Structured Review

Eppendorf AG thermocycler
Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a <t>thermocycler.</t> (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).
Thermocycler, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 99/100, based on 480 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermocycler/product/Eppendorf AG
Average 99 stars, based on 480 article reviews
Price from $9.99 to $1999.99
thermocycler - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa"

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa

Journal: PLoS ONE

doi: 10.1371/journal.pone.0094664

Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).
Figure Legend Snippet: Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).

Techniques Used: Lamp Assay, SYBR Green Assay, Agarose Gel Electrophoresis, Staining, Blocking Assay, Molecular Weight, Marker

Related Articles

Centrifugation:

Article Title: A comparative multi-parametric in vitro model identifies the power of test conditions to predict the fibrotic tendency of a biomaterial
Article Snippet: Experiments with blood samples were conducted in compliance with the rules for investigation on human subjects, as defined in the Declaration of Helsinki. .. Citrate-buffered autologous plasma was separated from human whole blood by centrifugation at 2500 x standard gravity (g0 ) for 15 min. For each donor, partial volumes of the obtained human plasma were heat inactivated for 1 h at 56 °C (Thermocycler, Eppendorf, Hamburg, Germany). .. Heat-inactivated and native plasma was stored at −80 °C.

Amplification:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: The LAMP assay was performed using the Loopamp DNA amplification Kit (Eiken Chemicals Co., Tokyo, Japan) following manufacturer's instructions. .. To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction.

Article Title: Blood meal sources of wild and domestic Triatoma infestans (Hemiptera: Reduviidae) in Bolivia: connectivity between cycles of transmission of Trypanosoma cruzi
Article Snippet: PCR amplification of a 355 bp Cytb fragment (PCR-Cytb ) was achieved with the set of primers previously described in Lee et al. (2002) [ ]. .. Amplification was performed in a thermocycler (Mastercycler, Eppendorf, Hamburg, Germany). .. Heteroduplex (HDA) chains subsequently formed were analysed by polyacrylamide gel electrophoresis according to Buitrago et al. (2012) [ ] using human DNA as a driver.

Article Title: In Silico Analysis of the cadF Gene and Development of a Duplex Polymerase Chain Reaction for Species-Specific Identification of Campylobacter jejuni and Campylobacter coli
Article Snippet: The duplex-PCR was carried out in a 25-μL reaction mixture, containing 10 ng of DNA template extracted by the boiling method, 2.5 μL PCR buffer 10X, 200 μM dNTP, 5 mM MgCl2 , 0.1 μM of each primer, 1 unit of Taq DNA polymerase, and sterile deionized water ( , ). .. Amplification conditions were 95°C for three minutes (one cycle), then denaturation at 94°C for 30 seconds, annealing at 43°C for 30 seconds and extension at 72°C for 30 seconds for 32 cycles in a thermocycler (Eppendorf, Hamburg, Germany). .. Finally, an additional extension step (five minutes, 72°C) was carried out.

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: Positive controls from the collection of the Biotechnology Research Centre, Islamic Azad University, Iran, were included in each PCR reaction, while sterile distilled water was used as the negative controls. .. The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany). .. PCR reaction for EHV-1 was performed as follows (30 cycles): denaturation at 94°C for 60 s, annealing at 65°C for 60 s, extension at 72°C for 60 s, and then final incubation at 72°C for 7 min. PCR reaction for EHV-4 was performed as follows (33 cycles): denaturation at 94°C for 60 s, annealing at 66°C for 60 s, extension at 72°C for 60 s, and then final incubation at 72°C for 5 min.

Article Title: Population Genetic Analysis Reveals a High Genetic Diversity in the Brazilian Cryptococcus gattii VGII Population and Shifts the Global Origin from the Amazon Rainforest to the Semi-arid Desert in the Northeast of Brazil
Article Snippet: Amplifications of the pheromone genes MATalpha and MAT a were performed independently, in a final volume of 50μL containing 50 ng of DNA, 1X PCR buffer [200 mM Tris-HCl (pH 8.4), 500 mM KCl—Invitrogen], 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Invitrogen), 2 mM magnesium cloride, 2.5 U Taq DNA polymerase (Invitrogen), and 50 ng of each primer. .. The amplification was carried out in a thermocycler (Eppendorf mastercycler gradient, California, USA) at 95°C for 3-min initial denaturation, 30 cycles at 94°C for 1 min, annealing at 57.5°C for 1 min, extension at 72°C for 1 min, and a final extension at 72°C for 7 min. .. The unique fragment corresponding to each mating type was visualized after 3% agarose gel electrophoresis at 100 V.

Article Title: A novel non-invasive diagnostic sampling technique for cutaneous leishmaniasis
Article Snippet: PCR mixtures contained 4mM MgCl2 , 0.5mM dNTP, 1 Unit of Taq DNA polymerase (Roche, Germany) and 40ng of each primer in a final volume of 50μl. .. Amplification conditions in an eppendorf thermocycler (Germany) were as follows: 95°C for 5min, 62°C for 1min, 72°C for 1min, 95°C for 45 sec, 65°C for 30 sec, 72°C for 30 sec (30 cycle), 72°C for 5 min. Amplification products were subjected to electrophoresis in 1% agarose in 0.5 X TBE (0.045M Tris-borate, 1mM EDTA) buffer. .. DNA purified from cultured promastigotes of L . major and L . tropica as reference strains was amplified in each PCR experiment as positive control.

