGCTTTCCAGTCAGAC 3′ (rev) and TNF-α, 5′ TCCCCAAAGGGATGAGAAG 3′ (for) and 5′ GCACCACTAGTTGGTTGTC 3′ (rev).

    Techniques: Real-time Polymerase Chain Reaction, Expressing

    Heparan sulfate induces a pro-apoptotic pathway. HL-1 cells exposed to 10 μg/ml HS for 16 h showed a significant increase in protein expression of (A) phospho-ERK 1/2, (B) cytochrome C, (C) cleaved PARP, and (D) cleaved caspase 3, compared to unstimulated cells. Protein expression was normalized to unstimulated cells. (E) Relative mRNA expressions of HL-1 cells exposed to HS were analyzed by quantitative real-time PCR, compared to unstimulated cells. Caspase 3 mRNA expression was normalized to reference gene S7 and unstimulated cells. (F) Relative caspase 3 activity of cardiomyocytes exposed to HS, compared to unstimulated cells. The data represent the mean ± SD of triplicate samples for three independent experiments. HS, heparan sulfate; PARP, poly-(ADP-ribose) polymerase; p-ERK, phospho-extracellular signal-regulated kinase; statistical significance was performed by using unpaired t -test. * p

    Journal: Frontiers in Immunology

    Article Title: Heparan Sulfate Induces Necroptosis in Murine Cardiomyocytes: A Medical-In silico Approach Combining In vitro Experiments and Machine Learning

    doi: 10.3389/fimmu.2018.00393

    Figure Lengend Snippet: Heparan sulfate induces a pro-apoptotic pathway. HL-1 cells exposed to 10 μg/ml HS for 16 h showed a significant increase in protein expression of (A) phospho-ERK 1/2, (B) cytochrome C, (C) cleaved PARP, and (D) cleaved caspase 3, compared to unstimulated cells. Protein expression was normalized to unstimulated cells. (E) Relative mRNA expressions of HL-1 cells exposed to HS were analyzed by quantitative real-time PCR, compared to unstimulated cells. Caspase 3 mRNA expression was normalized to reference gene S7 and unstimulated cells. (F) Relative caspase 3 activity of cardiomyocytes exposed to HS, compared to unstimulated cells. The data represent the mean ± SD of triplicate samples for three independent experiments. HS, heparan sulfate; PARP, poly-(ADP-ribose) polymerase; p-ERK, phospho-extracellular signal-regulated kinase; statistical significance was performed by using unpaired t -test. * p

    Article Snippet: The following primers were used to analyze the relative mRNA expression of caspase 3 and TNF-α in the quantitative real-time PCR (StepOnePlus Real-Time PCR System; Thermo Fisher Scientific, MA, USA): caspase 3, 5′ CCAACCTCAGAGAGACATTC 3′ (for) and 5′ TTTCGGCTTTCCAGTCAGAC 3′ (rev) and TNF-α, 5′ TCCCCAAAGGGATGAGAAG 3′ (for) and 5′ GCACCACTAGTTGGTTGTC 3′ (rev).

    Techniques: Expressing, Real-time Polymerase Chain Reaction, Activity Assay