Structured Review

Eppendorf AG thermocycler
Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a <t>thermocycler.</t> (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).
Thermocycler, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/thermocycler/product/Eppendorf AG
Average 99 stars, based on 12 article reviews
Price from $9.99 to $1999.99
thermocycler - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa"

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa

Journal: PLoS ONE

doi: 10.1371/journal.pone.0094664

Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).
Figure Legend Snippet: Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).

Techniques Used: Lamp Assay, SYBR Green Assay, Agarose Gel Electrophoresis, Staining, Blocking Assay, Molecular Weight, Marker

Related Articles

Clone Assay:

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. Approximately 50 clones were re-amplified for the 28S rRNA gene fragments and digested using the restriction enzyme Taq I (Promega, cutting site 5′T/CGA3′) to perform a screening analysis using RFLPs (Restriction Fragment Length Polymorphisms).

Amplification:

Article Title: Molecular Characterization of the Circulating Strains of Vibrio cholerae during 2010 Cholera Outbreak in Nigeria
Article Snippet: Paragraph title: Amplification of the cytotoxin (ctxA), wbeO1 and wbfO139 genes ... The reaction was conducted in a thermocycler (Eppendorf Mastercycler pro, Hamburg), with an initial denaturation at 95 0 C for 5 min.

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: LAMP assay The LAMP assay was performed using the Loopamp DNA amplification Kit (Eiken Chemicals Co., Tokyo, Japan) following manufacturer's instructions. .. To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction.

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: 10 µl of the purified ChIP DNA and 100 ng of purified input DNA were used for amplification. .. The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles.

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany). .. Negative and heat-inactivation controls were also amplified in each experiment.

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: Library preparation with polymerase chain reaction (PCR) amplification was performed using 20 ng bacterial DNA, 0.2 μM of each barcoded forward and reverse primer, and HotMasterMix (5Prime) solution in a total volume of 25 μL. .. The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C.

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: Symbiodinium Diversity The amplification of a specific region of the 28S rRNA gene of Symbiodinium was performed using the primers D1D2-F and D1D2-R ( ) in a solution containing 1X PCR buffer, 0.2 mM dNTPs, 2.5 mM MgCl2 , 2.5 U of recombinant Taq DNA polymerase (Promega, Madison, WI, USA), 10–40 ng of total DNA, 0.5 μM of each primer and sterile Milli-Q water in a final volume of 15 μl. .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions.

Article Title: Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR
Article Snippet: PCR (35 cycles) was carried out in a thermocycler (Eppendorf, Hamburg) under the following conditions: 30s denaturation at 94°C, 60s annealing at 50°C, and 50s strand synthesis at 72°C. .. Amplification products were resolved by gel electrophoresis using a 1.5% agarose gel stained with ethidium bromide and photographed under UV illumination.

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Our probes consisted of CENT repeats obtained by amplification of genomic DNA from “Caiana Fita” and IACSP93-3046, and the PCR product was purified as detailed above. .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

Whole Genome Amplification:

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: Paragraph title: Whole genome amplification ... The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles.

Positive Control:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler). .. A negative control and synthetic positive control were included in each batch of reactions.

Synthesized:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: First strand cDNA was synthesized using ~2 µg of RNA from each sample, random hexamers and Superscript IITM (Invitrogen, Inc, CA) at 42 °C for 2 hours. .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Article Title: Identification of novel Fgf enhancers and their role in dental evolution
Article Snippet: EMSAs were carried out with recombinant proteins synthesized in Escherichia coli ( E. coli ). .. Control (labeled) and ECR (cold inhibitor) oligonucleotides were annealed in a thermocycler (Eppendorf) (see for list of primers).

Blocking Assay:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: .. To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction. .. Because of the highly sensitivity of LAMP reaction, DNA contamination and carry-over of amplified products were prevented by using sterile tools at all times, performing each step of the analysis in separate work areas, minimizing manipulation of the reaction tubes and closing them with flexible parafilm.

Real-time Polymerase Chain Reaction:

Article Title: Chicken oviduct—the target tissue for growth hormone action: effect on cell proliferation and apoptosis and on the gene expression of some oviduct-specific proteins
Article Snippet: Paragraph title: RNA isolation, cDNA synthesis and quantitative PCR ... Samples were incubated in a thermocycler (Mastercycler Gradient; Eppendorf, Hamburg, Germany) according to the following thermal profile: 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min.

Microarray:

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: Whole genome amplification Co-precipitated DNA was amplified before microarray hybridization using WGA II (Sigma-Aldrich) according to the manufacturer’s instructions. .. The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles.

Incubation:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: .. To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction. .. Because of the highly sensitivity of LAMP reaction, DNA contamination and carry-over of amplified products were prevented by using sterile tools at all times, performing each step of the analysis in separate work areas, minimizing manipulation of the reaction tubes and closing them with flexible parafilm.