Article Title: Analysis of Salmonella enterica Serovar Typhi by Outer Membrane Protein (OMP) Profiling, Random Amplification of Polymorphic DNA (RAPD) and Pulsed Field Gel Electrophoresis (PFGE)
Article Snippet: Paragraph title: RAPD (Random Amplification of Polymorphic DNA) ... PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min.

Article Title: Effects of antimony on redox activities and antioxidant defence systems in sunflower (Helianthus annuus L.) plants
Article Snippet: The reaction was done in a thermocycler (Eppendorf, Hauppauge, NY, USA) with a first stage at 25°C for 10 min, followed by a stage at 37°C for 120 min, and a final stage at 85°C for 5 min, obtaining single-stranded cDNA. .. Semi-quantitative reverse-transcription PCR amplification of actin cDNA was chosen as control.

Article Title: Detection of Chlamydia trachomatis in Pap Smear Samples from South Khorasan Province of Iran
Article Snippet: Paragraph title: Amplification of ß-globin and Omp1 gene ... First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes.

Synthesized:

Article Title: In Silico Analysis of the cadF Gene and Development of a Duplex Polymerase Chain Reaction for Species-Specific Identification of Campylobacter jejuni and Campylobacter coli
Article Snippet: Oligonucleotide primers were synthesized by TAG Copenhagen (Denmark). .. Amplification conditions were 95°C for three minutes (one cycle), then denaturation at 94°C for 30 seconds, annealing at 43°C for 30 seconds and extension at 72°C for 30 seconds for 32 cycles in a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: First strand cDNA was synthesized using ~2 µg of RNA from each sample, random hexamers and Superscript IITM (Invitrogen, Inc, CA) at 42 °C for 2 hours. .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Article Title: [68Ga]pentixafor for CXCR4 imaging in a PC-3 prostate cancer xenograft model – comparison with [18F]FDG PET/CT, MRI and ex vivo receptor expression
Article Snippet: Afterwards cDNA was synthesized from 2 μg total RNA using SuperScript TM First Strand Synthese System (Invitrogen, USA). .. PCR was performed as follows: first denaturation step at 90°C for 5 min and 30 cycles of 94°C for 15 s, 61°C for 30 s and 72°C for 10 s with a final extension at 72 °C for 10 min using a thermocycler (Eppendorf Mastercycler Gradient, New York, NY, USA).

Article Title: Effects of antimony on redox activities and antioxidant defence systems in sunflower (Helianthus annuus L.) plants
Article Snippet: First-strand cDNA was synthesized using "High Capacity cDNA Reverse Transcription Kits" (Applied Biosystems): 2.0 μL of 10 x RT buffer, 0.8 μL of 25 x dNTP mix (100 mM), 2 μL 10 x RT random primers, 1.0 μL of MultiScribe™ reverse transcriptase, 1.0 μL RNase inhibitor, 3.2 μL nuclease-free H2 O, and 10 μL of RNA. .. The reaction was done in a thermocycler (Eppendorf, Hauppauge, NY, USA) with a first stage at 25°C for 10 min, followed by a stage at 37°C for 120 min, and a final stage at 85°C for 5 min, obtaining single-stranded cDNA.

Blocking Assay:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: Briefly, the reaction was carried out with a total of 25 μL reaction mixture containing 12.5 μL of 2x Reaction Mix, 40 pmol of each FIP and BIP primers, 5 pmol of each F3 and B3 primers, 1 μL of Bst -DNA polymerase, along with 2 μL of DNA template. .. To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction. .. Because of the highly sensitivity of LAMP reaction, DNA contamination and carry-over of amplified products were prevented by using sterile tools at all times, performing each step of the analysis in separate work areas, minimizing manipulation of the reaction tubes and closing them with flexible parafilm.

SYBR Green Assay:

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany). .. Real time PCR analyses were performed using the Opticon PCR machine (MJ Research, Waltham, MA).

Incubation:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: Briefly, the reaction was carried out with a total of 25 μL reaction mixture containing 12.5 μL of 2x Reaction Mix, 40 pmol of each FIP and BIP primers, 5 pmol of each F3 and B3 primers, 1 μL of Bst -DNA polymerase, along with 2 μL of DNA template. .. To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction. .. Because of the highly sensitivity of LAMP reaction, DNA contamination and carry-over of amplified products were prevented by using sterile tools at all times, performing each step of the analysis in separate work areas, minimizing manipulation of the reaction tubes and closing them with flexible parafilm.

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: Reverse transcription was performed in a one-step protocol using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s protocols. .. Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany). .. Primers ( ) were designed by Genetool software (BioTools Inc., Edmonton, Canada) and oligonucleotides were synthesized by Sigma Genosys (Sigma- Genosys Ltd., Woodlands, TX).

Formalin-fixed Paraffin-Embedded:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: Formalin-fixed paraffin-embedded (FFPE) tissue blocks of each sample were cut for multiple unstained slides. .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Spectrophotometry:

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: All RNA was quantified by spectrophotometer, and the optical density 260/280 nm ratios were determined. .. Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Activation of antioxidant defences of human mammary epithelial cells under leptin depend on neoplastic state
Article Snippet: After treatment with leptin, total RNA were isolated from the epithelial cells by Trizol® reagent (Invitrogen, Saint-Aubin, France) according to the manufacturer’s protocol and quantified using a NanoDrop spectrophotometer (Nanodrop®2000, Thermo Scientific, Waltham, MA). .. Reverse transcription was performed in a thermocycler (Mastercycler ® gradient, Eppendorf, Montesson, France), on 1 μg of total RNA for each condition using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Saint Aubin, France) with random hexamer pdN6 primers.

