Structured Review

Thermo Fisher top10
The transformation of Bifidobacterium was confirmed by plasmid isolation followed by agarose gel electrophoresis. Plasmids extracted from PAM host E. coli <t>TOP10</t> harbouring pPAM1233–1283 (Lane 1) and from recombinant B. adolescentis ATCC15703 (Lane 2). Vector pKKT427 (Lane 3) and pPAM1233-1283 (Lane 4).
Top10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/top10/product/Thermo Fisher
Average 99 stars, based on 10 article reviews
Price from $9.99 to $1999.99
top10 - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Improvement of bacterial transformation efficiency using plasmid artificial modification"

Article Title: Improvement of bacterial transformation efficiency using plasmid artificial modification

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkn884

The transformation of Bifidobacterium was confirmed by plasmid isolation followed by agarose gel electrophoresis. Plasmids extracted from PAM host E. coli TOP10 harbouring pPAM1233–1283 (Lane 1) and from recombinant B. adolescentis ATCC15703 (Lane 2). Vector pKKT427 (Lane 3) and pPAM1233-1283 (Lane 4).
Figure Legend Snippet: The transformation of Bifidobacterium was confirmed by plasmid isolation followed by agarose gel electrophoresis. Plasmids extracted from PAM host E. coli TOP10 harbouring pPAM1233–1283 (Lane 1) and from recombinant B. adolescentis ATCC15703 (Lane 2). Vector pKKT427 (Lane 3) and pPAM1233-1283 (Lane 4).

Techniques Used: Transformation Assay, Plasmid Preparation, Isolation, Agarose Gel Electrophoresis, Recombinant

Comparison of PAM effects on transformation efficiencies. ( A–D ) Bifidobacterium adolescentis ATCC15703 was transformed by electroporation using the PAM method. The plasmid pKKT427 was prepared from E. coli TOP10 carrying pPAM1233-1283 ( A ), pPAM1233 ( B ), pPAM1283 ( C ) or without pPAM plasmid ( D ). An alkaline-SDS method using purification by agarose gel electrophoresis was used to isolate the PAM plasmids which were then introduced into B. adolescentis ATCC15703 by electroporation, as described previously ( 6 ). The electroporated samples were 100 times diluted in (A–C ) , but not in D. ( E ) Schematic presentation of transformation efficiencies. Plasmid pKKT427 was prepared from the PAM host (blue), B. longum 105-A (green) or B. adolescentis ATCC15703. The numbers beside arrows indicate transformation efficiencies (CFU/µg DNA).
Figure Legend Snippet: Comparison of PAM effects on transformation efficiencies. ( A–D ) Bifidobacterium adolescentis ATCC15703 was transformed by electroporation using the PAM method. The plasmid pKKT427 was prepared from E. coli TOP10 carrying pPAM1233-1283 ( A ), pPAM1233 ( B ), pPAM1283 ( C ) or without pPAM plasmid ( D ). An alkaline-SDS method using purification by agarose gel electrophoresis was used to isolate the PAM plasmids which were then introduced into B. adolescentis ATCC15703 by electroporation, as described previously ( 6 ). The electroporated samples were 100 times diluted in (A–C ) , but not in D. ( E ) Schematic presentation of transformation efficiencies. Plasmid pKKT427 was prepared from the PAM host (blue), B. longum 105-A (green) or B. adolescentis ATCC15703. The numbers beside arrows indicate transformation efficiencies (CFU/µg DNA).

Techniques Used: Transformation Assay, Electroporation, Plasmid Preparation, Purification, Agarose Gel Electrophoresis

2) Product Images from "Characterization of a synthetic bacterial self-destruction device for programmed cell death and for recombinant proteins release"

Article Title: Characterization of a synthetic bacterial self-destruction device for programmed cell death and for recombinant proteins release

Journal: Journal of Biological Engineering

doi: 10.1186/1754-1611-5-8

OD600 time course of TOP10-rfp-lys grown in 15 ml tubes upon induction with HSL 100 nM (A) and RFP fluorescence time course in the supernatant (B) . Culture absorbance (A) and supernatant fluorescence (B) of TOP10-rfp-lys induced with HSL 100 nM (blue line). Uninduced TOP10-rfp-lys (red line), TOP10 bearing pHC-RFP induced with HSL 100 nM (green line) or uninduced (black line) are the negative controls. Induction was carried out in the exponential phase at OD600~0.55. Error bars represent the 95% confidence interval of the estimated mean.
Figure Legend Snippet: OD600 time course of TOP10-rfp-lys grown in 15 ml tubes upon induction with HSL 100 nM (A) and RFP fluorescence time course in the supernatant (B) . Culture absorbance (A) and supernatant fluorescence (B) of TOP10-rfp-lys induced with HSL 100 nM (blue line). Uninduced TOP10-rfp-lys (red line), TOP10 bearing pHC-RFP induced with HSL 100 nM (green line) or uninduced (black line) are the negative controls. Induction was carried out in the exponential phase at OD600~0.55. Error bars represent the 95% confidence interval of the estimated mean.

Techniques Used: Fluorescence

Lysis profile of TOP10 bearing the lysis device in low copy number when induced in different growth phases in microplate reader . OD600 of TOP10 with pLC-T4LysHSL induced with HSL 100 nM (blue line) and uninduced (red line), pLC-T4Lys - induced with HSL 100 nM (green line) and uninduced (black line). Induction was performed in exponential phase (OD600 = 0.2) at t = 0 (A), early stationary phase (OD600~1.3) at t = 4 h (B) and late stationary phase (OD600~2) at t = 20 h (C). Error bars represent the 95% confidence interval of the estimated mean. For clarity of presentation, data points shown here are resampled with a 1-hour sampling time.
Figure Legend Snippet: Lysis profile of TOP10 bearing the lysis device in low copy number when induced in different growth phases in microplate reader . OD600 of TOP10 with pLC-T4LysHSL induced with HSL 100 nM (blue line) and uninduced (red line), pLC-T4Lys - induced with HSL 100 nM (green line) and uninduced (black line). Induction was performed in exponential phase (OD600 = 0.2) at t = 0 (A), early stationary phase (OD600~1.3) at t = 4 h (B) and late stationary phase (OD600~2) at t = 20 h (C). Error bars represent the 95% confidence interval of the estimated mean. For clarity of presentation, data points shown here are resampled with a 1-hour sampling time.

Techniques Used: Lysis, Low Copy Number, Planar Chromatography, Sampling

Transfer function, rise time and delay time of the HSL-inducible lysis device in low copy plasmid in early stationary phase in microplate reader . Lysis entity of TOP10 cells with pLC-T4LysHSL induced with different concentrations of HSL in early stationary phase at OD600 = 0.9 (A). The experimental data (circles) were fitted with a Hill function (line, Vmax = 76, K 50 = 0.37, n = 1.3). For each concentration, the rise time, i.e. the time to rise from the 10% to 90% of the lysis entity (B) and the delay time before the OD600 drop after induction (C) are also shown. Error bars represent the 95% confidence interval of the estimated mean.
Figure Legend Snippet: Transfer function, rise time and delay time of the HSL-inducible lysis device in low copy plasmid in early stationary phase in microplate reader . Lysis entity of TOP10 cells with pLC-T4LysHSL induced with different concentrations of HSL in early stationary phase at OD600 = 0.9 (A). The experimental data (circles) were fitted with a Hill function (line, Vmax = 76, K 50 = 0.37, n = 1.3). For each concentration, the rise time, i.e. the time to rise from the 10% to 90% of the lysis entity (B) and the delay time before the OD600 drop after induction (C) are also shown. Error bars represent the 95% confidence interval of the estimated mean.