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: A total of 1×106 bone marrow mononuclear cells were incubated in 200 µl ice-cold 1X CHAPS lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM MgCl2 , 1 mM EGTA, 0.1 mM Benzamidine, 5 mM β-Mercaptoethanol, 0.5% CHAPS, 10% Glycerol) for 30 min and centrifuged at 12,000 × g for 30 min at 4°C. .. Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Chemical discrimination between dC and 5MedC via their hydroxylamine adducts
Article Snippet: .. Incubation of DNA strands In a thermocycler (Eppendorf Mastercycler personal) with a heatable lid a single-stranded oligodeoxynucleotide ODN (10 µM) (Metabion, Martinsried, Germany) was incubated with NH2 OAllyl (1 M, pH 5.2 with HNEt2 , Fluka, Buchs, Switzerland) for 4 h at 60°C. .. For incubation kinetics 200 pmol of the DNA were directly injected into a HPLC without prior desalting (for detailed incubation kinetics please refer to the Supplementary Data ).

Article Title: Arsenic Resistance and Prevalence of Arsenic Resistance Genes in Campylobacter jejuni and Campylobacter coli Isolated from Retail Meats
Article Snippet: Isolates were struck to Mueller-Hinton agar (MH; Difco), and incubated at 42 °C for 48 h under microaerophilic conditions. .. The cells were lysed by heating at 80 °C for 10 min, followed by cooling to 55 °C for 10 min, using a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Chicken oviduct—the target tissue for growth hormone action: effect on cell proliferation and apoptosis and on the gene expression of some oviduct-specific proteins
Article Snippet: .. Samples were incubated in a thermocycler (Mastercycler Gradient; Eppendorf, Hamburg, Germany) according to the following thermal profile: 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min. .. The obtained cDNA was used in real-time PCR for Bcl-2, caspases 2, 3, 8 and 9, ovalbumin and ovocalyxins 32 and 36 in a 96-well thermocycler (StepOne Plus; Applied Biosystems, USA) according to the recommended cycling program: 2 min at 50 °C, 10 min at 95 °C, 40 cycles of 15 s at 95 °C and 60 s at 60 °C.

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C). .. The CENT probe was detected with anti-digoxigenin conjugated to rhodamine (Roche).

Article Title: Identification of novel Fgf enhancers and their role in dental evolution
Article Snippet: Control (labeled) and ECR (cold inhibitor) oligonucleotides were annealed in a thermocycler (Eppendorf) (see for list of primers). .. The mixes were incubated for 20 min at room temperature, following 10 min incubation with addition of cold competitor ECR in molar excess and 20 min incubation with addition of the labeled probe.

Formalin-fixed Paraffin-Embedded:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: RNA extraction, cDNA synthesis and detection of fusion genes Formalin-fixed paraffin-embedded (FFPE) tissue blocks of each sample were cut for multiple unstained slides. .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Expressing:

Article Title: Chicken oviduct—the target tissue for growth hormone action: effect on cell proliferation and apoptosis and on the gene expression of some oviduct-specific proteins
Article Snippet: Samples were incubated in a thermocycler (Mastercycler Gradient; Eppendorf, Hamburg, Germany) according to the following thermal profile: 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min. .. The multiplex real-time quantitative PCRs (qPCRs) for the examined genes were performed in a 10 μl volume containing 5 μl TaqMan Gene Expression Master Mix, 0.5 μl TaqMan Gene Expression Assays with specific TaqMan MGB-probe and one pair of primers designed by Applied Biosystems, 0.5 μl Eucaryotic 18S rRNA Endogenous Control (pair of primers and TaqMan probe-labelled VIC/TAMRA as a reference gene), 3 μl water and 1 μl cDNA (ten-times-diluted sample after the RT step).

Article Title: Signaling-Related Mobility Changes in Bacterial Chemotaxis Receptors Revealed by Solid-State NMR
Article Snippet: The PCR reactions were done in a thermocycler (Eppendorf Master Cycler personal or BioRad MJ Mini) using reagents from New England Biolabs. .. Plasmids expressing TEV-cleavable His-tagged proteins were constructed for ease of purification and compatibility with the vesicle assembly of His-tagged CF.

Acrylamide Gel Assay:

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany). .. The PCR products were separated using gel electrophoresis in a 10% acrylamide gel and 0.2% Ag-stained (GE Healthcare Life Sciences, Shanghai, China), and the telomerase-positive signals were quantified using the Gel Doc 200 gel analytical system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Transformation Assay:

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. Approximately 50 clones were re-amplified for the 28S rRNA gene fragments and digested using the restriction enzyme Taq I (Promega, cutting site 5′T/CGA3′) to perform a screening analysis using RFLPs (Restriction Fragment Length Polymorphisms).

Hybridization:

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: Whole genome amplification Co-precipitated DNA was amplified before microarray hybridization using WGA II (Sigma-Aldrich) according to the manufacturer’s instructions. .. The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles.