Expressing:

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: Liver tissue was analyzed for hepatic mRNA expression of fructokinase (KHK). .. Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany).

Article Title: [68Ga]pentixafor for CXCR4 imaging in a PC-3 prostate cancer xenograft model – comparison with [18F]FDG PET/CT, MRI and ex vivo receptor expression
Article Snippet: Paragraph title: Analysis of ex vivo CXCR4 mRNA expression in tumor tissue by semiquantitative PCR ... PCR was performed as follows: first denaturation step at 90°C for 5 min and 30 cycles of 94°C for 15 s, 61°C for 30 s and 72°C for 10 s with a final extension at 72 °C for 10 min using a thermocycler (Eppendorf Mastercycler Gradient, New York, NY, USA).

Ex Vivo:

Article Title: [68Ga]pentixafor for CXCR4 imaging in a PC-3 prostate cancer xenograft model – comparison with [18F]FDG PET/CT, MRI and ex vivo receptor expression
Article Snippet: Paragraph title: Analysis of ex vivo CXCR4 mRNA expression in tumor tissue by semiquantitative PCR ... PCR was performed as follows: first denaturation step at 90°C for 5 min and 30 cycles of 94°C for 15 s, 61°C for 30 s and 72°C for 10 s with a final extension at 72 °C for 10 min using a thermocycler (Eppendorf Mastercycler Gradient, New York, NY, USA).

Countercurrent Chromatography:

Article Title: [68Ga]pentixafor for CXCR4 imaging in a PC-3 prostate cancer xenograft model – comparison with [18F]FDG PET/CT, MRI and ex vivo receptor expression
Article Snippet: PCR was performed as follows: first denaturation step at 90°C for 5 min and 30 cycles of 94°C for 15 s, 61°C for 30 s and 72°C for 10 s with a final extension at 72 °C for 10 min using a thermocycler (Eppendorf Mastercycler Gradient, New York, NY, USA). .. Stained bands were visualized under UV light and photographed.

Article Title: Dietary pterostilbene is a novel MTA1-targeted chemopreventive and therapeutic agent in prostate cancer
Article Snippet: Tail-genotyping was performed using the following primers: PTEN geno olMR9554F:5′-CAA GCA CTC TGC GAA CTG AG-3′; PTEN geno olMR9555R:5′-AAG TTT TTG AAG GCA AGA TGC-3′ with wt band of 156 bp and mutant band of 328 bp; and Cre F: 5′-TCG CGA TTA TCT TCT ATA TCT TCA G-3′; Cre R: 5′-GCT CGA CCA GTT TAG TTA CCC-3′ with a band of 393 bp. .. PCR was performed on an Eppendorf thermocycler.

Article Title: The Per-1 Short Isoform Inhibits de novo HIV-1 Transcription in Resting CD4+ T-cells
Article Snippet: Briefly, the following primers were used for the preamplification of genomic DNA: Alu forward, 5′-GCC TCC CAA AGT GCT GGG ATT ACA G-3′; and HIV-1 gag reverse, 5′-GCT CTC GCA CCC ATC TCT CTC C-3′. .. The Thermocycler (Eppendorf Mastercycler Pro Cycler) was programmed to perform a 2 min hot start at 94 °C, followed by 30 rounds of denaturation at 93 °C for 30 s, annealing at 50 °C for 1 min, and extension at 70 °C for 1 min 40 s. To quantify HIV-1 integration, a second round of real-time qPCR was performed using 2 μL of the material from the preamplification step.

Polymerase Chain Reaction:

Article Title: Blood meal sources of wild and domestic Triatoma infestans (Hemiptera: Reduviidae) in Bolivia: connectivity between cycles of transmission of Trypanosoma cruzi
Article Snippet: PCR amplification of a 355 bp Cytb fragment (PCR-Cytb ) was achieved with the set of primers previously described in Lee et al. (2002) [ ]. .. Amplification was performed in a thermocycler (Mastercycler, Eppendorf, Hamburg, Germany).

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany). .. Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany).

Article Title: In Silico Analysis of the cadF Gene and Development of a Duplex Polymerase Chain Reaction for Species-Specific Identification of Campylobacter jejuni and Campylobacter coli
Article Snippet: Paragraph title: 3.3. Designing a Duplex Polymerase Chain Reaction Assay for Specific Detection of Campylobacter jejuni and C. coli ... Amplification conditions were 95°C for three minutes (one cycle), then denaturation at 94°C for 30 seconds, annealing at 43°C for 30 seconds and extension at 72°C for 30 seconds for 32 cycles in a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: First strand cDNA was synthesized using ~2 µg of RNA from each sample, random hexamers and Superscript IITM (Invitrogen, Inc, CA) at 42 °C for 2 hours. .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler). .. A negative control and synthetic positive control were included in each batch of reactions.

