Structured Review

InGex tgirt iii enzyme
<t>TGIRT</t> ssDNA-seq workflow. The target DNA (2–50 ng in this work) is treated with alkaline phosphatase to remove 3′ phosphates and heat denatured prior to DNA-seq library construction. The resulting ssDNAs with 3′ OH termini are then used for TGIRT template-switching DNA synthesis coupled to Illumina read 2 reverse (R2R) DNA-seq adapter addition. In this novel reaction, the <t>TGIRT-III</t> enzyme (InGex) binds first to a synthetic 34-bp R2 RNA/R2R DNA heteroduplex in which the R2R DNA primer has a single nucleotide 3′ overhang that can direct TGIRT template switching by base pairing to the 3′ nucleotide of a target DNA strand. For minimally biased library preparation, the 3′-overhang nucleotide is an equimolar mixture of A, C, G, and T (denoted N). A 3′-blocking group (C3 spacer; 3′SpC3) is attached to the end of the R2 RNA oligonucleotide to prevent template-switching to that RNA. After the TGIRT enzyme extends the DNA primer to produce a DNA copy of the target DNA strand with an R2R adapter seamlessly linked to its 5′ end, a 5′ adenylated (App) Illumina read 1 reverse (R1R) adapter is added to its 3′ end by single-stranded DNA ligation using a Thermostable 5′ AppDNA/RNA ligase (New England Biolabs). In the workflow shown, an unique molecular identifier (UMI) is positioned at the 5′ end of the R1R DNA oligonucleotide. A final PCR step adds flow cell capture sites and barcodes for Illumina sequencing and sample multiplexing.
Tgirt Iii Enzyme, supplied by InGex, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tgirt iii enzyme/product/InGex
Average 95 stars, based on 1 article reviews
Price from $9.99 to $1999.99
tgirt iii enzyme - by Bioz Stars, 2020-04
95/100 stars

Images

1) Product Images from "Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching"

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching

Journal: Scientific Reports

doi: 10.1038/s41598-017-09064-w

TGIRT ssDNA-seq workflow. The target DNA (2–50 ng in this work) is treated with alkaline phosphatase to remove 3′ phosphates and heat denatured prior to DNA-seq library construction. The resulting ssDNAs with 3′ OH termini are then used for TGIRT template-switching DNA synthesis coupled to Illumina read 2 reverse (R2R) DNA-seq adapter addition. In this novel reaction, the TGIRT-III enzyme (InGex) binds first to a synthetic 34-bp R2 RNA/R2R DNA heteroduplex in which the R2R DNA primer has a single nucleotide 3′ overhang that can direct TGIRT template switching by base pairing to the 3′ nucleotide of a target DNA strand. For minimally biased library preparation, the 3′-overhang nucleotide is an equimolar mixture of A, C, G, and T (denoted N). A 3′-blocking group (C3 spacer; 3′SpC3) is attached to the end of the R2 RNA oligonucleotide to prevent template-switching to that RNA. After the TGIRT enzyme extends the DNA primer to produce a DNA copy of the target DNA strand with an R2R adapter seamlessly linked to its 5′ end, a 5′ adenylated (App) Illumina read 1 reverse (R1R) adapter is added to its 3′ end by single-stranded DNA ligation using a Thermostable 5′ AppDNA/RNA ligase (New England Biolabs). In the workflow shown, an unique molecular identifier (UMI) is positioned at the 5′ end of the R1R DNA oligonucleotide. A final PCR step adds flow cell capture sites and barcodes for Illumina sequencing and sample multiplexing.
Figure Legend Snippet: TGIRT ssDNA-seq workflow. The target DNA (2–50 ng in this work) is treated with alkaline phosphatase to remove 3′ phosphates and heat denatured prior to DNA-seq library construction. The resulting ssDNAs with 3′ OH termini are then used for TGIRT template-switching DNA synthesis coupled to Illumina read 2 reverse (R2R) DNA-seq adapter addition. In this novel reaction, the TGIRT-III enzyme (InGex) binds first to a synthetic 34-bp R2 RNA/R2R DNA heteroduplex in which the R2R DNA primer has a single nucleotide 3′ overhang that can direct TGIRT template switching by base pairing to the 3′ nucleotide of a target DNA strand. For minimally biased library preparation, the 3′-overhang nucleotide is an equimolar mixture of A, C, G, and T (denoted N). A 3′-blocking group (C3 spacer; 3′SpC3) is attached to the end of the R2 RNA oligonucleotide to prevent template-switching to that RNA. After the TGIRT enzyme extends the DNA primer to produce a DNA copy of the target DNA strand with an R2R adapter seamlessly linked to its 5′ end, a 5′ adenylated (App) Illumina read 1 reverse (R1R) adapter is added to its 3′ end by single-stranded DNA ligation using a Thermostable 5′ AppDNA/RNA ligase (New England Biolabs). In the workflow shown, an unique molecular identifier (UMI) is positioned at the 5′ end of the R1R DNA oligonucleotide. A final PCR step adds flow cell capture sites and barcodes for Illumina sequencing and sample multiplexing.

Techniques Used: DNA Sequencing, DNA Synthesis, Blocking Assay, DNA Ligation, Polymerase Chain Reaction, Flow Cytometry, Sequencing, Multiplexing