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: The hybridization mixture consisted of formamide (50%, v/v), dextran sulfate (10%, w/v), saline sodium citrate (2 × SSC), sodium dodecyl sulfate (0.13%, w/v SDS) and 3 ng/μl of probe. .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

High Performance Liquid Chromatography:

Article Title: Chemical discrimination between dC and 5MedC via their hydroxylamine adducts
Article Snippet: Incubation of DNA strands In a thermocycler (Eppendorf Mastercycler personal) with a heatable lid a single-stranded oligodeoxynucleotide ODN (10 µM) (Metabion, Martinsried, Germany) was incubated with NH2 OAllyl (1 M, pH 5.2 with HNEt2 , Fluka, Buchs, Switzerland) for 4 h at 60°C. .. For incubation kinetics 200 pmol of the DNA were directly injected into a HPLC without prior desalting (for detailed incubation kinetics please refer to the Supplementary Data ).

Nick Translation:

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Purified DNAs were labeled by nick translation (Roche) with digoxigenin-11-dUTP, following the manufacturer’s instructions. .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

Generated:

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C. .. A master DNA pool was generated from the purified products in equimolar ratios.

Polymerase Chain Reaction:

Article Title: Molecular Characterization of the Circulating Strains of Vibrio cholerae during 2010 Cholera Outbreak in Nigeria
Article Snippet: Amplification of the cytotoxin (ctxA), wbeO1 and wbfO139 genes The ctx A gene VCT1 [5’-CTCAGACGGGATTTGTTAGGCACG-3’], sense strand and VCT2 [5’-TCTATCTCTGTAGCCCCTATTACG-3’], antisense strand, the wbe O1 gene : O1 wbe F [5’- GTTTCACTGAACAGATGGG-3’], O1 wbe R [5’-GGTCATCTGTAAGTACAAC-3’] and wbfO139 gene O139F2 [5’-AGCCTCTTTATTACGGGTGG-3’], sense strand and O139R2 [5’-GTCAAACCCGATCGTAAAGG-3’] from each isolate were amplified by PCR with 50-200 ng of DNA mixed with PCR buffer (20 mM Tris-HCl, pH 8.3; 50 mM KCl) containing 200 micromole each of dNTP, 1.5 mM MgCl2 , 30 picomole each of forward and reverse primer, and 1 unit of Taq polymerase. .. The reaction was conducted in a thermocycler (Eppendorf Mastercycler pro, Hamburg), with an initial denaturation at 95 0 C for 5 min.

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: .. The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles. .. The amplified DNA was purified via NucleoSpin Extract II according to manufacturer’s instructions.

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: .. Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany). .. The PCR primers used to detect telomerase were 5′-AATCCGTCGAGCAGAGTT-3′ (forward) and 5′-CCCTTACCCTTACCCTTACCCTAA-3′ (reverse).

Article Title: Antibiotic Susceptibility Profiles of Campylobacter coli Isolated from Poultry Farms in Lagos Nigeria – A Pilot Study
Article Snippet: .. PCR was carried out in a thermocycler (Eppendorf AG, Hamburg, Germany) with cycling parameter as follows: denaturation at 94 °C for 1 min, annealing at 66 °C for 1 min, and extension at 72 °C for 1 min. PCR amplicons were electrophoretically separated in 1% agarose gels (Sigma type II, medium EEO), stained with ethidium bromide and visualized under ultraviolet (UV) light. .. Results Campylobacter spp. were isolated from 8 (5.3%) of the total 150 fresh poultry droppings analyzed.

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: .. One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler). .. A negative control and synthetic positive control were included in each batch of reactions.

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: .. The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C. .. The samples were purified with a magnetic-bead based clean-up and size selection kit (Macherey-Nagel GmbH & Co. KG, Germany).

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. Approximately 50 clones were re-amplified for the 28S rRNA gene fragments and digested using the restriction enzyme Taq I (Promega, cutting site 5′T/CGA3′) to perform a screening analysis using RFLPs (Restriction Fragment Length Polymorphisms).

Article Title: Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR
Article Snippet: .. PCR (35 cycles) was carried out in a thermocycler (Eppendorf, Hamburg) under the following conditions: 30s denaturation at 94°C, 60s annealing at 50°C, and 50s strand synthesis at 72°C. ..

Article Title: Arsenic Resistance and Prevalence of Arsenic Resistance Genes in Campylobacter jejuni and Campylobacter coli Isolated from Retail Meats
Article Snippet: DNA Extraction Bacterial DNA extracts used in polymerase chain reaction (PCR) were prepared from Campylobacter cultures using the single-cell lysing buffer (SCLB) method [ ]. .. The cells were lysed by heating at 80 °C for 10 min, followed by cooling to 55 °C for 10 min, using a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Our probes consisted of CENT repeats obtained by amplification of genomic DNA from “Caiana Fita” and IACSP93-3046, and the PCR product was purified as detailed above. .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

Article Title: Signaling-Related Mobility Changes in Bacterial Chemotaxis Receptors Revealed by Solid-State NMR
Article Snippet: .. The PCR reactions were done in a thermocycler (Eppendorf Master Cycler personal or BioRad MJ Mini) using reagents from New England Biolabs. .. Plasmids expressing TEV-cleavable His-tagged proteins were constructed for ease of purification and compatibility with the vesicle assembly of His-tagged CF.