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: Positive controls from the collection of the Biotechnology Research Centre, Islamic Azad University, Iran, were included in each PCR reaction, while sterile distilled water was used as the negative controls. .. The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Population Genetic Analysis Reveals a High Genetic Diversity in the Brazilian Cryptococcus gattii VGII Population and Shifts the Global Origin from the Amazon Rainforest to the Semi-arid Desert in the Northeast of Brazil
Article Snippet: Amplifications of the pheromone genes MATalpha and MAT a were performed independently, in a final volume of 50μL containing 50 ng of DNA, 1X PCR buffer [200 mM Tris-HCl (pH 8.4), 500 mM KCl—Invitrogen], 0.2 mM each of dATP, dCTP, dGTP, and dTTP (Invitrogen), 2 mM magnesium cloride, 2.5 U Taq DNA polymerase (Invitrogen), and 50 ng of each primer. .. The amplification was carried out in a thermocycler (Eppendorf mastercycler gradient, California, USA) at 95°C for 3-min initial denaturation, 30 cycles at 94°C for 1 min, annealing at 57.5°C for 1 min, extension at 72°C for 1 min, and a final extension at 72°C for 7 min.

Article Title: [68Ga]pentixafor for CXCR4 imaging in a PC-3 prostate cancer xenograft model – comparison with [18F]FDG PET/CT, MRI and ex vivo receptor expression
Article Snippet: The PCR reaction mixture of CXCR4 as well as GAPDH contained 6,25 μL of 2x Kappa biosystem reaction buffer, 1 μg cDNA, 10 μM of each of forward and reverse primers in a final volume of 12,5 μL. .. PCR was performed as follows: first denaturation step at 90°C for 5 min and 30 cycles of 94°C for 15 s, 61°C for 30 s and 72°C for 10 s with a final extension at 72 °C for 10 min using a thermocycler (Eppendorf Mastercycler Gradient, New York, NY, USA). .. PCR products were run on 2% agarose gel containing 1xGelStar TM nucleic acid gel stain from Biotium (Hayward, CA, USA).

Article Title: Dietary pterostilbene is a novel MTA1-targeted chemopreventive and therapeutic agent in prostate cancer
Article Snippet: Tail-genotyping was performed using the following primers: PTEN geno olMR9554F:5′-CAA GCA CTC TGC GAA CTG AG-3′; PTEN geno olMR9555R:5′-AAG TTT TTG AAG GCA AGA TGC-3′ with wt band of 156 bp and mutant band of 328 bp; and Cre F: 5′-TCG CGA TTA TCT TCT ATA TCT TCA G-3′; Cre R: 5′-GCT CGA CCA GTT TAG TTA CCC-3′ with a band of 393 bp. .. PCR was performed on an Eppendorf thermocycler. .. We used male Pb-Cre4 ; Pten +/f prostate-specific heterozygous mice (abbreviated as Pten +/f in the text and figures) in experiments with dietary supplementation of pterostilbene, and male Pb-Cre4 ; Pten f/f prostate-specific knockout mice (abbreviated as Pten f/f in the text and figures) in experiments with i.p. injections of pterostilbene.

Article Title: A novel non-invasive diagnostic sampling technique for cutaneous leishmaniasis
Article Snippet: Paragraph title: PCR amplification and identification of parasite species ... Amplification conditions in an eppendorf thermocycler (Germany) were as follows: 95°C for 5min, 62°C for 1min, 72°C for 1min, 95°C for 45 sec, 65°C for 30 sec, 72°C for 30 sec (30 cycle), 72°C for 5 min. Amplification products were subjected to electrophoresis in 1% agarose in 0.5 X TBE (0.045M Tris-borate, 1mM EDTA) buffer.

Article Title: Analysis of Salmonella enterica Serovar Typhi by Outer Membrane Protein (OMP) Profiling, Random Amplification of Polymorphic DNA (RAPD) and Pulsed Field Gel Electrophoresis (PFGE)
Article Snippet: Extracted DNA was further subjected to RAPD using a PCR buffer system containing Tris-HCl (10 mM, pH 9.0), KCl (50 mM), MgCl2 (2.5 mM), gelatin (0.01%), Triton X-100 (0.1%), 0.2 mM of each of the deoxynucleotide triphosphates, primer (50 pmol), and Taq polymerase (0.2 U) (Fermentas International Inc., Canada). .. PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min. .. The primer used to differentiate Salmonella enterica serovar .

Article Title: The Per-1 Short Isoform Inhibits de novo HIV-1 Transcription in Resting CD4+ T-cells
Article Snippet: Alu forward primer (100 nM), 600 nM of the gag reverse primer, and 1 μL of gDNA were used for every 20 μL of the PCR solution. .. The Thermocycler (Eppendorf Mastercycler Pro Cycler) was programmed to perform a 2 min hot start at 94 °C, followed by 30 rounds of denaturation at 93 °C for 30 s, annealing at 50 °C for 1 min, and extension at 70 °C for 1 min 40 s. To quantify HIV-1 integration, a second round of real-time qPCR was performed using 2 μL of the material from the preamplification step.

Article Title: Effects of antimony on redox activities and antioxidant defence systems in sunflower (Helianthus annuus L.) plants
Article Snippet: The reaction was done in a thermocycler (Eppendorf, Hauppauge, NY, USA) with a first stage at 25°C for 10 min, followed by a stage at 37°C for 120 min, and a final stage at 85°C for 5 min, obtaining single-stranded cDNA. .. Semi-quantitative reverse-transcription PCR amplification of actin cDNA was chosen as control.