Bisulfite sequencing of plasma cfDNA. Three separate TGIRT-seq libraries were each constructed from ~5 ng of bisulfite-treated plasma DNA from a healthy male individual, and sequenced to obtain TGIRT-seq datasets BPD1-3 (see Supplementary Table S4 ). The datasets were combined and analyzed to identify DNA methylation sites, as described in Methods. ( a ) Annotation of DNA methylation sites in the human genome and determination of DNA methylation densities by TGIRT-seq of bisulfite-treated plasma cfDNA. Tracks from the inner to the outer circle represent: (1) annotations of Type II biomarkers that are highly variable in methylation density across tissues; (2) annotations of Type I biomarkers that are highly tissue specific (color-coded); (3) bar graphs of methylation densities within the annotated regions based on TGIRT-seq of bisulfite-treated plasma cfDNA; (4) genome coordinates. ( b ) Tissues-of-origin of plasma cfDNA from a healthy male individual determined by TGIRT-seq of bisulfite-treated DNA. The pie chart shows the percent contributions of different tissues in combined datasets PB1-3 determined by quadratic programming 7 . Neutrophils are derived from myeloid precursors, and lymphocytes are a combination of T-cells and B-cells. Comparison of tissues-of-origin of plasma cfDNA determined as in panel ( b ) from the three independent datasets BPD1-3 are shown in Supplementary Fig. 11 . Pearson’s correlation coefficients were ≥0.96 for each pairwise combination of the three individual datasets.
Figure Legend Snippet: Bisulfite sequencing of plasma cfDNA. Three separate TGIRT-seq libraries were each constructed from ~5 ng of bisulfite-treated plasma DNA from a healthy male individual, and sequenced to obtain TGIRT-seq datasets BPD1-3 (see Supplementary Table S4 ). The datasets were combined and analyzed to identify DNA methylation sites, as described in Methods. ( a ) Annotation of DNA methylation sites in the human genome and determination of DNA methylation densities by TGIRT-seq of bisulfite-treated plasma cfDNA. Tracks from the inner to the outer circle represent: (1) annotations of Type II biomarkers that are highly variable in methylation density across tissues; (2) annotations of Type I biomarkers that are highly tissue specific (color-coded); (3) bar graphs of methylation densities within the annotated regions based on TGIRT-seq of bisulfite-treated plasma cfDNA; (4) genome coordinates. ( b ) Tissues-of-origin of plasma cfDNA from a healthy male individual determined by TGIRT-seq of bisulfite-treated DNA. The pie chart shows the percent contributions of different tissues in combined datasets PB1-3 determined by quadratic programming 7 . Neutrophils are derived from myeloid precursors, and lymphocytes are a combination of T-cells and B-cells. Comparison of tissues-of-origin of plasma cfDNA determined as in panel ( b ) from the three independent datasets BPD1-3 are shown in Supplementary Fig. 11 . Pearson’s correlation coefficients were ≥0.96 for each pairwise combination of the three individual datasets.

Techniques Used: Methylation Sequencing, Construct, DNA Methylation Assay, Methylation, Derivative Assay

2) Product Images from "Variation in single-nucleotide sensitivity of eCLIP derived from reverse transcription conditions"

Article Title: Variation in single-nucleotide sensitivity of eCLIP derived from reverse transcription conditions

Journal: Methods (San Diego, Calif.)

doi: 10.1016/j.ymeth.2017.08.002

Testing reverse transcriptase conditions with eCLIP (A) eCLIP overall schematic. A single biological sample was lysed, immunoprecipitated, and taken through standard eCLIP library preparation until the reverse transcription stage, at which point it was split into multiple conditions. (B) Immunoprecipitation (IP) western blot images for (left) TARDBP and (right) RBFOX2 eCLIP performed in HEK293XT cells. (C) Library yield obtained in eCLIP experiments for RBFOX2 (filled circles) and TARDBP (empty circles), normalized to a Superscript III condition performed within that experiment batch. Average across all experiments is indicated by red dashed lines. For eCLIP experiments that were completed and sequenced (black), yield was calculated as the number of PCR cycles required to obtain 100 femtomoles of library (extrapolated from the library yield and number of PCR cycles performed). For additional experiments only taken to pre-amplified library stage (blue), library yield was determined as the Ct value obtained by qPCR of the pre-amplified library with standard library amplification primers. Reverse transcription conditions tested were AffinityScript (AffSc), Superscript II (SS2), Superscript III (SS3), Superscript IV (SS4), Superscript IV in manganese buffer (SS4Mn), Superscript IV in Superscript III buffer (SS4in3B), TGIRT-III enzyme (TGIRT), AMV, and M-MLV. Standard buffers and reaction conditions were used unless otherwise indicated (see Materials Methods).
Figure Legend Snippet: Testing reverse transcriptase conditions with eCLIP (A) eCLIP overall schematic. A single biological sample was lysed, immunoprecipitated, and taken through standard eCLIP library preparation until the reverse transcription stage, at which point it was split into multiple conditions. (B) Immunoprecipitation (IP) western blot images for (left) TARDBP and (right) RBFOX2 eCLIP performed in HEK293XT cells. (C) Library yield obtained in eCLIP experiments for RBFOX2 (filled circles) and TARDBP (empty circles), normalized to a Superscript III condition performed within that experiment batch. Average across all experiments is indicated by red dashed lines. For eCLIP experiments that were completed and sequenced (black), yield was calculated as the number of PCR cycles required to obtain 100 femtomoles of library (extrapolated from the library yield and number of PCR cycles performed). For additional experiments only taken to pre-amplified library stage (blue), library yield was determined as the Ct value obtained by qPCR of the pre-amplified library with standard library amplification primers. Reverse transcription conditions tested were AffinityScript (AffSc), Superscript II (SS2), Superscript III (SS3), Superscript IV (SS4), Superscript IV in manganese buffer (SS4Mn), Superscript IV in Superscript III buffer (SS4in3B), TGIRT-III enzyme (TGIRT), AMV, and M-MLV. Standard buffers and reaction conditions were used unless otherwise indicated (see Materials Methods).