Techniques Used: Lysis, Plasmid Preparation, Planar Chromatography, Concentration Assay

Lysis dynamics of TOP10 bearing the thermoinducible lysis device in low copy plasmid grown in microplate reader . OD600 of TOP10 with pLC-T4LysHeat induced with a temperature shift from 30°C to 42°C in the microplate reader (blue line). Heat-induced pLC-T4Lys - (green line) is shown as the negative control. Induction was performed in exponential phase at OD600 = 0.3. Error bars represent the 95% confidence interval of the estimated mean. For clarity of presentation, data points shown here are resampled with a 30-minute sampling time.
Figure Legend Snippet: Lysis dynamics of TOP10 bearing the thermoinducible lysis device in low copy plasmid grown in microplate reader . OD600 of TOP10 with pLC-T4LysHeat induced with a temperature shift from 30°C to 42°C in the microplate reader (blue line). Heat-induced pLC-T4Lys - (green line) is shown as the negative control. Induction was performed in exponential phase at OD600 = 0.3. Error bars represent the 95% confidence interval of the estimated mean. For clarity of presentation, data points shown here are resampled with a 30-minute sampling time.

Techniques Used: Lysis, Plasmid Preparation, Planar Chromatography, Negative Control, Sampling

3) Product Images from "Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications"

Article Title: Unique nucleotide sequence (UNS)-guided assembly of repetitive DNA parts for synthetic biology applications

Journal: Nature protocols

doi: 10.1038/nprot.2014.145

Constructing individual circuits and combinatorial libraries (A) Combinatorial assembly of a 3-part biosynthetic pathway for deoxychromoviridans (an insoluble green alkaloid pigment) by UNS-guided assembly. Each part contained one of six promoters, a triple terminator, and one of the three genes required for deoxychromoviridans biosynthesis ( vioB , vioA , vioE ). (i) Analytical restriction digestion of a pool of 60 clones obtained by this method. The pool was digested to isolate the destination vector backbone (black arrow) from the inserts assembled into it. Indicated are the frequent, correctly-sized (green arrow) and rare, incorrectly-sized (red arrows) inserts. (ii) Transformation of empty pDestET into TOP10 competent cells yields a lawn of unpigmented TOP 10 E. coli . (iii) Transformation of the isothermal assembly reaction (containing the vioBAE library, indicated by “Vio Lib” in the figure) into TOP10 E. coli yields colonies with variable levels of green pigmentation. (B) Construction of individual, four-part circuits for and logical computation in mammalian cells. (i) Parts were assembled into the pDestRmceBAC destination vector, which is capable of single-copy integration into appropriate mammalian cell lines. The first three parts (A, B, C1) were mixed with either the D1 or D2 part. Each mixture was assembled on its own, transformed into E. coli, .
Figure Legend Snippet: Constructing individual circuits and combinatorial libraries (A) Combinatorial assembly of a 3-part biosynthetic pathway for deoxychromoviridans (an insoluble green alkaloid pigment) by UNS-guided assembly. Each part contained one of six promoters, a triple terminator, and one of the three genes required for deoxychromoviridans biosynthesis ( vioB , vioA , vioE ). (i) Analytical restriction digestion of a pool of 60 clones obtained by this method. The pool was digested to isolate the destination vector backbone (black arrow) from the inserts assembled into it. Indicated are the frequent, correctly-sized (green arrow) and rare, incorrectly-sized (red arrows) inserts. (ii) Transformation of empty pDestET into TOP10 competent cells yields a lawn of unpigmented TOP 10 E. coli . (iii) Transformation of the isothermal assembly reaction (containing the vioBAE library, indicated by “Vio Lib” in the figure) into TOP10 E. coli yields colonies with variable levels of green pigmentation. (B) Construction of individual, four-part circuits for and logical computation in mammalian cells. (i) Parts were assembled into the pDestRmceBAC destination vector, which is capable of single-copy integration into appropriate mammalian cell lines. The first three parts (A, B, C1) were mixed with either the D1 or D2 part. Each mixture was assembled on its own, transformed into E. coli, .

Techniques Used: Clone Assay, Plasmid Preparation, Transformation Assay

4) Product Images from "Tuning the relative affinities for activating and repressing operators of a temporally regulated restriction-modification system"

Article Title: Tuning the relative affinities for activating and repressing operators of a temporally regulated restriction-modification system

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkn1010

Methylation status of plasmid isolated from cells expressing varied levels of WT M.PvuII or its variants. The complementary strands for the symmetrized C-box region of the PvuII R-M system are shown at the top. The upper strand specifies M.PvuII. The two changes that symmetrize the C-boxes are shown in red, along with the resultant changes in the MTase sequence (N4S/S10R). Substitution of the O L spacer, from CAT to CAA, would result in an additional change (M8L). Escherichia coli TOP10 cells carried two plasmids: pUC × 7PvuII (with seven PvuII sites) and plasmids expressing either WT pvuIIM (pBadMTwt-kan) or one of its variants (MTase N4S/S10R–pBadMT2-kan; MTase N4S/S10R/M8L–pBadMT2-kan) under the arabinose inducible promoter P BAD . After induction with a range of arabinose concentrations, cells were pelleted and plasmid DNA was isolated. The extent of methylation was assessed by digestion with PvuII restriction enzyme. Results ranged from full cleavage (no protection as in control lane 1; asterisk shows the position of highest bands) to no cleavage (complete methylation as in control lane 2). Digests were resolved on 1% agarose gel. Lanes 4 to 8 for each MTase represent equivalent increasing arabinose concentration from 0.01 to 0.2%. The topmost band in lanes 4–8 for each MTase is the pBAD plasmid linearized with XhoI prior to digestion with PvuII indicated by arrow; pUC × 7PvuII lacks a XhoI site. M lane shows DNA markers (1 kB Plus ladder; Invitrogen).
Figure Legend Snippet: Methylation status of plasmid isolated from cells expressing varied levels of WT M.PvuII or its variants. The complementary strands for the symmetrized C-box region of the PvuII R-M system are shown at the top. The upper strand specifies M.PvuII. The two changes that symmetrize the C-boxes are shown in red, along with the resultant changes in the MTase sequence (N4S/S10R). Substitution of the O L spacer, from CAT to CAA, would result in an additional change (M8L). Escherichia coli TOP10 cells carried two plasmids: pUC × 7PvuII (with seven PvuII sites) and plasmids expressing either WT pvuIIM (pBadMTwt-kan) or one of its variants (MTase N4S/S10R–pBadMT2-kan; MTase N4S/S10R/M8L–pBadMT2-kan) under the arabinose inducible promoter P BAD . After induction with a range of arabinose concentrations, cells were pelleted and plasmid DNA was isolated. The extent of methylation was assessed by digestion with PvuII restriction enzyme. Results ranged from full cleavage (no protection as in control lane 1; asterisk shows the position of highest bands) to no cleavage (complete methylation as in control lane 2). Digests were resolved on 1% agarose gel. Lanes 4 to 8 for each MTase represent equivalent increasing arabinose concentration from 0.01 to 0.2%. The topmost band in lanes 4–8 for each MTase is the pBAD plasmid linearized with XhoI prior to digestion with PvuII indicated by arrow; pUC × 7PvuII lacks a XhoI site. M lane shows DNA markers (1 kB Plus ladder; Invitrogen).