Article Title: Bacteria colonising Penstemon digitalis show volatile and tissue-specific responses to a natural concentration range of the floral volatile linalool
Article Snippet: The following conditions were used for extraction: 1 µl genomic DNA was dissolved in 21.9 µl sterile distilled water (dH20), 6 µl of 10-fold reaction buffer (Moltaq PCR kit, Molzym GmbH and Co.KG, Bremen, Germany) and 10 mM dNTP-mix (Thermo Scientific, Munich, Germany). .. A thermocycler (Eppendorf Mastercycler gradient, Hamburg, Germany) with the following programme was used: initial denaturation at 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 100 s and a final extension step at 72 °C for 5 min.

Sequencing:

Article Title: In Silico Analysis of the cadF Gene and Development of a Duplex Polymerase Chain Reaction for Species-Specific Identification of Campylobacter jejuni and Campylobacter coli
Article Snippet: Other reverse primers, R2 (position 542 - 561) and R3 (position 818 - 837), were designed in this study using the Genrunner and CLC sequence viewer software ( ). .. Amplification conditions were 95°C for three minutes (one cycle), then denaturation at 94°C for 30 seconds, annealing at 43°C for 30 seconds and extension at 72°C for 30 seconds for 32 cycles in a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Bacteria colonising Penstemon digitalis show volatile and tissue-specific responses to a natural concentration range of the floral volatile linalool
Article Snippet: A thermocycler (Eppendorf Mastercycler gradient, Hamburg, Germany) with the following programme was used: initial denaturation at 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 100 s and a final extension step at 72 °C for 5 min. .. PCR products were purified with the Wizard SV Gel and PCR clean-up kit (Promega, USA) according to the instructions of the producer.

Cellular Antioxidant Activity Assay:

Article Title: The Per-1 Short Isoform Inhibits de novo HIV-1 Transcription in Resting CD4+ T-cells
Article Snippet: Briefly, the following primers were used for the preamplification of genomic DNA: Alu forward, 5′-GCC TCC CAA AGT GCT GGG ATT ACA G-3′; and HIV-1 gag reverse, 5′-GCT CTC GCA CCC ATC TCT CTC C-3′. .. The Thermocycler (Eppendorf Mastercycler Pro Cycler) was programmed to perform a 2 min hot start at 94 °C, followed by 30 rounds of denaturation at 93 °C for 30 s, annealing at 50 °C for 1 min, and extension at 70 °C for 1 min 40 s. To quantify HIV-1 integration, a second round of real-time qPCR was performed using 2 μL of the material from the preamplification step.

DNA Extraction:

Article Title: Blood meal sources of wild and domestic Triatoma infestans (Hemiptera: Reduviidae) in Bolivia: connectivity between cycles of transmission of Trypanosoma cruzi
Article Snippet: DNA extraction from intestinal contents of the digestive tracts was performed with QIAamp DNA mini kit (Qiagen, Courtaboeuf, France) according to the recommended protocol for blood samples, with minor modifications as described by Buitrago et al. (2012) [ ]. .. Amplification was performed in a thermocycler (Mastercycler, Eppendorf, Hamburg, Germany).

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: Viral genomic DNA in the blood samples was extracted using DNA extraction kit (Cinnagen, Tehran, Iran) following the manufacturer's instruction. .. The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany).

Marker:

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany). .. Analysis of the PCR products was performed in 1.5% horizontal agarose gel electrophoresis stained with ethidium bromide under UV light.

Mutagenesis:

Article Title: Dietary pterostilbene is a novel MTA1-targeted chemopreventive and therapeutic agent in prostate cancer
Article Snippet: Tail-genotyping was performed using the following primers: PTEN geno olMR9554F:5′-CAA GCA CTC TGC GAA CTG AG-3′; PTEN geno olMR9555R:5′-AAG TTT TTG AAG GCA AGA TGC-3′ with wt band of 156 bp and mutant band of 328 bp; and Cre F: 5′-TCG CGA TTA TCT TCT ATA TCT TCA G-3′; Cre R: 5′-GCT CGA CCA GTT TAG TTA CCC-3′ with a band of 393 bp. .. PCR was performed on an Eppendorf thermocycler.

Isolation:

Article Title: A comparative multi-parametric in vitro model identifies the power of test conditions to predict the fibrotic tendency of a biomaterial
Article Snippet: Paragraph title: Plasma isolation from whole blood ... Citrate-buffered autologous plasma was separated from human whole blood by centrifugation at 2500 x standard gravity (g0 ) for 15 min. For each donor, partial volumes of the obtained human plasma were heat inactivated for 1 h at 56 °C (Thermocycler, Eppendorf, Hamburg, Germany).

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: Paragraph title: mRNA Isolation, Reverse Transcription, and Real-Time PCR of KHK, Fatty acid synthase (FAS), and xanthine dehydrogenase/oxidase (XO) from Human Liver Tissue ... Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany).