Techniques Used: Immunoprecipitation, Western Blot, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

3) Product Images from "RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase"

Article Title: RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase

Journal: RNA

doi: 10.1261/rna.055558.115

TGIRT-seq reads map mostly to protein-coding genes but with greater representation of small ncRNAs than TruSeq libraries. ( A ) for different library preparation methods for numbered replicates of Samples A–D. ( B ) Stacked bar graphs showing the percentage of small noncoding RNA reads that map to different classes of small ncRNAs for different library preparation methods for numbered replicates of Samples A–D. MiscRNA includes ribozymes, such as RNase P RNA, imprinted transcripts, such as Xist, and other transcripts that cannot be classified into other RNA annotation categories. ( Left panels) TGIRT-seq; ( middle panels) TruSeq v2 (from ABRF at three different sites, L/R/V); ( right panels) TruSeq v3 (from ABRF at site W). Features and small ncRNA classes are color coded as indicated to the right of the bar graphs.
Figure Legend Snippet: TGIRT-seq reads map mostly to protein-coding genes but with greater representation of small ncRNAs than TruSeq libraries. ( A ) for different library preparation methods for numbered replicates of Samples A–D. ( B ) Stacked bar graphs showing the percentage of small noncoding RNA reads that map to different classes of small ncRNAs for different library preparation methods for numbered replicates of Samples A–D. MiscRNA includes ribozymes, such as RNase P RNA, imprinted transcripts, such as Xist, and other transcripts that cannot be classified into other RNA annotation categories. ( Left panels) TGIRT-seq; ( middle panels) TruSeq v2 (from ABRF at three different sites, L/R/V); ( right panels) TruSeq v3 (from ABRF at site W). Features and small ncRNA classes are color coded as indicated to the right of the bar graphs.

Techniques Used:

Related Articles

Amplification:

Article Title: A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation
Article Snippet: DMS-modified mRNA was purified with RNA Clean & Concentrator (Zymo Research), and reverse transcribed with 1µM cspA -specific primer (5’ GTACGAACACATCTTTAGAGCCATCGTCAGGAGTGATGAAG 3’), First strand buffer (Invitrogen), 1mM dNTP, 10mM DTT (freshly prepared), 10U SUPERase Inhibitor (Ambion) and 100 U TGIRT-III enzyme (InGex) at 57°C for 1hr 30min. .. The enzyme was inactivated by incubation at 85°C for 5m in, and mRNA template was digested by RNase H at 37°C for 20min. cDNA was PCR amplified using cspA -specific primers (Forward: 5’ GAACGGTTTGACGTACAGACC 3’; Reverse: 5’ GAGCCATCGTCAGGAGTGAT 3’) and Phusion HF Polymerase (NEB).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method. .. Sequencing libraries were amplified for 15 cycles using Phusion High-Fidelity PCR Master Mix and purified using 1.3-1.4xAgentcourt AMPure XP beads.

RNA Sequencing Assay:

Article Title: RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase
Article Snippet: .. To assess the ability of a TGIRT enzyme to comprehensively profile whole-cell RNAs, we used the commercially available TGIRT-III enzyme (InGex, LLC) to construct RNA-seq libraries from two well-characterized, commercially available human reference RNA sets: the Universal Human Reference RNA (UHR) and the Human Brain Reference RNA (HBR) ( A). ..

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method. .. Sequencing libraries were amplified for 15 cycles using Phusion High-Fidelity PCR Master Mix and purified using 1.3-1.4xAgentcourt AMPure XP beads.

E. coli Genomic Assay:

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching
Article Snippet: Paragraph title: TGIRT-seq of E. coli genomic DNA ... Reactions were done with 5–50 ng DNA substrate, 100 nM annealed template-primer substrate, and TGIRT-III enzyme (400 units, 1 mM; InGex, LLC; St. Louis) in 20 μl of reaction medium containing 420 mM NaCl, 5 mM MgCl2 , 20 mM Tris-HCl, pH 7.5, 5 mM DTT and 1 mM dNTPs (an equimolar mix of 1 mM dATP, dCTP, dGTP, and dTTP).

Modification:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: Due to potential pausing of the TGIRT at modification sites, this long incubation time facilitates readthrough of multiple modifications per RNA fragment. .. For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 .

Concentration Assay:

Article Title: Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex structure sequencing
Article Snippet: .. Reverse transcription The reaction mixture consisted of 1 μl of 1 μM pre-miRNA 149 wild-type (0.1 μM final), 1 μl of 1 μM reverse transcription primer with Cy5 fluorescent tag at 5′ end (0.1 μM final), 3 μl of 5X Li+ or K+ reverse transcription buffer, which gave a final concentration of 20 mM Tris (pH 7.5), 4 mM MgCl2 , 1 mM DTT, 0.5 mM dNTPs, 150 mM LiCl or 150 mM KCl or vendor supplied/recommended reaction buffer (SuperScript III: Thermo Scientific, 18080093: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 and 0.5 mM dNTPs final; ProtoScript II: NEB, B0368S: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 and 0.5 mM dNTPs final; TGIRT: 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2 , 450 mM NaCl and 0.5 mM dNTPs final), 4.5 μl of nuclease-free water, and 0.5 μl of 200U/μl SuperScript™ III Reverse Transcriptase (100U final) (Thermo Scientific, 18080093), 200U/μl TGIRT™-III Enzyme (100U final) (InGex), or 200U/μl ProtoScript® II Reverse Transcriptase (100U final) (NEB, M0368S). .. The guanosine (G) sequencing reaction was prepared by addition of 1 μl of 10 mM dideoxycytidine (ddC) (final 1 mM ddC) instead of nuclease-free water, ceteris paribus.

Article Title: In vivo analysis of influenza A mRNA secondary structures identifies critical regulatory motifs
Article Snippet: Reverse transcription (RT) was performed using the TGIRT-III enzyme (InGex, #TGIRT50) as described previously ( ). .. To remove TGIRT-III from the RNA–DNA duplex, 1 μl of proteinase K was added to a final concentration of 0.1 μg/μl and the reaction incubated at 37°C for 15 min., 1 μl of a 1:2 dilution of protease inhibitor cocktail (Sigma Aldrich, #P8340) was then added to inhibit proteinase K activity.

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching
Article Snippet: Reactions were done with 5–50 ng DNA substrate, 100 nM annealed template-primer substrate, and TGIRT-III enzyme (400 units, 1 mM; InGex, LLC; St. Louis) in 20 μl of reaction medium containing 420 mM NaCl, 5 mM MgCl2 , 20 mM Tris-HCl, pH 7.5, 5 mM DTT and 1 mM dNTPs (an equimolar mix of 1 mM dATP, dCTP, dGTP, and dTTP). .. Reactions were incubated at 60 °C for 40 min and terminated by adding 5 M NaOH to a final concentration of 0.25 M, incubating at 95 °C for 3 min, and then neutralizing with 5 M HCl.

