top10 vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Thermo Fisher top10 vector
    Top10 Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/top10 vector/product/Thermo Fisher
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    top10 vector - by Bioz Stars, 2020-04
    88/100 stars

    Related Products / Commonly Used Together

    bcl-2 open-reading frame
    nested racer primer r2
    race pcr

    Images

    Related Articles

    Clone Assay:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing. .. mRNA Half-Life Studies Following treatment with the transcription inhibitor 5,6-dichloro-1-beta-D-ribobenzimidazole (DRB) (Sigma-Aldrich) total RNA was extracted using TRIzol reagent.

    Article Title: A gC1qR Prevents White Spot Syndrome Virus Replication in the Freshwater Crayfish Pacifastacus leniusculus ▿
    Article Snippet: .. The 5′ and 3′ RACE PCR products were cloned into TOP10 vector (Invitrogen) and sequenced. .. The nucleotide sequence of Pl ), respectively.

    Amplification:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing. .. mRNA Half-Life Studies Following treatment with the transcription inhibitor 5,6-dichloro-1-beta-D-ribobenzimidazole (DRB) (Sigma-Aldrich) total RNA was extracted using TRIzol reagent.

    Article Title: A gC1qR Prevents White Spot Syndrome Virus Replication in the Freshwater Crayfish Pacifastacus leniusculus ▿
    Article Snippet: Total RNA (at least 1 μg) was extracted from heart and converted into 5′ and 3′ RACE-Ready first-stand cDNA according to the SMARTer RACE cDNA amplification kit user manual (Clontech). .. The 5′ and 3′ RACE PCR products were cloned into TOP10 vector (Invitrogen) and sequenced.

    Synthesized:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: The 5’gene racer oligo was ligated to the RNA using T4 RNA ligase and the first strand cDNA was synthesized using random hexamers and superscript III RT. .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing.

    Isolation:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: 5’ R apid A mplification of c DNA E nds (RACE) To identify the 5'UTR, we used the rapid amplification of cDNA ends (RACE) kit (Invitrogen; San Diego, CA) on RNA isolated from HAECs according to the manufacturer’s instructions. .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing.

    Sequencing:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing. .. mRNA Half-Life Studies Following treatment with the transcription inhibitor 5,6-dichloro-1-beta-D-ribobenzimidazole (DRB) (Sigma-Aldrich) total RNA was extracted using TRIzol reagent.

    Polymerase Chain Reaction:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: Transcripts were identified by PCR using the gene racer primer R1 and primers specific to the M region (M1: 5’GTGGGGGAGGTTTTATTT-3’) or bcl-2 open reading frame (ORF1: 5’CGCTGGGAGAACAGGGTACGATAA -3’). .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing.

    Article Title: A gC1qR Prevents White Spot Syndrome Virus Replication in the Freshwater Crayfish Pacifastacus leniusculus ▿
    Article Snippet: .. The 5′ and 3′ RACE PCR products were cloned into TOP10 vector (Invitrogen) and sequenced. .. The nucleotide sequence of Pl ), respectively.

    Rapid Amplification of cDNA Ends:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: 5’ R apid A mplification of c DNA E nds (RACE) To identify the 5'UTR, we used the rapid amplification of cDNA ends (RACE) kit (Invitrogen; San Diego, CA) on RNA isolated from HAECs according to the manufacturer’s instructions. .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing.

    Article Title: A gC1qR Prevents White Spot Syndrome Virus Replication in the Freshwater Crayfish Pacifastacus leniusculus ▿
    Article Snippet: Then, 5′ RACE (5′ rapid amplification of cDNA ends) PCR was performed by using the gene specific primer of Pl gC1qR-R (above experiment) and the SMART universal primer A mix. .. The 5′ and 3′ RACE PCR products were cloned into TOP10 vector (Invitrogen) and sequenced.

    Plasmid Preparation:

    Article Title: A Genetic Variant of p53 Restricts the Mucus Secretory Phenotype by Regulating SPDEF and Bcl-2 Expression
    Article Snippet: .. Amplification using nested racer primer R2 and gene-specific primers specific to the M region (M2: 5’-ATGACTGCTACGAAGTTCTCCC-3’) and the bcl-2 open-reading frame (ORF2: 5’-TGGCGCACGCTGGGAGAACA-3) were used to ensure specificity of products, followed by cloning into TOP10 vector (Invitrogen, CA) for sequencing. .. mRNA Half-Life Studies Following treatment with the transcription inhibitor 5,6-dichloro-1-beta-D-ribobenzimidazole (DRB) (Sigma-Aldrich) total RNA was extracted using TRIzol reagent.