Article Title: A novel non-invasive diagnostic sampling technique for cutaneous leishmaniasis
Article Snippet: Amplification conditions in an eppendorf thermocycler (Germany) were as follows: 95°C for 5min, 62°C for 1min, 72°C for 1min, 95°C for 45 sec, 65°C for 30 sec, 72°C for 30 sec (30 cycle), 72°C for 5 min. Amplification products were subjected to electrophoresis in 1% agarose in 0.5 X TBE (0.045M Tris-borate, 1mM EDTA) buffer. .. For species identification, the internal transcribed space 1 (ITS1) PCR assay was used with primers LITSR (5´CTGGATCATTTTCCGATG3´) and L5.8S (5´ TGATACCACTTATCGCACTT 3´) to amplify the ribosomal ITS1 region [ , ].

Article Title: Effects of antimony on redox activities and antioxidant defence systems in sunflower (Helianthus annuus L.) plants
Article Snippet: Paragraph title: RNA isolation and semi-quantitative RT-PCR ... The reaction was done in a thermocycler (Eppendorf, Hauppauge, NY, USA) with a first stage at 25°C for 10 min, followed by a stage at 37°C for 120 min, and a final stage at 85°C for 5 min, obtaining single-stranded cDNA.

Article Title: Activation of antioxidant defences of human mammary epithelial cells under leptin depend on neoplastic state
Article Snippet: Paragraph title: RNA isolation and reverse transcription ... Reverse transcription was performed in a thermocycler (Mastercycler ® gradient, Eppendorf, Montesson, France), on 1 μg of total RNA for each condition using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Saint Aubin, France) with random hexamer pdN6 primers.

Article Title: Bacteria colonising Penstemon digitalis show volatile and tissue-specific responses to a natural concentration range of the floral volatile linalool
Article Snippet: Paragraph title: Bacteria isolation and identification ... A thermocycler (Eppendorf Mastercycler gradient, Hamburg, Germany) with the following programme was used: initial denaturation at 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 100 s and a final extension step at 72 °C for 5 min.

Article Title: Detection of Chlamydia trachomatis in Pap Smear Samples from South Khorasan Province of Iran
Article Snippet: The isolated DNA was subjected to PCR using primers beta 1 (5.-TCAACCCTACAGTCACCCAT-3.) and beta 2 (5.-CTAACAATTACGAACAGCAATGAG- 3.), as previously described, to assess its integrity ( ). .. First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes.

Size-exclusion Chromatography:

Article Title: A novel non-invasive diagnostic sampling technique for cutaneous leishmaniasis
Article Snippet: PCR mixtures contained 4mM MgCl2 , 0.5mM dNTP, 1 Unit of Taq DNA polymerase (Roche, Germany) and 40ng of each primer in a final volume of 50μl. .. Amplification conditions in an eppendorf thermocycler (Germany) were as follows: 95°C for 5min, 62°C for 1min, 72°C for 1min, 95°C for 45 sec, 65°C for 30 sec, 72°C for 30 sec (30 cycle), 72°C for 5 min. Amplification products were subjected to electrophoresis in 1% agarose in 0.5 X TBE (0.045M Tris-borate, 1mM EDTA) buffer. .. DNA purified from cultured promastigotes of L . major and L . tropica as reference strains was amplified in each PCR experiment as positive control.

Purification:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler). .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Article Title: Bacteria colonising Penstemon digitalis show volatile and tissue-specific responses to a natural concentration range of the floral volatile linalool
Article Snippet: A thermocycler (Eppendorf Mastercycler gradient, Hamburg, Germany) with the following programme was used: initial denaturation at 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 100 s and a final extension step at 72 °C for 5 min. .. Positive and negative controls with and without genomic DNA were made for each set of samples during the PCR.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Effects of antimony on redox activities and antioxidant defence systems in sunflower (Helianthus annuus L.) plants
Article Snippet: Paragraph title: RNA isolation and semi-quantitative RT-PCR ... The reaction was done in a thermocycler (Eppendorf, Hauppauge, NY, USA) with a first stage at 25°C for 10 min, followed by a stage at 37°C for 120 min, and a final stage at 85°C for 5 min, obtaining single-stranded cDNA.

Nested PCR:

Article Title: Detection of Chlamydia trachomatis in Pap Smear Samples from South Khorasan Province of Iran
Article Snippet: First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes. .. First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes.

Mouse Assay:

Article Title: Dietary pterostilbene is a novel MTA1-targeted chemopreventive and therapeutic agent in prostate cancer
Article Snippet: Paragraph title: Generation of prostate-specific Pten heterozygous and knockout mice ... PCR was performed on an Eppendorf thermocycler.

Software:

Article Title: In Silico Analysis of the cadF Gene and Development of a Duplex Polymerase Chain Reaction for Species-Specific Identification of Campylobacter jejuni and Campylobacter coli
Article Snippet: Other reverse primers, R2 (position 542 - 561) and R3 (position 818 - 837), were designed in this study using the Genrunner and CLC sequence viewer software ( ). .. Amplification conditions were 95°C for three minutes (one cycle), then denaturation at 94°C for 30 seconds, annealing at 43°C for 30 seconds and extension at 72°C for 30 seconds for 32 cycles in a thermocycler (Eppendorf, Hamburg, Germany).

Real-time Polymerase Chain Reaction:

Article Title: Fructose Consumption as a Risk Factor for Non-alcoholic Fatty Liver Disease
Article Snippet: Paragraph title: mRNA Isolation, Reverse Transcription, and Real-Time PCR of KHK, Fatty acid synthase (FAS), and xanthine dehydrogenase/oxidase (XO) from Human Liver Tissue ... Reactions were incubated at 25°C for 5 minutes, and 42°C for 30 minutes, 85°C for 5 min and cooled at 4°C in a Thermocycler (Eppendorf, Hamburg, Germany).