Isolation:

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: RNA and Sequencing Library preparation For NextSeq RNA sequencing, small RNAs were enriched using the PureLink® miRNA Isolation Kit (Ambion™). .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

Incubation:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: .. For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 . .. After reverse transcription, 1 μl of 5 M NaOH was added and the reaction incubated for 3 min at 95°C to degrade the RNA, followed by EtOH precipitation and gel purification to remove excess RT primer.

Article Title: Variation in single-nucleotide sensitivity of eCLIP derived from reverse transcription conditions
Article Snippet: To 2.5 μL RNA was added 1 μL 5 μM AR17 and 5.5 μL H2 O, and samples were mixed, incubated at 65C for 2 minutes, and placed on ice. .. To each was added 3 μL H2 O, 4 μL of 5X TGIRT buffer (2.25M NaCl, 25 mM MgCl, 100 mM TrisHCl pH 7.5), 1 μL 0.1M DTT, 0.5 μL TGIRT-III enzyme (InGex), and 2.5 μL 10 mM dNTP mix.

Article Title: A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation
Article Snippet: DMS-modified mRNA was purified with RNA Clean & Concentrator (Zymo Research), and reverse transcribed with 1µM cspA -specific primer (5’ GTACGAACACATCTTTAGAGCCATCGTCAGGAGTGATGAAG 3’), First strand buffer (Invitrogen), 1mM dNTP, 10mM DTT (freshly prepared), 10U SUPERase Inhibitor (Ambion) and 100 U TGIRT-III enzyme (InGex) at 57°C for 1hr 30min. .. The enzyme was inactivated by incubation at 85°C for 5m in, and mRNA template was digested by RNase H at 37°C for 20min. cDNA was PCR amplified using cspA -specific primers (Forward: 5’ GAACGGTTTGACGTACAGACC 3’; Reverse: 5’ GAGCCATCGTCAGGAGTGAT 3’) and Phusion HF Polymerase (NEB).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega). .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

Article Title: In vivo analysis of influenza A mRNA secondary structures identifies critical regulatory motifs
Article Snippet: Reverse transcription (RT) was performed using the TGIRT-III enzyme (InGex, #TGIRT50) as described previously ( ). .. To remove TGIRT-III from the RNA–DNA duplex, 1 μl of proteinase K was added to a final concentration of 0.1 μg/μl and the reaction incubated at 37°C for 15 min., 1 μl of a 1:2 dilution of protease inhibitor cocktail (Sigma Aldrich, #P8340) was then added to inhibit proteinase K activity.

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching
Article Snippet: Reactions were done with 5–50 ng DNA substrate, 100 nM annealed template-primer substrate, and TGIRT-III enzyme (400 units, 1 mM; InGex, LLC; St. Louis) in 20 μl of reaction medium containing 420 mM NaCl, 5 mM MgCl2 , 20 mM Tris-HCl, pH 7.5, 5 mM DTT and 1 mM dNTPs (an equimolar mix of 1 mM dATP, dCTP, dGTP, and dTTP). .. Reactions were incubated at 60 °C for 40 min and terminated by adding 5 M NaOH to a final concentration of 0.25 M, incubating at 95 °C for 3 min, and then neutralizing with 5 M HCl.

Construct:

Article Title: RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase
Article Snippet: .. To assess the ability of a TGIRT enzyme to comprehensively profile whole-cell RNAs, we used the commercially available TGIRT-III enzyme (InGex, LLC) to construct RNA-seq libraries from two well-characterized, commercially available human reference RNA sets: the Universal Human Reference RNA (UHR) and the Human Brain Reference RNA (HBR) ( A). ..

Article Title: A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation
Article Snippet: DMS-modified mRNA was purified with RNA Clean & Concentrator (Zymo Research), and reverse transcribed with 1µM cspA -specific primer (5’ GTACGAACACATCTTTAGAGCCATCGTCAGGAGTGATGAAG 3’), First strand buffer (Invitrogen), 1mM dNTP, 10mM DTT (freshly prepared), 10U SUPERase Inhibitor (Ambion) and 100 U TGIRT-III enzyme (InGex) at 57°C for 1hr 30min. .. Illumina libraries were constructed using the Beckman Coulter SPRIworks to adenylate ends and ligate adaptors to amplicons.

Purification:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: Ribosomal RNA was depleted using RiboZero (Epicentre), with a final incubation of 5 min at 40°C, instead of 50°C as recommended in the commercial protocol, and purified by EtOH precipitation. .. For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 .

Article Title: A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation
Article Snippet: .. DMS-modified mRNA was purified with RNA Clean & Concentrator (Zymo Research), and reverse transcribed with 1µM cspA -specific primer (5’ GTACGAACACATCTTTAGAGCCATCGTCAGGAGTGATGAAG 3’), First strand buffer (Invitrogen), 1mM dNTP, 10mM DTT (freshly prepared), 10U SUPERase Inhibitor (Ambion) and 100 U TGIRT-III enzyme (InGex) at 57°C for 1hr 30min. .. The enzyme was inactivated by incubation at 85°C for 5m in, and mRNA template was digested by RNase H at 37°C for 20min. cDNA was PCR amplified using cspA -specific primers (Forward: 5’ GAACGGTTTGACGTACAGACC 3’; Reverse: 5’ GAGCCATCGTCAGGAGTGAT 3’) and Phusion HF Polymerase (NEB).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: RNA was purified using Chloroform extraction and EtOH precipitation. .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

Article Title: In vivo analysis of influenza A mRNA secondary structures identifies critical regulatory motifs
Article Snippet: Library preparation IAV mRNA was fragmented in 64 mM Tris–HCl pH 8.3, 96 mM KCl, 3.9 mM MgCl2 for 8 min at 94°C and subsequently purified on RNA Clean & Concentrator-5 columns. .. Reverse transcription (RT) was performed using the TGIRT-III enzyme (InGex, #TGIRT50) as described previously ( ).