Negative Control:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler). .. A negative control and synthetic positive control were included in each batch of reactions.

Electroporation Bacterial Transformation:

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. Approximately 50 clones were re-amplified for the 28S rRNA gene fragments and digested using the restriction enzyme Taq I (Promega, cutting site 5′T/CGA3′) to perform a screening analysis using RFLPs (Restriction Fragment Length Polymorphisms).

Injection:

Article Title: Chemical discrimination between dC and 5MedC via their hydroxylamine adducts
Article Snippet: Incubation of DNA strands In a thermocycler (Eppendorf Mastercycler personal) with a heatable lid a single-stranded oligodeoxynucleotide ODN (10 µM) (Metabion, Martinsried, Germany) was incubated with NH2 OAllyl (1 M, pH 5.2 with HNEt2 , Fluka, Buchs, Switzerland) for 4 h at 60°C. .. For incubation kinetics 200 pmol of the DNA were directly injected into a HPLC without prior desalting (for detailed incubation kinetics please refer to the Supplementary Data ).

Recombinant:

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: Symbiodinium Diversity The amplification of a specific region of the 28S rRNA gene of Symbiodinium was performed using the primers D1D2-F and D1D2-R ( ) in a solution containing 1X PCR buffer, 0.2 mM dNTPs, 2.5 mM MgCl2 , 2.5 U of recombinant Taq DNA polymerase (Promega, Madison, WI, USA), 10–40 ng of total DNA, 0.5 μM of each primer and sterile Milli-Q water in a final volume of 15 μl. .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions.

Article Title: Identification of novel Fgf enhancers and their role in dental evolution
Article Snippet: EMSAs were carried out with recombinant proteins synthesized in Escherichia coli ( E. coli ). .. Control (labeled) and ECR (cold inhibitor) oligonucleotides were annealed in a thermocycler (Eppendorf) (see for list of primers).

Staining:

Article Title: Antibiotic Susceptibility Profiles of Campylobacter coli Isolated from Poultry Farms in Lagos Nigeria – A Pilot Study
Article Snippet: .. PCR was carried out in a thermocycler (Eppendorf AG, Hamburg, Germany) with cycling parameter as follows: denaturation at 94 °C for 1 min, annealing at 66 °C for 1 min, and extension at 72 °C for 1 min. PCR amplicons were electrophoretically separated in 1% agarose gels (Sigma type II, medium EEO), stained with ethidium bromide and visualized under ultraviolet (UV) light. .. Results Campylobacter spp. were isolated from 8 (5.3%) of the total 150 fresh poultry droppings analyzed.

Article Title: Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR
Article Snippet: PCR (35 cycles) was carried out in a thermocycler (Eppendorf, Hamburg) under the following conditions: 30s denaturation at 94°C, 60s annealing at 50°C, and 50s strand synthesis at 72°C. .. Amplification products were resolved by gel electrophoresis using a 1.5% agarose gel stained with ethidium bromide and photographed under UV illumination.

DNA Extraction:

Article Title: Antibiotic Susceptibility Profiles of Campylobacter coli Isolated from Poultry Farms in Lagos Nigeria – A Pilot Study
Article Snippet: Polymerase Chain Reaction (PCR) for Suspect Campylobacter Spp DNA extraction of Campylobacter spp. was done as described by Samosornsuk et al. [ ]. .. PCR was carried out in a thermocycler (Eppendorf AG, Hamburg, Germany) with cycling parameter as follows: denaturation at 94 °C for 1 min, annealing at 66 °C for 1 min, and extension at 72 °C for 1 min. PCR amplicons were electrophoretically separated in 1% agarose gels (Sigma type II, medium EEO), stained with ethidium bromide and visualized under ultraviolet (UV) light.

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: Paragraph title: DNA extraction, 16S rRNA library preparation and sequencing ... The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C.

Article Title: Arsenic Resistance and Prevalence of Arsenic Resistance Genes in Campylobacter jejuni and Campylobacter coli Isolated from Retail Meats
Article Snippet: Paragraph title: 2.3. DNA Extraction ... The cells were lysed by heating at 80 °C for 10 min, followed by cooling to 55 °C for 10 min, using a thermocycler (Eppendorf, Hamburg, Germany).

Nucleic Acid Electrophoresis:

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany). .. The PCR products were separated using gel electrophoresis in a 10% acrylamide gel and 0.2% Ag-stained (GE Healthcare Life Sciences, Shanghai, China), and the telomerase-positive signals were quantified using the Gel Doc 200 gel analytical system (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C. .. Amplicons were visualized by gel electrophoresis and quantified by a Qubit 2.0 fluorometer.

Article Title: Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR
Article Snippet: PCR (35 cycles) was carried out in a thermocycler (Eppendorf, Hamburg) under the following conditions: 30s denaturation at 94°C, 60s annealing at 50°C, and 50s strand synthesis at 72°C. .. Amplification products were resolved by gel electrophoresis using a 1.5% agarose gel stained with ethidium bromide and photographed under UV illumination.