Techniques Used: Methylation, Plasmid Preparation, Isolation, Expressing, Sequencing, Cellular Antioxidant Activity Assay, Agarose Gel Electrophoresis, Concentration Assay

In vivo effects of C-box O L spacer variants on temporal expression of C.PvuII. ( A ) Diagram of experiment. Four E. coli TOP10’ cultures carrying plasmids with different O L spacers fused to a cat (chloramphenicol acetyltransferase) promotorless reporter gene were infected with recombinant M13pvuIIwt phage at MOI = 15. We used three spacer variants tested previously in this study: WT-Sym (CAT/CAA; pDK178; closed circles), CAA/CAA (pIM22; open circles) and nonrepressing WT-Sym (box 2B mutated, pWWWR; gray circles) as a control. The first two variants have identical, symmetrized C-boxes sequences, and differ only at a single nt in O R . A plasmid with no C-box sequence (pKK-238; triangles) was also tested and gave only background levels of cat expression (shown in Figure S6). ( B ) Growth was monitored at OD 600 nm before and after phage addition. ( C ) CAT production over infection time for two independently performed experiments was measured by sensitive colorimetric assay based on ELISA sandwich method (see ‘Materials and methods’ section). CAT production data were normalized to the value for each strain prior to infection. Curves were fitted and statistical analysis was performed using the SAS package (SAS Institute Inc., Cary, NC). The analysis of covariance indicated significant difference of slopes over time with P
Figure Legend Snippet: In vivo effects of C-box O L spacer variants on temporal expression of C.PvuII. ( A ) Diagram of experiment. Four E. coli TOP10’ cultures carrying plasmids with different O L spacers fused to a cat (chloramphenicol acetyltransferase) promotorless reporter gene were infected with recombinant M13pvuIIwt phage at MOI = 15. We used three spacer variants tested previously in this study: WT-Sym (CAT/CAA; pDK178; closed circles), CAA/CAA (pIM22; open circles) and nonrepressing WT-Sym (box 2B mutated, pWWWR; gray circles) as a control. The first two variants have identical, symmetrized C-boxes sequences, and differ only at a single nt in O R . A plasmid with no C-box sequence (pKK-238; triangles) was also tested and gave only background levels of cat expression (shown in Figure S6). ( B ) Growth was monitored at OD 600 nm before and after phage addition. ( C ) CAT production over infection time for two independently performed experiments was measured by sensitive colorimetric assay based on ELISA sandwich method (see ‘Materials and methods’ section). CAT production data were normalized to the value for each strain prior to infection. Curves were fitted and statistical analysis was performed using the SAS package (SAS Institute Inc., Cary, NC). The analysis of covariance indicated significant difference of slopes over time with P

Techniques Used: In Vivo, Expressing, Infection, Recombinant, Cellular Antioxidant Activity Assay, Plasmid Preparation, Sequencing, Colorimetric Assay, Enzyme-linked Immunosorbent Assay

5) Product Images from "Reconstruction of the Archaeal Isoprenoid Ether Lipid Biosynthesis Pathway in Escherichia coli Through Digeranylgeranylglyceryl Phosphate"

Article Title: Reconstruction of the Archaeal Isoprenoid Ether Lipid Biosynthesis Pathway in Escherichia coli Through Digeranylgeranylglyceryl Phosphate

Journal: Metabolic engineering

doi: 10.1016/j.ymben.2009.01.008

LC/MS/MS analysis of crude, dephosphorylated lipid extracts from E. coli TOP10/pDL11/pDL6 confirmed DGGGP biosynthesis in vivo . (A) Chromatogram from HPLC analysis at 210 nm. Peak assignment of GGG and DGGG was based on mass spectrometry identification. (B) MS and MS/MS spectra of compound eluting at 10.5 min which was identified as GGG. (C) MS and MS/MS spectra of compound eluting at 12.5–14.5 min which was identified as DGGG.
Figure Legend Snippet: LC/MS/MS analysis of crude, dephosphorylated lipid extracts from E. coli TOP10/pDL11/pDL6 confirmed DGGGP biosynthesis in vivo . (A) Chromatogram from HPLC analysis at 210 nm. Peak assignment of GGG and DGGG was based on mass spectrometry identification. (B) MS and MS/MS spectra of compound eluting at 10.5 min which was identified as GGG. (C) MS and MS/MS spectra of compound eluting at 12.5–14.5 min which was identified as DGGG.

Techniques Used: Liquid Chromatography with Mass Spectroscopy, Mass Spectrometry, In Vivo, High Performance Liquid Chromatography

Western blot analysis with an anti-His antibody confirmed expression of His-tagged G1P dehydrogenase (39.4 kDa) and GGGP synthase (30.4 kDa) in E. coli . Lane 1: Crude cell lysate of E. coli TOP10/pDL11/pDL6. Lane 2: Affinity chromatography fraction of E. coli TOP10/pDL6 lysate containing His-tagged GGGP synthase. Lane 3: Affinity chromatography fraction of E. coli TOP10/pDL11 lysate containing His-tagged G1P dehydrogenase.
Figure Legend Snippet: Western blot analysis with an anti-His antibody confirmed expression of His-tagged G1P dehydrogenase (39.4 kDa) and GGGP synthase (30.4 kDa) in E. coli . Lane 1: Crude cell lysate of E. coli TOP10/pDL11/pDL6. Lane 2: Affinity chromatography fraction of E. coli TOP10/pDL6 lysate containing His-tagged GGGP synthase. Lane 3: Affinity chromatography fraction of E. coli TOP10/pDL11 lysate containing His-tagged G1P dehydrogenase.