Sequencing:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 . .. Finally, cDNAs were circularized using CircLigase (Epicentre), and Illumina sequencing adapters and indexes were introduced by 9–13 cycles of PCR using Phusion HF Polymerase (NEB), oNTI231, and indexing primers with TruSeq 6 bp indices.

Article Title: Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex structure sequencing
Article Snippet: Reverse transcription The reaction mixture consisted of 1 μl of 1 μM pre-miRNA 149 wild-type (0.1 μM final), 1 μl of 1 μM reverse transcription primer with Cy5 fluorescent tag at 5′ end (0.1 μM final), 3 μl of 5X Li+ or K+ reverse transcription buffer, which gave a final concentration of 20 mM Tris (pH 7.5), 4 mM MgCl2 , 1 mM DTT, 0.5 mM dNTPs, 150 mM LiCl or 150 mM KCl or vendor supplied/recommended reaction buffer (SuperScript III: Thermo Scientific, 18080093: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 and 0.5 mM dNTPs final; ProtoScript II: NEB, B0368S: 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 and 0.5 mM dNTPs final; TGIRT: 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2 , 450 mM NaCl and 0.5 mM dNTPs final), 4.5 μl of nuclease-free water, and 0.5 μl of 200U/μl SuperScript™ III Reverse Transcriptase (100U final) (Thermo Scientific, 18080093), 200U/μl TGIRT™-III Enzyme (100U final) (InGex), or 200U/μl ProtoScript® II Reverse Transcriptase (100U final) (NEB, M0368S). .. The guanosine (G) sequencing reaction was prepared by addition of 1 μl of 10 mM dideoxycytidine (ddC) (final 1 mM ddC) instead of nuclease-free water, ceteris paribus.

Article Title: RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase
Article Snippet: Paragraph title: RNA sample preparation, sequencing, and mapping pipeline ... To assess the ability of a TGIRT enzyme to comprehensively profile whole-cell RNAs, we used the commercially available TGIRT-III enzyme (InGex, LLC) to construct RNA-seq libraries from two well-characterized, commercially available human reference RNA sets: the Universal Human Reference RNA (UHR) and the Human Brain Reference RNA (HBR) ( A).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Paragraph title: RNA and Sequencing Library preparation ... RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

Generated:

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method. .. Sequencing libraries were amplified for 15 cycles using Phusion High-Fidelity PCR Master Mix and purified using 1.3-1.4xAgentcourt AMPure XP beads.

Activity Assay:

Article Title: In vivo analysis of influenza A mRNA secondary structures identifies critical regulatory motifs
Article Snippet: Reverse transcription (RT) was performed using the TGIRT-III enzyme (InGex, #TGIRT50) as described previously ( ). .. To remove TGIRT-III from the RNA–DNA duplex, 1 μl of proteinase K was added to a final concentration of 0.1 μg/μl and the reaction incubated at 37°C for 15 min., 1 μl of a 1:2 dilution of protease inhibitor cocktail (Sigma Aldrich, #P8340) was then added to inhibit proteinase K activity.

De-Phosphorylation Assay:

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching
Article Snippet: Reactions were done with 5–50 ng DNA substrate, 100 nM annealed template-primer substrate, and TGIRT-III enzyme (400 units, 1 mM; InGex, LLC; St. Louis) in 20 μl of reaction medium containing 420 mM NaCl, 5 mM MgCl2 , 20 mM Tris-HCl, pH 7.5, 5 mM DTT and 1 mM dNTPs (an equimolar mix of 1 mM dATP, dCTP, dGTP, and dTTP). .. Prior to the reactions, the template-primer substrate was pre-incubated with TGIRT-III enzyme for 30 min at room temperature in 6 μl of reaction mixture containing 1.4 M NaCl, 5.8 mM MgCl2 , 23.3 mM Tris HCl pH 7.5 and then mixed with the 13.2-μl dephosphorylation reaction mixture containing the DNA substrate (see above) before initiating template-switching and DNA synthesis by adding dNTPs.

Genome Wide:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: Paragraph title: Library generation, genome-wide DMS-MaPseq ... For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 .

Polymerase Chain Reaction:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 . .. Finally, cDNAs were circularized using CircLigase (Epicentre), and Illumina sequencing adapters and indexes were introduced by 9–13 cycles of PCR using Phusion HF Polymerase (NEB), oNTI231, and indexing primers with TruSeq 6 bp indices.

Article Title: A stress response that monitors and regulates mRNA structure is central to cold-shock adaptation
Article Snippet: DMS-modified mRNA was purified with RNA Clean & Concentrator (Zymo Research), and reverse transcribed with 1µM cspA -specific primer (5’ GTACGAACACATCTTTAGAGCCATCGTCAGGAGTGATGAAG 3’), First strand buffer (Invitrogen), 1mM dNTP, 10mM DTT (freshly prepared), 10U SUPERase Inhibitor (Ambion) and 100 U TGIRT-III enzyme (InGex) at 57°C for 1hr 30min. .. The enzyme was inactivated by incubation at 85°C for 5m in, and mRNA template was digested by RNase H at 37°C for 20min. cDNA was PCR amplified using cspA -specific primers (Forward: 5’ GAACGGTTTGACGTACAGACC 3’; Reverse: 5’ GAGCCATCGTCAGGAGTGAT 3’) and Phusion HF Polymerase (NEB).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method. .. Sequencing libraries were amplified for 15 cycles using Phusion High-Fidelity PCR Master Mix and purified using 1.3-1.4xAgentcourt AMPure XP beads.