Fluorescence:

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C). .. Slides were examined under a fluorescence microscope (Olympus BX51) and images captured (Olympus DP72 camera) using DP2-BSW software (Olympus).

Isolation:

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: DNA extraction, 16S rRNA library preparation and sequencing Genomic DNA was isolated from 200 mg of faeces using the NucleoSpinSoil kit (Macherey-Nagel GmbH & Co. KG, Germany) following the manufacturer’s instruction. .. The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C.

Article Title: Chicken oviduct—the target tissue for growth hormone action: effect on cell proliferation and apoptosis and on the gene expression of some oviduct-specific proteins
Article Snippet: Paragraph title: RNA isolation, cDNA synthesis and quantitative PCR ... Samples were incubated in a thermocycler (Mastercycler Gradient; Eppendorf, Hamburg, Germany) according to the following thermal profile: 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min.

Size-exclusion Chromatography:

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: .. Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany). .. The PCR primers used to detect telomerase were 5′-AATCCGTCGAGCAGAGTT-3′ (forward) and 5′-CCCTTACCCTTACCCTTACCCTAA-3′ (reverse).

Electrophoretic Mobility Shift Assay:

Article Title: Identification of novel Fgf enhancers and their role in dental evolution
Article Snippet: Paragraph title: Electrophoretic mobility shift assay ... Control (labeled) and ECR (cold inhibitor) oligonucleotides were annealed in a thermocycler (Eppendorf) (see for list of primers).

Purification:

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: 10 µl of the purified ChIP DNA and 100 ng of purified input DNA were used for amplification. .. The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles.

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler). .. The PCR products were gel purified and Sanger-sequenced on 20% positive samples.

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C. .. The samples were purified with a magnetic-bead based clean-up and size selection kit (Macherey-Nagel GmbH & Co. KG, Germany).

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Purified DNAs were labeled by nick translation (Roche) with digoxigenin-11-dUTP, following the manufacturer’s instructions. .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

Article Title: Identification of novel Fgf enhancers and their role in dental evolution
Article Snippet: Control (labeled) and ECR (cold inhibitor) oligonucleotides were annealed in a thermocycler (Eppendorf) (see for list of primers). .. Control oligonucleotides were labeled with [γ-32 P]rATP utilizing T4 polynucleotide kinase and purified.

Article Title: Signaling-Related Mobility Changes in Bacterial Chemotaxis Receptors Revealed by Solid-State NMR
Article Snippet: The PCR reactions were done in a thermocycler (Eppendorf Master Cycler personal or BioRad MJ Mini) using reagents from New England Biolabs. .. Plasmids expressing TEV-cleavable His-tagged proteins were constructed for ease of purification and compatibility with the vesicle assembly of His-tagged CF.

Sequencing:

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: Paragraph title: DNA extraction, 16S rRNA library preparation and sequencing ... The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C.

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. The RFLPs enabled the selection of distinct Symbiodinium lineages for sequencing.

Article Title: Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR
Article Snippet: Primer pair F2 + R2 was used as nested primer and primer for direct sequencing. .. PCR (35 cycles) was carried out in a thermocycler (Eppendorf, Hamburg) under the following conditions: 30s denaturation at 94°C, 60s annealing at 50°C, and 50s strand synthesis at 72°C.

Labeling:

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Purified DNAs were labeled by nick translation (Roche) with digoxigenin-11-dUTP, following the manufacturer’s instructions. .. Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

Article Title: Identification of novel Fgf enhancers and their role in dental evolution
Article Snippet: .. Control (labeled) and ECR (cold inhibitor) oligonucleotides were annealed in a thermocycler (Eppendorf) (see for list of primers). .. Control oligonucleotides were labeled with [γ-32 P]rATP utilizing T4 polynucleotide kinase and purified.

Lysis:

Article Title: Methylation of CDKN2B CpG islands is associated with upregulated telomerase activity in children with acute lymphoblastic leukemia
Article Snippet: A total of 1×106 bone marrow mononuclear cells were incubated in 200 µl ice-cold 1X CHAPS lysis buffer (10 mM Tris-HCl, pH 7.5, 1 mM MgCl2 , 1 mM EGTA, 0.1 mM Benzamidine, 5 mM β-Mercaptoethanol, 0.5% CHAPS, 10% Glycerol) for 30 min and centrifuged at 12,000 × g for 30 min at 4°C. .. Cell lysates were resuspended in 50 µl reaction mixture (5.0 µl 10X TRAP buffer, 1.0 µl 50X dNTPs mix, 2.0 µl Ts primer, 1.0 µl TRAP Primer mix, 2 unit Taq enzyme, 2 µl cell lysates) and subjected to 33 PCR cycles of 94°C for 30 sec and 60°C for 30 sec, and a final extension at 72°C for 10 min using a thermocycler (Eppendorf, Hamburg, Germany).

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: For the cell lysis buffer SL2 + Enhancer buffer SX were used, the subsequent vortex step was replaced with repeated bead beating. .. The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C.