Techniques Used: Western Blot, Expressing, Affinity Chromatography

6) Product Images from "Sequence determinants spanning -35 motif and AT-rich spacer region impacting Ehrlichia chaffeensis Sigma 70-dependent promoter activity of two differentially expressed p28 outer membrane protein genes"

Article Title: Sequence determinants spanning -35 motif and AT-rich spacer region impacting Ehrlichia chaffeensis Sigma 70-dependent promoter activity of two differentially expressed p28 outer membrane protein genes

Journal: DNA Research: An International Journal for Rapid Publication of Reports on Genes and Genomes

doi: 10.1093/dnares/dsw034

Mapping the sequence determinants of -35 motifs in Ehrlichia chaffeensis genes. The β-galactosidase expression driven by E. chaffeensis promoters constructs containing point mutations at each of the six nucleotide positions of the -35 motifs of genes encoding p28-Omp14 (A) and p28-Omp19 (B) were measured in the CAG20177 strain of E. coli expressing E. chaffeensis σ 70 . The experiment included the no promoter (NP) and wild-type promoter (WT) controls. Each mutation is identified with a change of the nucleotide at each position to the modified nucleotide. β-galactosidase expression was presented relative to the respective wild-type promoters. The β-galactosidase expression driven by E. chaffeensis promoters constructs containing point mutations at each of the six nucleotide positions of the -35 motifs of genes encoding p28-Omp14 (C) and p28-Omp19 (D) also were measured in the TOP10 strain of E. coli expressing its native chromosomally expressed σ 70 with only the promoter plasmid pQF50K-p28-Omp14 or pQF50K-p28-Omp19 . The experiment also included the no promoter (NP) and wild-type promoter (WT) controls. Only four substititions in p28-Omp14 gene promoter and five substitions in p28-Omp19 gene promoter correlated well in altering the promoter activities when using σ 70 of E. chaffeensis and E. coli (within ∼10% variations); these mutations were identified in this figure with bold text.
Figure Legend Snippet: Mapping the sequence determinants of -35 motifs in Ehrlichia chaffeensis genes. The β-galactosidase expression driven by E. chaffeensis promoters constructs containing point mutations at each of the six nucleotide positions of the -35 motifs of genes encoding p28-Omp14 (A) and p28-Omp19 (B) were measured in the CAG20177 strain of E. coli expressing E. chaffeensis σ 70 . The experiment included the no promoter (NP) and wild-type promoter (WT) controls. Each mutation is identified with a change of the nucleotide at each position to the modified nucleotide. β-galactosidase expression was presented relative to the respective wild-type promoters. The β-galactosidase expression driven by E. chaffeensis promoters constructs containing point mutations at each of the six nucleotide positions of the -35 motifs of genes encoding p28-Omp14 (C) and p28-Omp19 (D) also were measured in the TOP10 strain of E. coli expressing its native chromosomally expressed σ 70 with only the promoter plasmid pQF50K-p28-Omp14 or pQF50K-p28-Omp19 . The experiment also included the no promoter (NP) and wild-type promoter (WT) controls. Only four substititions in p28-Omp14 gene promoter and five substitions in p28-Omp19 gene promoter correlated well in altering the promoter activities when using σ 70 of E. chaffeensis and E. coli (within ∼10% variations); these mutations were identified in this figure with bold text.

Techniques Used: Sequencing, Expressing, Construct, Mutagenesis, Modification, Plasmid Preparation

7) Product Images from "Regulatory circuit based on autogenous activation-repression: roles of C-boxes and spacer sequences in control of the PvuII restriction-modification system"

Article Title: Regulatory circuit based on autogenous activation-repression: roles of C-boxes and spacer sequences in control of the PvuII restriction-modification system

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkm837

The effect of mutation in O R on pvuIICR transcription and on PvuII R-M system establishment. The nonrepressing C-box mutation (WWWR: 5′-GACT-CAT-AGTC-TGTA-GACT-CAA- GA TC-3′) was tested in two ways. ( A ) In vivo titration with C.PvuII on arabinose inducible plasmid pIM1, where mutated C-box was fused to lacZ gene (pIM9). Cells were grown in minimal media with 0.2% glycerol, 0.2% glucose and the indicated concentration of arabinose as described in Figure 2 B. The transcriptional activity was measured as β-galactosidase specific activity as described in the Figure 2 legend. ( B ) Equal amounts of three plasmid DNAs were used to determine the efficiency of transformation (EOT) in each of two host strains. The three plasmids were pPvuRM3.4 (WT PvuII R-M system), pIM6 (symmetrized nonrepressing variant), and pBR322 (vector control). These were introduced into competent E. coli TOP10 cells that already carried either the gene for the PvuII MTase ( pvuIIM ; plasmid pPvuM1.9-ACYC) or a vector control ( pACYC177 ). Relative EOT was determined as the fraction of M.PvuII − transformants obtained relative to the number of transformants for the M.PvuIIM + strain, and then normalized to the pBR322 EOT ratio. Error bars indicate the SD.
Figure Legend Snippet: The effect of mutation in O R on pvuIICR transcription and on PvuII R-M system establishment. The nonrepressing C-box mutation (WWWR: 5′-GACT-CAT-AGTC-TGTA-GACT-CAA- GA TC-3′) was tested in two ways. ( A ) In vivo titration with C.PvuII on arabinose inducible plasmid pIM1, where mutated C-box was fused to lacZ gene (pIM9). Cells were grown in minimal media with 0.2% glycerol, 0.2% glucose and the indicated concentration of arabinose as described in Figure 2 B. The transcriptional activity was measured as β-galactosidase specific activity as described in the Figure 2 legend. ( B ) Equal amounts of three plasmid DNAs were used to determine the efficiency of transformation (EOT) in each of two host strains. The three plasmids were pPvuRM3.4 (WT PvuII R-M system), pIM6 (symmetrized nonrepressing variant), and pBR322 (vector control). These were introduced into competent E. coli TOP10 cells that already carried either the gene for the PvuII MTase ( pvuIIM ; plasmid pPvuM1.9-ACYC) or a vector control ( pACYC177 ). Relative EOT was determined as the fraction of M.PvuII − transformants obtained relative to the number of transformants for the M.PvuIIM + strain, and then normalized to the pBR322 EOT ratio. Error bars indicate the SD.

Techniques Used: Mutagenesis, Cellular Antioxidant Activity Assay, In Vivo, Titration, Plasmid Preparation, Concentration Assay, Activity Assay, Transformation Assay, Variant Assay

8) Product Images from "A bistable hysteretic switch in an activator-repressor regulated restriction-modification system"

Article Title: A bistable hysteretic switch in an activator-repressor regulated restriction-modification system