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching
Article Snippet: Reactions were done with 5–50 ng DNA substrate, 100 nM annealed template-primer substrate, and TGIRT-III enzyme (400 units, 1 mM; InGex, LLC; St. Louis) in 20 μl of reaction medium containing 420 mM NaCl, 5 mM MgCl2 , 20 mM Tris-HCl, pH 7.5, 5 mM DTT and 1 mM dNTPs (an equimolar mix of 1 mM dATP, dCTP, dGTP, and dTTP). .. After cleaning up by using a Nucleospin Gel and PCR cleanup kit (Clontech), a 5′App/3′-CpSp blocked R1R adapter with a 13-nt UMI at its 5′ end (denoted R1R-UMI) was ligated to the 3′ end of the cDNA by using Thermostable 5′ AppDNA/RNA Ligase as specified by manufacturer’s protocol (New England Biolabs).

DNA Synthesis:

Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching
Article Snippet: The DNA was then used as substrate for TGIRT template-switching DNA synthesis from an initial template-primer substrate consisting of a 34-nt RNA oligonucleotide (R2 RNA), which contains an Illumina Read 2 (R2) primer-binding site and a 3′-blocking group (C3 Spacer, 3′SpC3; IDT), annealed to a complementary 35-nt DNA primer (R2R DNA), which leaves an equimolar mixture of A, C, G, or T single-nucleotide 3′ overhangs (see Supplementary Table ). .. Reactions were done with 5–50 ng DNA substrate, 100 nM annealed template-primer substrate, and TGIRT-III enzyme (400 units, 1 mM; InGex, LLC; St. Louis) in 20 μl of reaction medium containing 420 mM NaCl, 5 mM MgCl2 , 20 mM Tris-HCl, pH 7.5, 5 mM DTT and 1 mM dNTPs (an equimolar mix of 1 mM dATP, dCTP, dGTP, and dTTP).

Protease Inhibitor:

Article Title: In vivo analysis of influenza A mRNA secondary structures identifies critical regulatory motifs
Article Snippet: Reverse transcription (RT) was performed using the TGIRT-III enzyme (InGex, #TGIRT50) as described previously ( ). .. To remove TGIRT-III from the RNA–DNA duplex, 1 μl of proteinase K was added to a final concentration of 0.1 μg/μl and the reaction incubated at 37°C for 15 min., 1 μl of a 1:2 dilution of protease inhibitor cocktail (Sigma Aldrich, #P8340) was then added to inhibit proteinase K activity.

Sample Prep:

Article Title: RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase
Article Snippet: Paragraph title: RNA sample preparation, sequencing, and mapping pipeline ... To assess the ability of a TGIRT enzyme to comprehensively profile whole-cell RNAs, we used the commercially available TGIRT-III enzyme (InGex, LLC) to construct RNA-seq libraries from two well-characterized, commercially available human reference RNA sets: the Universal Human Reference RNA (UHR) and the Human Brain Reference RNA (HBR) ( A).

Gel Purification:

Article Title: DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo
Article Snippet: For the TGIRT reverse transcription, a 5 min incubation at room temperature followed the initial denaturation, and the RT reaction proceeded for 1.5 h at 57°C with 100 U TGIRT-III enzyme (InGex) and the following reaction conditions: 1 mM dNTPs, 5 mM freshly prepared DTT (Sigma-Aldrich), 10 U SUPERase Inhibitor, 50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2 . .. After reverse transcription, 1 μl of 5 M NaOH was added and the reaction incubated for 3 min at 95°C to degrade the RNA, followed by EtOH precipitation and gel purification to remove excess RT primer.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    InGex tgirt enzyme
    <t>TGIRT</t> ssDNA-seq workflow. The target DNA (2–50 ng in this work) is treated with alkaline phosphatase to remove 3′ phosphates and heat denatured prior to DNA-seq library construction. The resulting ssDNAs with 3′ OH termini are then used for TGIRT template-switching DNA synthesis coupled to Illumina read 2 reverse (R2R) DNA-seq adapter addition. In this novel reaction, the <t>TGIRT-III</t> enzyme (InGex) binds first to a synthetic 34-bp R2 RNA/R2R DNA heteroduplex in which the R2R DNA primer has a single nucleotide 3′ overhang that can direct TGIRT template switching by base pairing to the 3′ nucleotide of a target DNA strand. For minimally biased library preparation, the 3′-overhang nucleotide is an equimolar mixture of A, C, G, and T (denoted N). A 3′-blocking group (C3 spacer; 3′SpC3) is attached to the end of the R2 RNA oligonucleotide to prevent template-switching to that RNA. After the TGIRT enzyme extends the DNA primer to produce a DNA copy of the target DNA strand with an R2R adapter seamlessly linked to its 5′ end, a 5′ adenylated (App) Illumina read 1 reverse (R1R) adapter is added to its 3′ end by single-stranded DNA ligation using a Thermostable 5′ AppDNA/RNA ligase (New England Biolabs). In the workflow shown, an unique molecular identifier (UMI) is positioned at the 5′ end of the R1R DNA oligonucleotide. A final PCR step adds flow cell capture sites and barcodes for Illumina sequencing and sample multiplexing.
    Tgirt Enzyme, supplied by InGex, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tgirt enzyme/product/InGex
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    tgirt enzyme - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results


    TGIRT ssDNA-seq workflow. The target DNA (2–50 ng in this work) is treated with alkaline phosphatase to remove 3′ phosphates and heat denatured prior to DNA-seq library construction. The resulting ssDNAs with 3′ OH termini are then used for TGIRT template-switching DNA synthesis coupled to Illumina read 2 reverse (R2R) DNA-seq adapter addition. In this novel reaction, the TGIRT-III enzyme (InGex) binds first to a synthetic 34-bp R2 RNA/R2R DNA heteroduplex in which the R2R DNA primer has a single nucleotide 3′ overhang that can direct TGIRT template switching by base pairing to the 3′ nucleotide of a target DNA strand. For minimally biased library preparation, the 3′-overhang nucleotide is an equimolar mixture of A, C, G, and T (denoted N). A 3′-blocking group (C3 spacer; 3′SpC3) is attached to the end of the R2 RNA oligonucleotide to prevent template-switching to that RNA. After the TGIRT enzyme extends the DNA primer to produce a DNA copy of the target DNA strand with an R2R adapter seamlessly linked to its 5′ end, a 5′ adenylated (App) Illumina read 1 reverse (R1R) adapter is added to its 3′ end by single-stranded DNA ligation using a Thermostable 5′ AppDNA/RNA ligase (New England Biolabs). In the workflow shown, an unique molecular identifier (UMI) is positioned at the 5′ end of the R1R DNA oligonucleotide. A final PCR step adds flow cell capture sites and barcodes for Illumina sequencing and sample multiplexing.