    Article Title: A gC1qR Prevents White Spot Syndrome Virus Replication in the Freshwater Crayfish Pacifastacus leniusculus ▿
    Article Snippet: .. The 5′ and 3′ RACE PCR products were cloned into TOP10 vector (Invitrogen) and sequenced. .. The nucleotide sequence of Pl ), respectively.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher topo ta cloning kit
    Topo Ta Cloning Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 3762 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/topo ta cloning kit/product/Thermo Fisher
    Average 99 stars, based on 3762 article reviews
    Price from $9.99 to $1999.99
    topo ta cloning kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher e coli top10 carrying vector pcr4 topo
    Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli <t>TOP10</t> cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector <t>pCR4-TOPO,</t> pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.
    E Coli Top10 Carrying Vector Pcr4 Topo, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli top10 carrying vector pcr4 topo/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli top10 carrying vector pcr4 topo - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    99
    Thermo Fisher one shot top10
    Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli <t>TOP10</t> cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector <t>pCR4-TOPO,</t> pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.
    One Shot Top10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 180 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one shot top10/product/Thermo Fisher
    Average 99 stars, based on 180 article reviews
    Price from $9.99 to $1999.99
    one shot top10 - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli TOP10 cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector pCR4-TOPO, pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.

    Journal: Frontiers in Microbiology

    Article Title: Discovery of Novel Antibiotic Resistance Determinants in Forest and Grassland Soil Metagenomes

    doi: 10.3389/fmicb.2019.00460

    Figure Lengend Snippet: Resistance against sulfonamide antibiotics mediated by SEW2_dhps01, SEW5_dhps01, AEW9_dhps01 , and AEG2_dhps01 . Five microliters of serially diluted E. coli TOP10 cultures with starting OD 600 of 0.5 were spotted onto Iso-Sensitest agar plates supplemented with 1000 mg/L sulfamethazine (+ SMZ), 250 mg/L sulfamethoxazole (+ SMX), 250 mg/L sulfadiazine (+ SDZ) or 500 mg/L sulfisoxazole (+ SOX). Iso-Sensitest agar plates with no sulfonamide added (control) were also included. E. coli TOP10 cultures carrying the cloning vector pCR4-TOPO, pCR4_SEW2_dhps01, pCR4_SEW5_dhps01, pCR4_AEW9_dhps01 or pCR4_AEG2_dhps01 were considered.

    Article Snippet: E. coli TOP10 carrying vector pCR4-TOPO (Thermo Fisher Scientific) was used as control.

    Techniques: Clone Assay, Plasmid Preparation

    Antibiotic susceptibility profiles of E. coli TOP10 carrying soil-derived genes involved in antibiotic resistance. The genes were subcloned into plasmid vector pCR4-TOPO. MICs of antibiotics were determined using the broth microdilution method and are presented as fold increase relative to those for E. coli TOP10 carrying the cloning vector pCR4-TOPO. CAX, cefotaxime; CHL, chloramphenicol; ERY, erythromycin; GEN, gentamicin; LIN, lincomycin; RIF, rifampicin; SDZ, sulfadiazine; SMX, sulfamethoxazole; SMZ, sulfamethazine; SOX, sulfisoxazole; TET, tetracycline; TYL, tylosin.

    Journal: Frontiers in Microbiology

    Article Title: Discovery of Novel Antibiotic Resistance Determinants in Forest and Grassland Soil Metagenomes

    doi: 10.3389/fmicb.2019.00460

    Figure Lengend Snippet: Antibiotic susceptibility profiles of E. coli TOP10 carrying soil-derived genes involved in antibiotic resistance. The genes were subcloned into plasmid vector pCR4-TOPO. MICs of antibiotics were determined using the broth microdilution method and are presented as fold increase relative to those for E. coli TOP10 carrying the cloning vector pCR4-TOPO. CAX, cefotaxime; CHL, chloramphenicol; ERY, erythromycin; GEN, gentamicin; LIN, lincomycin; RIF, rifampicin; SDZ, sulfadiazine; SMX, sulfamethoxazole; SMZ, sulfamethazine; SOX, sulfisoxazole; TET, tetracycline; TYL, tylosin.

    Article Snippet: E. coli TOP10 carrying vector pCR4-TOPO (Thermo Fisher Scientific) was used as control.

    Techniques: Derivative Assay, Plasmid Preparation, Clone Assay