Article Title: The Per-1 Short Isoform Inhibits de novo HIV-1 Transcription in Resting CD4+ T-cells
Article Snippet: Alu forward primer (100 nM), 600 nM of the gag reverse primer, and 1 μL of gDNA were used for every 20 μL of the PCR solution. .. The Thermocycler (Eppendorf Mastercycler Pro Cycler) was programmed to perform a 2 min hot start at 94 °C, followed by 30 rounds of denaturation at 93 °C for 30 s, annealing at 50 °C for 1 min, and extension at 70 °C for 1 min 40 s. To quantify HIV-1 integration, a second round of real-time qPCR was performed using 2 μL of the material from the preamplification step. .. The sequences of the primers used included LTR forward, 5′-GCC TCA ATA AAG CTT GCC TTGA-3′ and LTR reverse, 5′-TCC ACA CTG ACT AAA AGG GTC TGA-3′.

RNA Extraction:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis and detection of fusion genes ... One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Agarose Gel Electrophoresis:

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany). .. PCR reaction for EHV-1 was performed as follows (30 cycles): denaturation at 94°C for 60 s, annealing at 65°C for 60 s, extension at 72°C for 60 s, and then final incubation at 72°C for 7 min. PCR reaction for EHV-4 was performed as follows (33 cycles): denaturation at 94°C for 60 s, annealing at 66°C for 60 s, extension at 72°C for 60 s, and then final incubation at 72°C for 5 min.

Article Title: Analysis of Salmonella enterica Serovar Typhi by Outer Membrane Protein (OMP) Profiling, Random Amplification of Polymorphic DNA (RAPD) and Pulsed Field Gel Electrophoresis (PFGE)
Article Snippet: PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min. .. PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min.

Article Title: Detection of Chlamydia trachomatis in Pap Smear Samples from South Khorasan Province of Iran
Article Snippet: First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes. .. First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes.

Electrophoresis:

Article Title: A novel non-invasive diagnostic sampling technique for cutaneous leishmaniasis
Article Snippet: PCR mixtures contained 4mM MgCl2 , 0.5mM dNTP, 1 Unit of Taq DNA polymerase (Roche, Germany) and 40ng of each primer in a final volume of 50μl. .. Amplification conditions in an eppendorf thermocycler (Germany) were as follows: 95°C for 5min, 62°C for 1min, 72°C for 1min, 95°C for 45 sec, 65°C for 30 sec, 72°C for 30 sec (30 cycle), 72°C for 5 min. Amplification products were subjected to electrophoresis in 1% agarose in 0.5 X TBE (0.045M Tris-borate, 1mM EDTA) buffer. .. DNA purified from cultured promastigotes of L . major and L . tropica as reference strains was amplified in each PCR experiment as positive control.

Article Title: Analysis of Salmonella enterica Serovar Typhi by Outer Membrane Protein (OMP) Profiling, Random Amplification of Polymorphic DNA (RAPD) and Pulsed Field Gel Electrophoresis (PFGE)
Article Snippet: PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min. .. PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min.

Random Hexamer Labeling:

Article Title: Activation of antioxidant defences of human mammary epithelial cells under leptin depend on neoplastic state
Article Snippet: After treatment with leptin, total RNA were isolated from the epithelial cells by Trizol® reagent (Invitrogen, Saint-Aubin, France) according to the manufacturer’s protocol and quantified using a NanoDrop spectrophotometer (Nanodrop®2000, Thermo Scientific, Waltham, MA). .. Reverse transcription was performed in a thermocycler (Mastercycler ® gradient, Eppendorf, Montesson, France), on 1 μg of total RNA for each condition using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Saint Aubin, France) with random hexamer pdN6 primers. .. qPCR was performed using SYBR®Green reagents according to the manufacturer’s instructions on a StepOne system (Applied Biosystems, Saint-Aubin, France).

Knock-Out:

Article Title: Dietary pterostilbene is a novel MTA1-targeted chemopreventive and therapeutic agent in prostate cancer
Article Snippet: Paragraph title: Generation of prostate-specific Pten heterozygous and knockout mice ... PCR was performed on an Eppendorf thermocycler.

Concentration Assay:

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: Concentration of extracted DNA from each blood sample was measured spectrophotometrically at 260 nm optical density following the method described by Sambrook and Russell [ ]. .. The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Effects of antimony on redox activities and antioxidant defence systems in sunflower (Helianthus annuus L.) plants
Article Snippet: After extraction, the concentration of the extract was determined by biophotometry (Eppendorf, Hauppauge, NY, USA), calculating the A260 /A280 ratio. .. The reaction was done in a thermocycler (Eppendorf, Hauppauge, NY, USA) with a first stage at 25°C for 10 min, followed by a stage at 37°C for 120 min, and a final stage at 85°C for 5 min, obtaining single-stranded cDNA.

Article Title: Bacteria colonising Penstemon digitalis show volatile and tissue-specific responses to a natural concentration range of the floral volatile linalool
Article Snippet: A thermocycler (Eppendorf Mastercycler gradient, Hamburg, Germany) with the following programme was used: initial denaturation at 94 °C for 3 min, 35 cycles of 94 °C for 30 s, 52 °C for 30 s, 72 °C for 100 s and a final extension step at 72 °C for 5 min. .. PCR products were purified with the Wizard SV Gel and PCR clean-up kit (Promega, USA) according to the instructions of the producer.