    Journal: Scientific Reports

    Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching

    doi: 10.1038/s41598-017-09064-w

    Figure Lengend Snippet: TGIRT ssDNA-seq workflow. The target DNA (2–50 ng in this work) is treated with alkaline phosphatase to remove 3′ phosphates and heat denatured prior to DNA-seq library construction. The resulting ssDNAs with 3′ OH termini are then used for TGIRT template-switching DNA synthesis coupled to Illumina read 2 reverse (R2R) DNA-seq adapter addition. In this novel reaction, the TGIRT-III enzyme (InGex) binds first to a synthetic 34-bp R2 RNA/R2R DNA heteroduplex in which the R2R DNA primer has a single nucleotide 3′ overhang that can direct TGIRT template switching by base pairing to the 3′ nucleotide of a target DNA strand. For minimally biased library preparation, the 3′-overhang nucleotide is an equimolar mixture of A, C, G, and T (denoted N). A 3′-blocking group (C3 spacer; 3′SpC3) is attached to the end of the R2 RNA oligonucleotide to prevent template-switching to that RNA. After the TGIRT enzyme extends the DNA primer to produce a DNA copy of the target DNA strand with an R2R adapter seamlessly linked to its 5′ end, a 5′ adenylated (App) Illumina read 1 reverse (R1R) adapter is added to its 3′ end by single-stranded DNA ligation using a Thermostable 5′ AppDNA/RNA ligase (New England Biolabs). In the workflow shown, an unique molecular identifier (UMI) is positioned at the 5′ end of the R1R DNA oligonucleotide. A final PCR step adds flow cell capture sites and barcodes for Illumina sequencing and sample multiplexing.

    Article Snippet: In the first step, the TGIRT enzyme (TGIRT-III, a derivative of the Geobacillus stearothermohilus GsI-IIC group II intron RT; InGex) binds to a short synthetic RNA template/DNA primer heteroduplex substrate in which the DNA primer contains a reverse complement of Illumina read 2 adapter sequence (R2R) and has a single-nucleotide 3′ DNA overhang (see Supplementary Table ).

    Techniques: DNA Sequencing, DNA Synthesis, Blocking Assay, DNA Ligation, Polymerase Chain Reaction, Flow Cytometry, Sequencing, Multiplexing

    Bisulfite sequencing of plasma cfDNA. Three separate TGIRT-seq libraries were each constructed from ~5 ng of bisulfite-treated plasma DNA from a healthy male individual, and sequenced to obtain TGIRT-seq datasets BPD1-3 (see Supplementary Table S4 ). The datasets were combined and analyzed to identify DNA methylation sites, as described in Methods. ( a ) Annotation of DNA methylation sites in the human genome and determination of DNA methylation densities by TGIRT-seq of bisulfite-treated plasma cfDNA. Tracks from the inner to the outer circle represent: (1) annotations of Type II biomarkers that are highly variable in methylation density across tissues; (2) annotations of Type I biomarkers that are highly tissue specific (color-coded); (3) bar graphs of methylation densities within the annotated regions based on TGIRT-seq of bisulfite-treated plasma cfDNA; (4) genome coordinates. ( b ) Tissues-of-origin of plasma cfDNA from a healthy male individual determined by TGIRT-seq of bisulfite-treated DNA. The pie chart shows the percent contributions of different tissues in combined datasets PB1-3 determined by quadratic programming 7 . Neutrophils are derived from myeloid precursors, and lymphocytes are a combination of T-cells and B-cells. Comparison of tissues-of-origin of plasma cfDNA determined as in panel ( b ) from the three independent datasets BPD1-3 are shown in Supplementary Fig. 11 . Pearson’s correlation coefficients were ≥0.96 for each pairwise combination of the three individual datasets.

    Journal: Scientific Reports

    Article Title: Facile single-stranded DNA sequencing of human plasma DNA via thermostable group II intron reverse transcriptase template switching

    doi: 10.1038/s41598-017-09064-w

    Figure Lengend Snippet: Bisulfite sequencing of plasma cfDNA. Three separate TGIRT-seq libraries were each constructed from ~5 ng of bisulfite-treated plasma DNA from a healthy male individual, and sequenced to obtain TGIRT-seq datasets BPD1-3 (see Supplementary Table S4 ). The datasets were combined and analyzed to identify DNA methylation sites, as described in Methods. ( a ) Annotation of DNA methylation sites in the human genome and determination of DNA methylation densities by TGIRT-seq of bisulfite-treated plasma cfDNA. Tracks from the inner to the outer circle represent: (1) annotations of Type II biomarkers that are highly variable in methylation density across tissues; (2) annotations of Type I biomarkers that are highly tissue specific (color-coded); (3) bar graphs of methylation densities within the annotated regions based on TGIRT-seq of bisulfite-treated plasma cfDNA; (4) genome coordinates. ( b ) Tissues-of-origin of plasma cfDNA from a healthy male individual determined by TGIRT-seq of bisulfite-treated DNA. The pie chart shows the percent contributions of different tissues in combined datasets PB1-3 determined by quadratic programming 7 . Neutrophils are derived from myeloid precursors, and lymphocytes are a combination of T-cells and B-cells. Comparison of tissues-of-origin of plasma cfDNA determined as in panel ( b ) from the three independent datasets BPD1-3 are shown in Supplementary Fig. 11 . Pearson’s correlation coefficients were ≥0.96 for each pairwise combination of the three individual datasets.