Chromatin Immunoprecipitation:

Article Title: Open chromatin structures regulate the efficiencies of pre-RC formation and replication initiation in Epstein-Barr virus
Article Snippet: 10 µl of the purified ChIP DNA and 100 ng of purified input DNA were used for amplification. .. The PCR was performed in a thermocycler (Mastercycler personal; Eppendorf) using 15 cycles.

RNA Extraction:

Article Title: Identification of recurrent fusion genes across multiple cancer types
Article Snippet: Paragraph title: RNA extraction, cDNA synthesis and detection of fusion genes ... One microliter each cDNA sample was used for TaqMan PCR reactions with 50 heat cycles at 94 °C for 30 seconds, 61 °C for 30 seconds, and 72 °C for 30 seconds using primers and probes specific for CCNH-C5orf30 (AAAGTTATTTATCAGAGAGTCTGATGCTG/CTGTTCTACTCCAGGTATTTTCATTATATC; TaqMan probe, 5′-/56-FAM/ACAGGCAAG/ZEN/TTCTGTTCTCTTTCAGCA/3IABkFQ/-3′), mTOR-TP53BP1 (TGATAGACCAGTCCCGGGATG/CCACTGACATTCCCAGAACAAG; TaqMan probe, 5′-/56-FAM/TGTCAGCCT/ZEN/GTCAGAATCCAAGTCAAG/3IABkFQ/-3′), TRMT11-GRIK2 (GCGCTGTCGTGTACCCTTAAC/GAATGCAAGTTCCTCAGCTCC; TaqMan probe, 5′-/56-FAM/CGGAACTCC/ZEN/AGATGCTCCTGCG/3IABkFQ/-3′), LRRC59-FLJ60017 (GTGACTGCTTGGATGAGAAGC/CCCTCCTCTGGTTTGTTGTTG; TaqMan probe, 5′-/56-FAM/CAGTGTGCA/ZEN/AACAAGGTGACTGGAAG/3IABkFQ/-3′), TMEM135-CCDC67 (CAGCTGTCATGGAAGTTCAGAC/CCTCATTCTTTCCTGCTCAGAG; TaqMan probe, 5′-/56-FAM/AGTTCCTTT/ZEN/TAAGACTCACCAAGGGCAA/3IABkFQ/-3′), KDM4- AC011523.2 (AGACCACCTTCGCCTGGCAC/TCTCTCTCAGATCCAGGCTTG; TaqMan probe, 5′-/56-FAM/ACAGCATCA/ZEN/ACTACCTGCACTTTGGG/3IABkFQ/-3′), and β-actin (ACCCCACTTCTCTCTAAGGAG/GCAATGCTATCACCTCCCCTG; TaqMan probe, 5′-/56-FAM/CCAGTCCTC/ZEN/TCCCAAGTCCACAC/3IABkFQ/-3′) in a thermocycler (Eppendorf RealplexTM thermocycler).

Plasmid Preparation:

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: .. The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. Approximately 50 clones were re-amplified for the 28S rRNA gene fragments and digested using the restriction enzyme Taq I (Promega, cutting site 5′T/CGA3′) to perform a screening analysis using RFLPs (Restriction Fragment Length Polymorphisms).

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C). .. Preparations were counterstained and mounted with DAPI in VECTASHIELD medium (Vector).

Article Title: Signaling-Related Mobility Changes in Bacterial Chemotaxis Receptors Revealed by Solid-State NMR
Article Snippet: Paragraph title: Plasmid Construction ... The PCR reactions were done in a thermocycler (Eppendorf Master Cycler personal or BioRad MJ Mini) using reagents from New England Biolabs.

Software:

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C). .. Slides were examined under a fluorescence microscope (Olympus BX51) and images captured (Olympus DP72 camera) using DP2-BSW software (Olympus).

Microscopy:

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C). .. Slides were examined under a fluorescence microscope (Olympus BX51) and images captured (Olympus DP72 camera) using DP2-BSW software (Olympus).

Multiplex Assay:

Article Title: Chicken oviduct—the target tissue for growth hormone action: effect on cell proliferation and apoptosis and on the gene expression of some oviduct-specific proteins
Article Snippet: Samples were incubated in a thermocycler (Mastercycler Gradient; Eppendorf, Hamburg, Germany) according to the following thermal profile: 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5 min. .. The multiplex real-time quantitative PCRs (qPCRs) for the examined genes were performed in a 10 μl volume containing 5 μl TaqMan Gene Expression Master Mix, 0.5 μl TaqMan Gene Expression Assays with specific TaqMan MGB-probe and one pair of primers designed by Applied Biosystems, 0.5 μl Eucaryotic 18S rRNA Endogenous Control (pair of primers and TaqMan probe-labelled VIC/TAMRA as a reference gene), 3 μl water and 1 μl cDNA (ten-times-diluted sample after the RT step).

Selection:

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C. .. The samples were purified with a magnetic-bead based clean-up and size selection kit (Macherey-Nagel GmbH & Co. KG, Germany).