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkt324

Induction kinetics of pvuIICR operon. ( A ) System used. To allow stable titration with C.PvuII, its positive feedback loop was broken by placing the pvuIIC gene under control of the arabinose-inducible P araBAD promoter (top), while fusing the lacZ reporter gene (β-galactosidase) to the promoter that normally controls pvuIIC and is regulated by C.PvuII (P pvuIICR , middle; including both P CR 1 and P CR 2). The strain background was E. coli TOP10. The tet gene (tetracycline resistance) is on the same plasmid as lacZ , and was used to normalize gene expression in some experiments. The C.PvuII binding sites are shown at the bottom, with ovals representing C.PvuII homodimers. Some experiments use a non-repressing variant, in which C-box 2B (bottom) is altered ( AG TC → GA TC). For references, see text. ( B ) C.PvuII levels. Results of C.PvuII measurements from western blots of cell extracts. C.PvuII was detected by a polyclonal primary antiserum, with final readout via luminescence densitometry. Means of triplicates, ±SE, are shown. The loading normalization was to BCCP, a naturally biotinylated E. coli protein. See Methods for details.
Figure Legend Snippet: Induction kinetics of pvuIICR operon. ( A ) System used. To allow stable titration with C.PvuII, its positive feedback loop was broken by placing the pvuIIC gene under control of the arabinose-inducible P araBAD promoter (top), while fusing the lacZ reporter gene (β-galactosidase) to the promoter that normally controls pvuIIC and is regulated by C.PvuII (P pvuIICR , middle; including both P CR 1 and P CR 2). The strain background was E. coli TOP10. The tet gene (tetracycline resistance) is on the same plasmid as lacZ , and was used to normalize gene expression in some experiments. The C.PvuII binding sites are shown at the bottom, with ovals representing C.PvuII homodimers. Some experiments use a non-repressing variant, in which C-box 2B (bottom) is altered ( AG TC → GA TC). For references, see text. ( B ) C.PvuII levels. Results of C.PvuII measurements from western blots of cell extracts. C.PvuII was detected by a polyclonal primary antiserum, with final readout via luminescence densitometry. Means of triplicates, ±SE, are shown. The loading normalization was to BCCP, a naturally biotinylated E. coli protein. See Methods for details.

Techniques Used: Titration, Plasmid Preparation, Expressing, Binding Assay, Variant Assay, Western Blot

9) Product Images from "Optimization of production of recombinant human growth hormone in Escherichia coli"

Article Title: Optimization of production of recombinant human growth hormone in Escherichia coli

Journal: Journal of Research in Medical Sciences : The Official Journal of Isfahan University of Medical Sciences

doi:

Dot blot analysis of E. coli strains expressed rhGH in LB and 4YT mediums. A1: GH 1 mgr/ml , A2: GH 100 μgr/ml , A3: GH 10 μgr/ml , A4: GH 1 μgr/ ml , A5: GH 100 ngr/ml , A6: PBS, A7: control – with out loading, A8: Top10 none transformed supernatant, A9: Top10 none transformed cell lysate, A10: Top10 transformed LB T0 supernatant, A11: Top10 transformed LB T0 cell lysate, B1: Top10 transformed LB T5 supernatant, B2: Top10 transformed LB T5 supernatant 1/10 diluted, B3: Top10 transformed LB T5 cell lysate, B4: Top10 transformed LB T5 cell lysate 1/10 diluted, B5: Top10 transformed 4YT T0 supernatant, B6: Top10 transformed 4YT T0 cell lysate, B7: Top10 transformed 4YT T5 supernatant, B8: Top10 transformed 4YT T5 supernatant 1/10 diluted, B9: Top10 transformed 4YT T5 cell lysate, B10: Top10 transformed 4YT T5 cell lysate 1/10 diluted, B11 to C11: Top10 repeat 2, D1 to E1: Top10 repeat 3. E2 to F4: repeat 1 of XL1-blue, F5 to G5: repeat 2, G6 to H6: repeat 3. H7 to I9: repeat 1 of JM109, I10 to J10: repeat 2 and J11 to K11: repeat 3.
Figure Legend Snippet: Dot blot analysis of E. coli strains expressed rhGH in LB and 4YT mediums. A1: GH 1 mgr/ml , A2: GH 100 μgr/ml , A3: GH 10 μgr/ml , A4: GH 1 μgr/ ml , A5: GH 100 ngr/ml , A6: PBS, A7: control – with out loading, A8: Top10 none transformed supernatant, A9: Top10 none transformed cell lysate, A10: Top10 transformed LB T0 supernatant, A11: Top10 transformed LB T0 cell lysate, B1: Top10 transformed LB T5 supernatant, B2: Top10 transformed LB T5 supernatant 1/10 diluted, B3: Top10 transformed LB T5 cell lysate, B4: Top10 transformed LB T5 cell lysate 1/10 diluted, B5: Top10 transformed 4YT T0 supernatant, B6: Top10 transformed 4YT T0 cell lysate, B7: Top10 transformed 4YT T5 supernatant, B8: Top10 transformed 4YT T5 supernatant 1/10 diluted, B9: Top10 transformed 4YT T5 cell lysate, B10: Top10 transformed 4YT T5 cell lysate 1/10 diluted, B11 to C11: Top10 repeat 2, D1 to E1: Top10 repeat 3. E2 to F4: repeat 1 of XL1-blue, F5 to G5: repeat 2, G6 to H6: repeat 3. H7 to I9: repeat 1 of JM109, I10 to J10: repeat 2 and J11 to K11: repeat 3.

Techniques Used: Dot Blot, Transformation Assay

Comparison of transformation efficiency between different E.coli strains (A) Top10 (B) XL1-blue and (C) JM109
Figure Legend Snippet: Comparison of transformation efficiency between different E.coli strains (A) Top10 (B) XL1-blue and (C) JM109

Techniques Used: Transformation Assay

10) Product Images from "Size and Conformation Limits to Secretion of Disulfide-bonded Loops in Autotransporter Proteins *"

Article Title: Size and Conformation Limits to Secretion of Disulfide-bonded Loops in Autotransporter Proteins *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.306118

Stalled intermediates interact with BamA and BamD during OM translocation. TOP10 cells expressing empty vector ( EV ), wild-type Pet, PetSB, Pet48aa, Pet1HA, and Pet1HA-FLAG were harvested, spheroplasted, and lysed. Proteins were co-purified with anti-Pet
Figure Legend Snippet: Stalled intermediates interact with BamA and BamD during OM translocation. TOP10 cells expressing empty vector ( EV ), wild-type Pet, PetSB, Pet48aa, Pet1HA, and Pet1HA-FLAG were harvested, spheroplasted, and lysed. Proteins were co-purified with anti-Pet

Techniques Used: Translocation Assay, Expressing, Plasmid Preparation, Positron Emission Tomography, Purification

Stalled intermediates possess a hairpin conformation that can be detected using fluorescence microscopy. TOP10 cells expressing empty vector ( EV ), PetSB, PetSB-FLAG, PetL4HA, Pet1HA, and Pet1HA-FLAG were collected 1 h after induction with 0.02% arabinose
Figure Legend Snippet: Stalled intermediates possess a hairpin conformation that can be detected using fluorescence microscopy. TOP10 cells expressing empty vector ( EV ), PetSB, PetSB-FLAG, PetL4HA, Pet1HA, and Pet1HA-FLAG were collected 1 h after induction with 0.02% arabinose

Techniques Used: Fluorescence, Microscopy, Expressing, Plasmid Preparation

A rigid linker interferes with OM translocation. A , SDS-PAGE analysis of TCA-precipitated culture supernatant fractions harvested after growth of TOP10 and TOP10 Δ dsbA expressing Pet, Pet1HA ( 1HA ), Pet2HA ( 2HA ), and Pet3HA ( 3HA ). Intramolecular
Figure Legend Snippet: A rigid linker interferes with OM translocation. A , SDS-PAGE analysis of TCA-precipitated culture supernatant fractions harvested after growth of TOP10 and TOP10 Δ dsbA expressing Pet, Pet1HA ( 1HA ), Pet2HA ( 2HA ), and Pet3HA ( 3HA ). Intramolecular

Techniques Used: Translocation Assay, SDS Page, Expressing, Positron Emission Tomography

11) Product Images from "Random mutagenesis by error-prone Pol I plasmid replication in Escherichia coli"

Article Title: Random mutagenesis by error-prone Pol I plasmid replication in Escherichia coli

Journal: Methods in molecular biology (Clifton, N.J.)

doi: 10.1007/978-1-4939-1053-3_3

Phenotypic diversity a. Diversity in individual colony fluorescence intensity. E. coli Top10 cells were transformed with the pGFPuv library obtained by four rounds of direct-plating mutagenesis and grown under carbenicillin selection (the antibiotic marker for the plasmid). The majority of these colonies represent single plasmid transformations. Colonies were imaged using a UVP bioanalyzer illuminated at 302nm using a SYBR filter with an emission cutoff between 517-570 nm. b. Flow cytometry analysis. Colonies shown in panel b were washed with LB and grown to an OD 600 between 0.7-0.9 for optimal GFP fluorescence ( see ). Next, cells were diluted in sheath solution ( see ) to an event rate of less than 100 cells per second passing through the detector of the BD Influx cytometer. The GFP fluorescence was analyzed using a 531/40 optical filter and excited by a 488nm laser. This data represents the fluorescence emission of single cells in a cell culture population. In addition to the library, we also show two controls: cells expressing WT pGFPuv plasmid, and untransformed cells. These are labeled directly on the figure.
Figure Legend Snippet: Phenotypic diversity a. Diversity in individual colony fluorescence intensity. E. coli Top10 cells were transformed with the pGFPuv library obtained by four rounds of direct-plating mutagenesis and grown under carbenicillin selection (the antibiotic marker for the plasmid). The majority of these colonies represent single plasmid transformations. Colonies were imaged using a UVP bioanalyzer illuminated at 302nm using a SYBR filter with an emission cutoff between 517-570 nm. b. Flow cytometry analysis. Colonies shown in panel b were washed with LB and grown to an OD 600 between 0.7-0.9 for optimal GFP fluorescence ( see ). Next, cells were diluted in sheath solution ( see ) to an event rate of less than 100 cells per second passing through the detector of the BD Influx cytometer. The GFP fluorescence was analyzed using a 531/40 optical filter and excited by a 488nm laser. This data represents the fluorescence emission of single cells in a cell culture population. In addition to the library, we also show two controls: cells expressing WT pGFPuv plasmid, and untransformed cells. These are labeled directly on the figure.

Techniques Used: Fluorescence, Transformation Assay, Mutagenesis, Selection, Marker, Plasmid Preparation, Flow Cytometry, Cytometry, Cell Culture, Expressing, Labeling

Related Articles

Clone Assay:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: .. The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. Purified plasmid (QIAprep Spin Miniprep Kit, Qiagen) was sequenced by the UW—Madison Biotech DNA Sequencing Facility.

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: .. PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. ( ) with modification for limb samples as in McEwan et al. ( ).

Amplification:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: 3′ and 5′ RACE was performed according to manufacturer’s protocol using Clontech SMART RACE cDNA Amplification kit. .. The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen).

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: The 6‐O ‐endosulfatase genes were amplified from cDNA reverse transcribed from RNA extracted from stage 38 and 42 X. laevis embryos. .. PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis.

Agarose Gel Electrophoresis:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: .. The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. Purified plasmid (QIAprep Spin Miniprep Kit, Qiagen) was sequenced by the UW—Madison Biotech DNA Sequencing Facility.

Synthesized:

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. ( ) with modification for limb samples as in McEwan et al. ( ).

Microscopy:

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Samples were photographed in phosphate buffer solution (PBS) on 1.5%−2% noble agar using a Leica Fluo III dissecting microscope and accompanying Leica camera and LS software.

Purification:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. Purified plasmid (QIAprep Spin Miniprep Kit, Qiagen) was sequenced by the UW—Madison Biotech DNA Sequencing Facility.

Sequencing:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: Paragraph title: RACE and Extended Transcript Sequence Confirmation ... The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen).

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: .. PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. ( ) with modification for limb samples as in McEwan et al. ( ).

Polymerase Chain Reaction:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. To confirm the RACE results, PCR was performed on A. suum cDNA using specific 5′ primer afp11FWD1 (CGCACATATAAGCCATCGAA) and afp11REV1 (CAACAGAGAAACGACGTAACGA).

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: .. PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. ( ) with modification for limb samples as in McEwan et al. ( ).

DNA Sequencing:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. Purified plasmid (QIAprep Spin Miniprep Kit, Qiagen) was sequenced by the UW—Madison Biotech DNA Sequencing Facility.

Modification:

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. ( ) with modification for limb samples as in McEwan et al. ( ).

In Situ Hybridization:

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: Paragraph title: RNA probe synthesis and in situ hybridization ... PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis.

Plasmid Preparation:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. Purified plasmid (QIAprep Spin Miniprep Kit, Qiagen) was sequenced by the UW—Madison Biotech DNA Sequencing Facility.

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: .. PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Digoxigenin labelled RNA probes were synthesized and whole mount in situ hybridization was carried out following procedures previously described by Pownall et al. ( ) with modification for limb samples as in McEwan et al. ( ).

Software:

Article Title: Three Independent Techniques Localize Expression of Transcript afp-11 and Its Bioactive Peptide Products to the Paired AVK Neurons in Ascaris suum: In Situ Hybridization, Immunocytochemistry, and Single Cell Mass Spectrometry
Article Snippet: The RACE products were extracted from a 1% agarose gel and cloned into chemically competent E. coli (TOPO TA Dual Promoter Top10 Cloning kit, Invitrogen). .. The sequencing results were interpreted using ChromasPro software.

Article Title: Distinct patterns of endosulfatase gene expression during Xenopus laevis limb development and regeneration
Article Snippet: PCR products of the respective genes were cloned into pCRIITOPO TA vector (supplied by Invitrogen NZ) and the plasmids were linearized via PCR with the M13 sequencing primers prior to RNA probe synthesis. .. Samples were photographed in phosphate buffer solution (PBS) on 1.5%−2% noble agar using a Leica Fluo III dissecting microscope and accompanying Leica camera and LS software.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Thermo Fisher top10 escherichia coli
    DNA methylation in the enhancer region regulates perforin transcription. (a) Promoter region sequence containing enhancer in the PRF1 gene was aligned between human and mouse using the VISTA tool. The conservation degree is indicated by the peaks, with coloured peaks (blue for exon and light red for the non‐coding sequence) indicating > 70% conservation. Ten cytosine–phosphate–guanine sites (CpGs) in the enhancer are displayed upstream from the transcription start site (TSS). (b) Sorted CD8 + T cells from healthy donors were cultured initially in the presence of 200 IU/ml recombinant human interleukin (IL)‐2, 5 μg/ml plate‐coated anti‐CD3 and 1 μg/ml anti‐CD28 stimulating antibodies in vitro . 5‐Azacytidine (5‐aza) was added to the culture at a final concentration of 2·5 μM/ml for 48 h, followed by culture medium replacement and incubation for another 48 h. Flow cytometry data demonstrating perforin expression pre‐ and post‐treatment are shown. (c) Perforin – and perforin + CD8 + T cells were sorted. DNA was extracted and bisulfite‐converted from each cell subset, TA‐cloned to pCR4‐TOPO vector and transformed into <t>TOP10</t> <t>Escherichia</t> coli . Colonies were picked from each cell subset and their DNA was sequenced to measure DNA methylation status of the 10 CpGs in the enhancer. The data display rows represent individually sequenced clone. (d) The bar graphs display total DNA methylation percentage in each CpG from clones in (c).
    Top10 Escherichia Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/top10 escherichia coli/product/Thermo Fisher
    Average 93 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    top10 escherichia coli - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    93
    Thermo Fisher e coli top10 carrying vector pcr4 topo
    Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli <t>TOP10</t> cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector <t>pCR4-TOPO,</t> pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.
    E Coli Top10 Carrying Vector Pcr4 Topo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli top10 carrying vector pcr4 topo/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli top10 carrying vector pcr4 topo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher escherichia coli
    Representative SDS-PAGE, 2-dimensional electrophoresis (2DE), and Western blots showing the workflow for selection of immunoreactive spots. (A) The 1-dimensional SDS-PAGE image of Staphylococcus aureus Newbould 305 trypsinized protein (lane 1) and <t>Escherichia</t> coli trypsinized protein (lane 2). (B) 2DE gel conducted on 7 cm, pH 4 to 7, immobilized pH gradient (IPG) strips of S. aureus Newbould 305 trypsinized protein. Mr = molecular weight. (C) Immunoblot of S. aureus Newbould 305 trypsinized protein using pooled bovine mastitic milk, with immunoreactive regions highlighted in red circles. (D) 2DE gel conducted on 7 cm, pH 4 to 7, IPG strips of Escherichia coli DH10-β trypsinized protein. (E) Immunoblot of E. coli DH10-β trypsinized protein using bovine mastitic milk, with the immunoreactive regions highlighted in red circles. Color version available online.
    Escherichia Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 389 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli/product/Thermo Fisher
    Average 99 stars, based on 389 article reviews
    Price from $9.99 to $1999.99
    escherichia coli - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher e coli top10 cells
    Recombinant expression of rNanI species corresponding to protease-cleaved NanI fragments. rNanI species corresponding to full-length NanI or the major 65-kDa chymotrypsin-cleaved or 60-kDa mouse SI fluid-cleaved NanI fragments were recombinantly expressed by using E. coli <t>Top10</t> cells and the pTrc-HisB expression system. The rNanI species were then affinity enriched from the E. coli culture by using Talon resin and dialyzed overnight against PBS. Panel A shows the dialyzed samples subjected to SDS-PAGE and then either stained with Coomassie blue (left) or Western blotted for NanI (right). The relative amount of each enriched rNanI species was then determined by a protein assay. All experiments were performed in triplicate, and the mean results are shown. Error bars show standard deviations. # indicates a significant ( P
    E Coli Top10 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli top10 cells/product/Thermo Fisher
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    e coli top10 cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNA methylation in the enhancer region regulates perforin transcription. (a) Promoter region sequence containing enhancer in the PRF1 gene was aligned between human and mouse using the VISTA tool. The conservation degree is indicated by the peaks, with coloured peaks (blue for exon and light red for the non‐coding sequence) indicating > 70% conservation. Ten cytosine–phosphate–guanine sites (CpGs) in the enhancer are displayed upstream from the transcription start site (TSS). (b) Sorted CD8 + T cells from healthy donors were cultured initially in the presence of 200 IU/ml recombinant human interleukin (IL)‐2, 5 μg/ml plate‐coated anti‐CD3 and 1 μg/ml anti‐CD28 stimulating antibodies in vitro . 5‐Azacytidine (5‐aza) was added to the culture at a final concentration of 2·5 μM/ml for 48 h, followed by culture medium replacement and incubation for another 48 h. Flow cytometry data demonstrating perforin expression pre‐ and post‐treatment are shown. (c) Perforin – and perforin + CD8 + T cells were sorted. DNA was extracted and bisulfite‐converted from each cell subset, TA‐cloned to pCR4‐TOPO vector and transformed into TOP10 Escherichia coli . Colonies were picked from each cell subset and their DNA was sequenced to measure DNA methylation status of the 10 CpGs in the enhancer. The data display rows represent individually sequenced clone. (d) The bar graphs display total DNA methylation percentage in each CpG from clones in (c).

    Journal: Clinical and Experimental Immunology

    Article Title: Tissue‐resident memory T cells are epigenetically cytotoxic with signs of exhaustion in human urinary bladder cancer

    doi: 10.1111/cei.13183

    Figure Lengend Snippet: DNA methylation in the enhancer region regulates perforin transcription. (a) Promoter region sequence containing enhancer in the PRF1 gene was aligned between human and mouse using the VISTA tool. The conservation degree is indicated by the peaks, with coloured peaks (blue for exon and light red for the non‐coding sequence) indicating > 70% conservation. Ten cytosine–phosphate–guanine sites (CpGs) in the enhancer are displayed upstream from the transcription start site (TSS). (b) Sorted CD8 + T cells from healthy donors were cultured initially in the presence of 200 IU/ml recombinant human interleukin (IL)‐2, 5 μg/ml plate‐coated anti‐CD3 and 1 μg/ml anti‐CD28 stimulating antibodies in vitro . 5‐Azacytidine (5‐aza) was added to the culture at a final concentration of 2·5 μM/ml for 48 h, followed by culture medium replacement and incubation for another 48 h. Flow cytometry data demonstrating perforin expression pre‐ and post‐treatment are shown. (c) Perforin – and perforin + CD8 + T cells were sorted. DNA was extracted and bisulfite‐converted from each cell subset, TA‐cloned to pCR4‐TOPO vector and transformed into TOP10 Escherichia coli . Colonies were picked from each cell subset and their DNA was sequenced to measure DNA methylation status of the 10 CpGs in the enhancer. The data display rows represent individually sequenced clone. (d) The bar graphs display total DNA methylation percentage in each CpG from clones in (c).

    Article Snippet: Next, the PCR amplicons were TA‐cloned into pCR4‐TOPO vector (ThermoFisher) and transformed into TOP10 Escherichia coli (ThermoFisher) by heat shock, according to the manufacturer’s protocol.

    Techniques: DNA Methylation Assay, Sequencing, Cell Culture, Recombinant, In Vitro, Concentration Assay, Incubation, Flow Cytometry, Cytometry, Expressing, Clone Assay, Plasmid Preparation, Transformation Assay

    Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli TOP10 cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector pCR4-TOPO, pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.