Article Title: Detection of Chlamydia trachomatis in Pap Smear Samples from South Khorasan Province of Iran
Article Snippet: The nested step was performed on 3 µl of the first-round PCR product as a template with inner primers NLI (5.-TTTGCCGCTTTGAGTTCTGCT-3.) and NRI (5.-CCGCAAGATTTTCTAGATTTC-3.) ( ) under reaction conditions identical to the first PCR except that the concentration of MgCl2 was 1 mM. .. First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes.

Lamp Assay:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: Paragraph title: LAMP assay ... To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction.

CTG Assay:

Article Title: Dietary pterostilbene is a novel MTA1-targeted chemopreventive and therapeutic agent in prostate cancer
Article Snippet: Tail-genotyping was performed using the following primers: PTEN geno olMR9554F:5′-CAA GCA CTC TGC GAA CTG AG-3′; PTEN geno olMR9555R:5′-AAG TTT TTG AAG GCA AGA TGC-3′ with wt band of 156 bp and mutant band of 328 bp; and Cre F: 5′-TCG CGA TTA TCT TCT ATA TCT TCA G-3′; Cre R: 5′-GCT CGA CCA GTT TAG TTA CCC-3′ with a band of 393 bp. .. PCR was performed on an Eppendorf thermocycler.

Staining:

Article Title: Molecular Detection of Equine Herpesvirus Types 1 and 4 Infection in Healthy Horses in Isfahan Central and Shahrekord Southwest Regions, Iran
Article Snippet: The amplification of EHV-1 and EHV-4 DNA was done using thermocycler (Eppendorf, Hamburg, Germany). .. PCR reaction for EHV-1 was performed as follows (30 cycles): denaturation at 94°C for 60 s, annealing at 65°C for 60 s, extension at 72°C for 60 s, and then final incubation at 72°C for 7 min. PCR reaction for EHV-4 was performed as follows (33 cycles): denaturation at 94°C for 60 s, annealing at 66°C for 60 s, extension at 72°C for 60 s, and then final incubation at 72°C for 5 min.

Article Title: [68Ga]pentixafor for CXCR4 imaging in a PC-3 prostate cancer xenograft model – comparison with [18F]FDG PET/CT, MRI and ex vivo receptor expression
Article Snippet: PCR was performed as follows: first denaturation step at 90°C for 5 min and 30 cycles of 94°C for 15 s, 61°C for 30 s and 72°C for 10 s with a final extension at 72 °C for 10 min using a thermocycler (Eppendorf Mastercycler Gradient, New York, NY, USA). .. PCR products were run on 2% agarose gel containing 1xGelStar TM nucleic acid gel stain from Biotium (Hayward, CA, USA).

Article Title: Analysis of Salmonella enterica Serovar Typhi by Outer Membrane Protein (OMP) Profiling, Random Amplification of Polymorphic DNA (RAPD) and Pulsed Field Gel Electrophoresis (PFGE)
Article Snippet: PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min. .. PCR reaction was put up in a thermocycler (Mastercycler, Eppendorf, New York, USA) using pre-denaturation step at 94°C for 4 min followed by 35 cycles of 94°C for 1 min, 25°C for 1 min and 74°C for 2 min.

Article Title: Detection of Chlamydia trachomatis in Pap Smear Samples from South Khorasan Province of Iran
Article Snippet: First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes. .. First- and second- round PCR reactions were performed using an Eppendorf thermocycler (Mastercycler Nexus, Eppendorf, Germany) under the following cycling conditions: 4 minutes preheating at 95ºC followed by 30 cycles of denaturation at 94ºC for 1 minutes, annealing at 57ºC for 1 minutes and extension at 72ºC for 1 minutes.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Eppendorf AG thermocycler
    Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a <t>thermocycler.</t> (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).
    Thermocycler, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 99/100, based on 504 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermocycler/product/Eppendorf AG
    Average 99 stars, based on 504 article reviews
    Price from $9.99 to $1999.99
    thermocycler - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).

    Journal: PLoS ONE

    Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa

    doi: 10.1371/journal.pone.0094664

    Figure Lengend Snippet: Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).

    Article Snippet: To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction.

    Techniques: Lamp Assay, SYBR Green Assay, Agarose Gel Electrophoresis, Staining, Blocking Assay, Molecular Weight, Marker

    Diagram of the protocol of in situ RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of in situ RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.

    Journal: Frontiers in Cellular Neuroscience

    Article Title: In situ RT-PCR Optimized for Electron Microscopy Allows Description of Subcellular Morphology of Target mRNA-Expressing Cells in the Brain

    doi: 10.3389/fncel.2017.00141

    Figure Lengend Snippet: Diagram of the protocol of in situ RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of in situ RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.

    Article Snippet: A gradient PCR was performed using the primers and mouse striatum cDNA to test distinct melting temperatures (Tm = 56, 58, and 60°C) in a conventional thermocycler (Mastercycler, Eppendorf, Hamburg, Germany).

    Techniques: In Situ, Reverse Transcription Polymerase Chain Reaction, Labeling, Electron Microscopy, Polymerase Chain Reaction