    Article Snippet: In the first step, the TGIRT enzyme (TGIRT-III, a derivative of the Geobacillus stearothermohilus GsI-IIC group II intron RT; InGex) binds to a short synthetic RNA template/DNA primer heteroduplex substrate in which the DNA primer contains a reverse complement of Illumina read 2 adapter sequence (R2R) and has a single-nucleotide 3′ DNA overhang (see Supplementary Table ).

    Techniques: Methylation Sequencing, Construct, DNA Methylation Assay, Methylation, Derivative Assay

    Testing reverse transcriptase conditions with eCLIP (A) eCLIP overall schematic. A single biological sample was lysed, immunoprecipitated, and taken through standard eCLIP library preparation until the reverse transcription stage, at which point it was split into multiple conditions. (B) Immunoprecipitation (IP) western blot images for (left) TARDBP and (right) RBFOX2 eCLIP performed in HEK293XT cells. (C) Library yield obtained in eCLIP experiments for RBFOX2 (filled circles) and TARDBP (empty circles), normalized to a Superscript III condition performed within that experiment batch. Average across all experiments is indicated by red dashed lines. For eCLIP experiments that were completed and sequenced (black), yield was calculated as the number of PCR cycles required to obtain 100 femtomoles of library (extrapolated from the library yield and number of PCR cycles performed). For additional experiments only taken to pre-amplified library stage (blue), library yield was determined as the Ct value obtained by qPCR of the pre-amplified library with standard library amplification primers. Reverse transcription conditions tested were AffinityScript (AffSc), Superscript II (SS2), Superscript III (SS3), Superscript IV (SS4), Superscript IV in manganese buffer (SS4Mn), Superscript IV in Superscript III buffer (SS4in3B), TGIRT-III enzyme (TGIRT), AMV, and M-MLV. Standard buffers and reaction conditions were used unless otherwise indicated (see Materials Methods).

    Journal: Methods (San Diego, Calif.)

    Article Title: Variation in single-nucleotide sensitivity of eCLIP derived from reverse transcription conditions

    doi: 10.1016/j.ymeth.2017.08.002

    Figure Lengend Snippet: Testing reverse transcriptase conditions with eCLIP (A) eCLIP overall schematic. A single biological sample was lysed, immunoprecipitated, and taken through standard eCLIP library preparation until the reverse transcription stage, at which point it was split into multiple conditions. (B) Immunoprecipitation (IP) western blot images for (left) TARDBP and (right) RBFOX2 eCLIP performed in HEK293XT cells. (C) Library yield obtained in eCLIP experiments for RBFOX2 (filled circles) and TARDBP (empty circles), normalized to a Superscript III condition performed within that experiment batch. Average across all experiments is indicated by red dashed lines. For eCLIP experiments that were completed and sequenced (black), yield was calculated as the number of PCR cycles required to obtain 100 femtomoles of library (extrapolated from the library yield and number of PCR cycles performed). For additional experiments only taken to pre-amplified library stage (blue), library yield was determined as the Ct value obtained by qPCR of the pre-amplified library with standard library amplification primers. Reverse transcription conditions tested were AffinityScript (AffSc), Superscript II (SS2), Superscript III (SS3), Superscript IV (SS4), Superscript IV in manganese buffer (SS4Mn), Superscript IV in Superscript III buffer (SS4in3B), TGIRT-III enzyme (TGIRT), AMV, and M-MLV. Standard buffers and reaction conditions were used unless otherwise indicated (see Materials Methods).

    Article Snippet: To each was added 3 μL H2 O, 4 μL of 5X TGIRT buffer (2.25M NaCl, 25 mM MgCl, 100 mM TrisHCl pH 7.5), 1 μL 0.1M DTT, 0.5 μL TGIRT-III enzyme (InGex), and 2.5 μL 10 mM dNTP mix.

    Techniques: Immunoprecipitation, Western Blot, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    TGIRT-seq reads map mostly to protein-coding genes but with greater representation of small ncRNAs than TruSeq libraries. ( A ) for different library preparation methods for numbered replicates of Samples A–D. ( B ) Stacked bar graphs showing the percentage of small noncoding RNA reads that map to different classes of small ncRNAs for different library preparation methods for numbered replicates of Samples A–D. MiscRNA includes ribozymes, such as RNase P RNA, imprinted transcripts, such as Xist, and other transcripts that cannot be classified into other RNA annotation categories. ( Left panels) TGIRT-seq; ( middle panels) TruSeq v2 (from ABRF at three different sites, L/R/V); ( right panels) TruSeq v3 (from ABRF at site W). Features and small ncRNA classes are color coded as indicated to the right of the bar graphs.

    Journal: RNA

    Article Title: RNA-seq of human reference RNA samples using a thermostable group II intron reverse transcriptase

    doi: 10.1261/rna.055558.115

    Figure Lengend Snippet: TGIRT-seq reads map mostly to protein-coding genes but with greater representation of small ncRNAs than TruSeq libraries. ( A ) for different library preparation methods for numbered replicates of Samples A–D. ( B ) Stacked bar graphs showing the percentage of small noncoding RNA reads that map to different classes of small ncRNAs for different library preparation methods for numbered replicates of Samples A–D. MiscRNA includes ribozymes, such as RNase P RNA, imprinted transcripts, such as Xist, and other transcripts that cannot be classified into other RNA annotation categories. ( Left panels) TGIRT-seq; ( middle panels) TruSeq v2 (from ABRF at three different sites, L/R/V); ( right panels) TruSeq v3 (from ABRF at site W). Features and small ncRNA classes are color coded as indicated to the right of the bar graphs.

    Article Snippet: To assess the ability of a TGIRT enzyme to comprehensively profile whole-cell RNAs, we used the commercially available TGIRT-III enzyme (InGex, LLC) to construct RNA-seq libraries from two well-characterized, commercially available human reference RNA sets: the Universal Human Reference RNA (UHR) and the Human Brain Reference RNA (HBR) ( A).

    Techniques: