Journal: PLoS ONE

Article Title: Two Types of Tet-On Transgenic Lines for Doxycycline-Inducible Gene Expression in Zebrafish Rod Photoreceptors and a Gateway-Based Tet-On Toolkit

doi: 10.1371/journal.pone.0051270

Figure Lengend Snippet: (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the reverse tetracycline-controlled transcriptional activator ( rtTA ) gene while the tetracycline responsive element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.

Article Snippet: The Tet-On components, including the tetracycline response element ( TRE ) from pTRE-Tight (Clontech), the bi-directional tetracycline-response element ( biTRE ) from pTRE-Tight-BI-AcGFP1 (Clontech), and the reverse tetracycline-controlled transcriptional transactivator ( rtTA ) coding region from pTet-On Advanced (Clontech) were moved to Gateway entry vectors.

Techniques: Construct, Transgenic Assay, Expressing, Labeling, Fluorescence, Immunofluorescence

Journal: Cells

Article Title: A Novel Cre/lox71-Based System for Inducible Expression of Recombinant Proteins and Genome Editing

doi: 10.3390/cells11142141

Figure Lengend Snippet: The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for TRE3G promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).

Article Snippet: Minimal promoter of TRE3G system Tet-On 3G (Takara Bio, Kusatsu, Japan, #631168), coreD (D for short) 5′-GAATTCTTTAGACGCGTACGGTGG GCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGCAATTCCACAACACTTTTGTCTTATACCAACTTTCCGTACCACTTCCTACCCTCGTAAA was used as a reference to assess the efficiency of A/B/C minimal synthetic promoters.

Techniques: Expressing, Flow Cytometry, Transfection, Microscopy, Construct, Fluorescence

Journal: International Journal of Molecular Sciences

Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

doi: 10.3390/ijms23094705

Figure Lengend Snippet: The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.

Article Snippet: The cDNA of full-length Zebrafish kras was amplified by PrimeSTAR HS DNA polymerase (Takara) and point mutated to obtain kras G12V , cloned into the modified pTRE3G-BI:ZsGreen1 (Cat.631342, Clontech) vector; and TRE3G-BI is a bidirectional version of TRE3G promoter that allows for simultaneous, equivalent, and inducible expression of two transgenes.

Techniques: Inhibition, Expressing, Activation Assay, Transgenic Assay, Staining, In Situ Hybridization

Journal: International Journal of Molecular Sciences

Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

doi: 10.3390/ijms23094705

Figure Lengend Snippet: Hepatic Sox9 expression is upregulated after hepatocellular carcinoma induction, and the sox9b fh313 mutant suppressed hepatocyte dedifferentiation. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( B , C ) Sox9 antibody staining indicated the number of Sox9+ cells in the liver at 10 dpf in the DOX-induced control ( n = 5), kras G12V + ( n = 5) and kras G12V + and dnMAML+ ( n = 5) groups with statistical results. ( D ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) treatment strategy in sox9b fh313 mutant. ( E ) Three-dimensional images of Anxa4 antibody staining showed biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutants at 8 dpf and 10 dpf. ( F ) Monolayer images of Anxa4 antibody staining biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutant at 8 dpf and 10 dpf. Asterisks show significance: *— p < 0.05; **— p < 0.01. Scale bars—100 μm; error bars—S.D.

Article Snippet: The cDNA of full-length Zebrafish kras was amplified by PrimeSTAR HS DNA polymerase (Takara) and point mutated to obtain kras G12V , cloned into the modified pTRE3G-BI:ZsGreen1 (Cat.631342, Clontech) vector; and TRE3G-BI is a bidirectional version of TRE3G promoter that allows for simultaneous, equivalent, and inducible expression of two transgenes.

Techniques: Expressing, Mutagenesis, Transgenic Assay, Staining

Journal: International Journal of Molecular Sciences

Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

doi: 10.3390/ijms23094705

Figure Lengend Snippet: Inhibition of the Notch signaling pathway after liver cancer induction reduced cancer cell migration and improved survival. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy to observe the migration of cancer cells. ( B ) Zebrafish larvae were classified into three classes, I, II, and III, by the number of cancer cells outside the liver and the number of locations of metastases. ( C ) The proportion of the total number of larvae in different metastasis classes in the kras G12V + ( n = 46) and kras G12V + and dnMAML+ ( n = 130) groups at 9 dpf. ( D ) Kaplan–Meier survival curves of the DOX-induced kras G12V + ( n = 191) and kras G12V + and dnMAML+ ( n = 163) groups. p values for survival curves were calculated by log-rank test. Scale bars , 100 μm.

Article Snippet: The cDNA of full-length Zebrafish kras was amplified by PrimeSTAR HS DNA polymerase (Takara) and point mutated to obtain kras G12V , cloned into the modified pTRE3G-BI:ZsGreen1 (Cat.631342, Clontech) vector; and TRE3G-BI is a bidirectional version of TRE3G promoter that allows for simultaneous, equivalent, and inducible expression of two transgenes.

Techniques: Inhibition, Migration, Transgenic Assay