    Journal: Frontiers in Microbiology

    Article Title: Discovery of Novel Antibiotic Resistance Determinants in Forest and Grassland Soil Metagenomes

    doi: 10.3389/fmicb.2019.00460

    Figure Lengend Snippet: Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli TOP10 cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector pCR4-TOPO, pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.

    Article Snippet: E. coli TOP10 carrying vector pCR4-TOPO (Thermo Fisher Scientific) was used as control.

    Techniques: Clone Assay, Plasmid Preparation

    Antibiotic susceptibility profiles of E. coli TOP10 carrying soil-derived genes involved in antibiotic resistance. The genes were subcloned into plasmid vector pCR4-TOPO. MICs of antibiotics were determined using the broth microdilution method and are presented as fold increase relative to those for E. coli TOP10 carrying the cloning vector pCR4-TOPO. CAX, cefotaxime; CHL, chloramphenicol; ERY, erythromycin; GEN, gentamicin; LIN, lincomycin; RIF, rifampicin; SDZ, sulfadiazine; SMX, sulfamethoxazole; SMZ, sulfamethazine; SOX, sulfisoxazole; TET, tetracycline; TYL, tylosin.

    Journal: Frontiers in Microbiology

    Article Title: Discovery of Novel Antibiotic Resistance Determinants in Forest and Grassland Soil Metagenomes

    doi: 10.3389/fmicb.2019.00460

    Figure Lengend Snippet: Antibiotic susceptibility profiles of E. coli TOP10 carrying soil-derived genes involved in antibiotic resistance. The genes were subcloned into plasmid vector pCR4-TOPO. MICs of antibiotics were determined using the broth microdilution method and are presented as fold increase relative to those for E. coli TOP10 carrying the cloning vector pCR4-TOPO. CAX, cefotaxime; CHL, chloramphenicol; ERY, erythromycin; GEN, gentamicin; LIN, lincomycin; RIF, rifampicin; SDZ, sulfadiazine; SMX, sulfamethoxazole; SMZ, sulfamethazine; SOX, sulfisoxazole; TET, tetracycline; TYL, tylosin.

    Article Snippet: E. coli TOP10 carrying vector pCR4-TOPO (Thermo Fisher Scientific) was used as control.

    Techniques: Derivative Assay, Plasmid Preparation, Clone Assay

    Representative SDS-PAGE, 2-dimensional electrophoresis (2DE), and Western blots showing the workflow for selection of immunoreactive spots. (A) The 1-dimensional SDS-PAGE image of Staphylococcus aureus Newbould 305 trypsinized protein (lane 1) and Escherichia coli trypsinized protein (lane 2). (B) 2DE gel conducted on 7 cm, pH 4 to 7, immobilized pH gradient (IPG) strips of S. aureus Newbould 305 trypsinized protein. Mr = molecular weight. (C) Immunoblot of S. aureus Newbould 305 trypsinized protein using pooled bovine mastitic milk, with immunoreactive regions highlighted in red circles. (D) 2DE gel conducted on 7 cm, pH 4 to 7, IPG strips of Escherichia coli DH10-β trypsinized protein. (E) Immunoblot of E. coli DH10-β trypsinized protein using bovine mastitic milk, with the immunoreactive regions highlighted in red circles. Color version available online.

    Journal: Journal of dairy science

    Article Title: Immunoproteomics to identify Staphylococcus aureus antigens expressed in bovine milk during mastitis

    doi: 10.3168/jds.2017-14040

    Figure Lengend Snippet: Representative SDS-PAGE, 2-dimensional electrophoresis (2DE), and Western blots showing the workflow for selection of immunoreactive spots. (A) The 1-dimensional SDS-PAGE image of Staphylococcus aureus Newbould 305 trypsinized protein (lane 1) and Escherichia coli trypsinized protein (lane 2). (B) 2DE gel conducted on 7 cm, pH 4 to 7, immobilized pH gradient (IPG) strips of S. aureus Newbould 305 trypsinized protein. Mr = molecular weight. (C) Immunoblot of S. aureus Newbould 305 trypsinized protein using pooled bovine mastitic milk, with immunoreactive regions highlighted in red circles. (D) 2DE gel conducted on 7 cm, pH 4 to 7, IPG strips of Escherichia coli DH10-β trypsinized protein. (E) Immunoblot of E. coli DH10-β trypsinized protein using bovine mastitic milk, with the immunoreactive regions highlighted in red circles. Color version available online.

    Article Snippet: Briefly, S. aureus Newbould 305, S. aureus C1, and Escherichia coli (DH10-β Top10, Thermo Fisher Scientific, Waltham, MA) were grown in LIM overnight to an optical density ( OD ) of 0.75 to 1.2 and harvested by centrifugation (6,000 × g for 10 min at 4°C), before washing 3 times with 1× PBS.

    Techniques: SDS Page, Electrophoresis, Two-Dimensional Gel Electrophoresis, Western Blot, Selection, Molecular Weight

    Recombinant expression of rNanI species corresponding to protease-cleaved NanI fragments. rNanI species corresponding to full-length NanI or the major 65-kDa chymotrypsin-cleaved or 60-kDa mouse SI fluid-cleaved NanI fragments were recombinantly expressed by using E. coli Top10 cells and the pTrc-HisB expression system. The rNanI species were then affinity enriched from the E. coli culture by using Talon resin and dialyzed overnight against PBS. Panel A shows the dialyzed samples subjected to SDS-PAGE and then either stained with Coomassie blue (left) or Western blotted for NanI (right). The relative amount of each enriched rNanI species was then determined by a protein assay. All experiments were performed in triplicate, and the mean results are shown. Error bars show standard deviations. # indicates a significant ( P

    Journal: Infection and Immunity

    Article Title: Native or Proteolytically Activated NanI Sialidase Enhances the Binding and Cytotoxic Activity of Clostridium perfringens Enterotoxin and Beta Toxin

    doi: 10.1128/IAI.00730-17

    Figure Lengend Snippet: Recombinant expression of rNanI species corresponding to protease-cleaved NanI fragments. rNanI species corresponding to full-length NanI or the major 65-kDa chymotrypsin-cleaved or 60-kDa mouse SI fluid-cleaved NanI fragments were recombinantly expressed by using E. coli Top10 cells and the pTrc-HisB expression system. The rNanI species were then affinity enriched from the E. coli culture by using Talon resin and dialyzed overnight against PBS. Panel A shows the dialyzed samples subjected to SDS-PAGE and then either stained with Coomassie blue (left) or Western blotted for NanI (right). The relative amount of each enriched rNanI species was then determined by a protein assay. All experiments were performed in triplicate, and the mean results are shown. Error bars show standard deviations. # indicates a significant ( P

    Article Snippet: E. coli Top10 cells (ThermoFisher) were routinely grown on LB medium (Fisher Scientific) supplemented with 100 μg/ml of ampicillin (Fisher Scientific), as indicated.

    Techniques: Recombinant, Expressing, SDS Page, Staining, Western Blot