Article Title: Broadcast Spawning Coral Mussismilia hispida Can Vertically Transfer its Associated Bacterial Core
Article Snippet: The reaction was performed in a thermocycler (Mastercycler Gradient, Eppendorf, Hamburg, Germany) with the following conditions: initial denaturing at 94°C for 5 min; 1 cycle at 94°C for 1 min, 56°C for 45 s and 72°C; 29 cycles at 92°C for 1 min, 56°C for 1 min and 72°C for 45 s; and a final extension at 72°C for 10 min. Polymerase chain reaction products were cloned using the pJET 1.2 vector (CloneJET PCR Cloning Kit #K1231, Thermo Scientific) and transformed into Escherichia coli competent cells (Single Step – KRX – Competent Cells, Promega) with the TransformAid Bacterial Transformation Kit (#K2710 Thermo Scientific) according to the manufacturer’s instructions. .. The RFLPs enabled the selection of distinct Symbiodinium lineages for sequencing.

Agarose Gel Electrophoresis:

Article Title: The effect of drinking water pH on the human gut microbiota and glucose regulation: results of a randomized controlled cross-over intervention
Article Snippet: DNA yield, purity and integrity were assessed using a Qubit 2.0 fluorometer, a NanoDrop 2000 spectrometer (Thermo Fisher Scientific Inc., MA USA) and agarose gel electrophoresis. .. The PCR reaction was performed in a Thermocycler (Eppendorf AG, Germany), using the following parameters: 3 minutes at 94 °C, followed by 28 cycles of 20 seconds at 94 °C, 30 seconds at 55 °C and 54 seconds at 72 °C.

Article Title: Identification of a novel Plasmopara halstedii elicitor protein combining de novo peptide sequencing algorithms and RACE-PCR
Article Snippet: PCR (35 cycles) was carried out in a thermocycler (Eppendorf, Hamburg) under the following conditions: 30s denaturation at 94°C, 60s annealing at 50°C, and 50s strand synthesis at 72°C. .. Amplification products were resolved by gel electrophoresis using a 1.5% agarose gel stained with ethidium bromide and photographed under UV illumination.

Construct:

Article Title: Signaling-Related Mobility Changes in Bacterial Chemotaxis Receptors Revealed by Solid-State NMR
Article Snippet: The PCR reactions were done in a thermocycler (Eppendorf Master Cycler personal or BioRad MJ Mini) using reagents from New England Biolabs. .. Plasmids expressing TEV-cleavable His-tagged proteins were constructed for ease of purification and compatibility with the vesicle assembly of His-tagged CF.

Lamp Assay:

Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa
Article Snippet: Paragraph title: LAMP assay ... To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction.

Gel Extraction:

Article Title: Signaling-Related Mobility Changes in Bacterial Chemotaxis Receptors Revealed by Solid-State NMR
Article Snippet: The PCR reactions were done in a thermocycler (Eppendorf Master Cycler personal or BioRad MJ Mini) using reagents from New England Biolabs. .. PCR products were separated in 1% Agarose gels, and each product with the expected length was gel-purified (QiAquick gel extraction Kit, Qiagen).

Fluorescence In Situ Hybridization:

Article Title: Revisiting Meiosis in Sugarcane: Chromosomal Irregularities and the Prevalence of Bivalent Configurations
Article Snippet: Paragraph title: Chromosome Association Analysis Using FISH ... Slides were denatured/hybridized for 10 min at each temperature (90°C, 48°C, and 38°C) using a thermocycler (5333 Mastercycler® , Eppendorf) and subsequently incubated in a humidity chamber (20 h, 37°C).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 81
    Eppendorf AG conventional thermocycler
    Diagram of the protocol of in situ RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of in situ RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a <t>thermocycler</t> adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.
    Conventional Thermocycler, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 81/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/conventional thermocycler/product/Eppendorf AG
    Average 81 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    conventional thermocycler - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    77
    Eppendorf AG thermocycler 2
    Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on <t>thermocycler</t> 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).
    Thermocycler 2, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 77/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermocycler 2/product/Eppendorf AG
    Average 77 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    thermocycler 2 - by Bioz Stars, 2020-02
    77/100 stars
      Buy from Supplier

    76
    Eppendorf AG thermocycler 1
    Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on <t>thermocycler</t> 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).
    Thermocycler 1, supplied by Eppendorf AG, used in various techniques. Bioz Stars score: 76/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/thermocycler 1/product/Eppendorf AG
    Average 76 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    thermocycler 1 - by Bioz Stars, 2020-02
    76/100 stars
      Buy from Supplier

    Image Search Results


    Diagram of the protocol of in situ RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of in situ RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.

    Journal: Frontiers in Cellular Neuroscience

    Article Title: In situ RT-PCR Optimized for Electron Microscopy Allows Description of Subcellular Morphology of Target mRNA-Expressing Cells in the Brain

    doi: 10.3389/fncel.2017.00141

    Figure Lengend Snippet: Diagram of the protocol of in situ RT-PCR combined with immunogold labeling for electron microscopy . Schematic diagram of in situ RT-PCR immunogold protocol. Tissue digestion with proteinase K increases the nucleic acid accessibility. After proteinase K treatment, we performed reverse transcription of mRNA to cDNA followed by a polymerase chain reaction with specific primers to amplify the gene of interest. In this step, biotin-labeled nucleotides are added to the PCR mix and incorporated into the reaction product. For this step we used a thermocycler adapted to glass slides. Then, PCR product was fixed with 4% PFA/0.5%GA, followed by immunogold labeling against biotin with gold-conjugated antibodies. After embedding the tissue in epoxy resin with conventional protocols, we obtained ultrathin sections with an ultramicrotome and detected gold particles with electron microscopy.

    Article Snippet: Polymerase chain reaction A gradient PCR was performed using the primers and mouse striatum cDNA to test distinct melting temperatures (Tm = 56, 58, and 60°C) in a conventional thermocycler (Mastercycler, Eppendorf, Hamburg, Germany).

    Techniques: In Situ, Reverse Transcription Polymerase Chain Reaction, Labeling, Electron Microscopy, Polymerase Chain Reaction

    Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).

    Journal: PLoS ONE

    Article Title: Development of a Highly Sensitive Loop-Mediated Isothermal Amplification (LAMP) Method for the Detection of Loa loa

    doi: 10.1371/journal.pone.0094664

    Figure Lengend Snippet: Sensitivity assessment of the LAMP assay for Loa loa using serial dilutions of genomic DNA by the addition of SYBR Green I or by visualization on agarose gel stained with ethidium bromide. (A) Sensitivity assessment performed with a thermocycler. (B) Sensitivity assessment performed with a heating block. Lane Loa: genomic DNA from Loa loa (5 ng); lanes 10 −1 –10 −13 : 10-fold serially dilutions; lanes N, N1, N2, N3: negative controls (no DNA template). Lane M: 50 bp DNA ladder (Molecular weight marker XIII, Roche).

    Article Snippet: To establish the standard protocol for the LAMP method, the reaction mixture was incubated in a conventional heating block (K Dry-Bath) or in a thermocycler (Mastercycler Gradient-96well; Eppendorf) at a range of temperatures (61, 63 and 65°C) for 60 min to optimize the reaction conditions and then heated at 80°C for 5 min to terminate the reaction.

    Techniques: Lamp Assay, SYBR Green Assay, Agarose Gel Electrophoresis, Staining, Blocking Assay, Molecular Weight, Marker

    Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).

    Journal: Genome Biology

    Article Title: Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries

    doi: 10.1186/gb-2011-12-2-r18

    Figure Lengend Snippet: Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).

    Article Snippet: Thermocycler 2 was an Eppendorf Mastercycler epgradient (no 'S').

    Techniques: Polymerase Chain Reaction

    Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).

    Journal: Genome Biology

    Article Title: Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries

    doi: 10.1186/gb-2011-12-2-r18

    Figure Lengend Snippet: Effect of temperature ramp rates . The standard PCR protocol with Phusion HF DNA polymerase and short initial (30 s) and in-cycle (10 s) denaturation times was performed on three different thermocyclers at their respective default temperature ramp settings. Heating and cooling rates were 6°C/s and 4.5°C/s on thermocycler 1 (bright red line), 4°C/s and 3°C/s on thermocycler 2 (purple line) and 2.2°C/s and 2.2°C/s on thermocycler 3 (dark red line).

    Article Snippet: Thermocycler 1 was a Mastercycler epgradient S (Eppendorf, Hamburg, Germany).

    Techniques: Polymerase Chain Reaction

    Optimized PCR conditions rescue GC-rich promoter regions in the human genome .  (a,b)  A 180-bp fragment library of human DNA was amplified using (a) standard conditions (Phusion HF, short denaturation) or (b) optimized conditions (AccuPrime HiFi, long denaturation, extension at 65°C) on the fast-ramping thermocycler 1. The amplified libraries were analyzed by qPCR. Orange bars indicate the quantity of eight GC-rich loci near gene promoters relative to the mean quantity of four size-matched control loci (blue bars; mean set to 100% in each graph). Error bars represent the range of two measurements averaged to calculate the quantity of each locus. Locus 7 is the first protein-coding exon of the tumor suppressor gene  RB1 .

    Journal: Genome Biology

    Article Title: Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries

    doi: 10.1186/gb-2011-12-2-r18

    Figure Lengend Snippet: Optimized PCR conditions rescue GC-rich promoter regions in the human genome . (a,b) A 180-bp fragment library of human DNA was amplified using (a) standard conditions (Phusion HF, short denaturation) or (b) optimized conditions (AccuPrime HiFi, long denaturation, extension at 65°C) on the fast-ramping thermocycler 1. The amplified libraries were analyzed by qPCR. Orange bars indicate the quantity of eight GC-rich loci near gene promoters relative to the mean quantity of four size-matched control loci (blue bars; mean set to 100% in each graph). Error bars represent the range of two measurements averaged to calculate the quantity of each locus. Locus 7 is the first protein-coding exon of the tumor suppressor gene RB1 .

    Article Snippet: Thermocycler 1 was a Mastercycler epgradient S (Eppendorf, Hamburg, Germany).

    Techniques: Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction