ef1a tet on 3g system  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa ef1a tet on 3g system
    Ef1a Tet On 3g System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ef1a tet on 3g system/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ef1a tet on 3g system - by Bioz Stars, 2023-02
    95/100 stars

    Images

    ef1a tet on 3g system  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa ef1a tet on 3g system
    Ef1a Tet On 3g System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ef1a tet on 3g system/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ef1a tet on 3g system - by Bioz Stars, 2023-02
    95/100 stars

    Images

    3g inducible vector  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa 3g inducible vector
    3g Inducible Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3g inducible vector/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    3g inducible vector - by Bioz Stars, 2023-02
    95/100 stars

    Images

    revtet on system  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa revtet on system
    Revtet On System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revtet on system/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revtet on system - by Bioz Stars, 2023-02
    94/100 stars

    Images

    prevtet on expression system  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa prevtet on expression system
    Prevtet On Expression System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prevtet on expression system/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    prevtet on expression system - by Bioz Stars, 2023-02
    94/100 stars

    Images

    tet on components  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa tet on components
    (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the <t>reverse</t> <t>tetracycline-controlled</t> transcriptional activator ( rtTA ) gene while the <t>tetracycline</t> <t>responsive</t> element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.
    Tet On Components, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet on components/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tet on components - by Bioz Stars, 2023-02
    95/100 stars

    Images

    1) Product Images from "Two Types of Tet-On Transgenic Lines for Doxycycline-Inducible Gene Expression in Zebrafish Rod Photoreceptors and a Gateway-Based Tet-On Toolkit"

    Article Title: Two Types of Tet-On Transgenic Lines for Doxycycline-Inducible Gene Expression in Zebrafish Rod Photoreceptors and a Gateway-Based Tet-On Toolkit

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0051270

    (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the reverse tetracycline-controlled transcriptional activator ( rtTA ) gene while the tetracycline responsive element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.
    Figure Legend Snippet: (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the reverse tetracycline-controlled transcriptional activator ( rtTA ) gene while the tetracycline responsive element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.

    Techniques Used: Construct, Transgenic Assay, Expressing, Labeling, Fluorescence, Immunofluorescence

    tet on 3g inducible expression systems  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa tet on 3g inducible expression systems
    Tet On 3g Inducible Expression Systems, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet on 3g inducible expression systems/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tet on 3g inducible expression systems - by Bioz Stars, 2023-02
    94/100 stars

    Images

    pcmv tet3g vector  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa pcmv tet3g vector
    Pcmv Tet3g Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv tet3g vector/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcmv tet3g vector - by Bioz Stars, 2023-02
    94/100 stars

    Images

    tre3g system tet on 3g  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa tre3g system tet on 3g
    The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for <t>TRE3G</t> promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).
    Tre3g System Tet On 3g, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tre3g system tet on 3g/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tre3g system tet on 3g - by Bioz Stars, 2023-02
    94/100 stars

    Images

    1) Product Images from "A Novel Cre/lox71-Based System for Inducible Expression of Recombinant Proteins and Genome Editing"

    Article Title: A Novel Cre/lox71-Based System for Inducible Expression of Recombinant Proteins and Genome Editing

    Journal: Cells

    doi: 10.3390/cells11142141

    The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for TRE3G promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).
    Figure Legend Snippet: The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for TRE3G promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).

    Techniques Used: Expressing, Flow Cytometry, Transfection, Microscopy, Construct, Fluorescence

    bidirectional tetracycline responsive element tre  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa bidirectional tetracycline responsive element tre
    Bidirectional Tetracycline Responsive Element Tre, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bidirectional tetracycline responsive element tre/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bidirectional tetracycline responsive element tre - by Bioz Stars, 2023-02
    94/100 stars

    Images

    ptre3g bi  (TaKaRa)


    Bioz Verified Symbol TaKaRa is a verified supplier
    Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    TaKaRa ptre3g bi
    The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V <t>-ZsGreen1)</t> with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.
    Ptre3g Bi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptre3g bi/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptre3g bi - by Bioz Stars, 2023-02
    94/100 stars

    Images

    1) Product Images from "Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma"

    Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms23094705

    The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.
    Figure Legend Snippet: The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.

    Techniques Used: Inhibition, Expressing, Activation Assay, Transgenic Assay, Staining, In Situ Hybridization

    Hepatic Sox9 expression is upregulated after hepatocellular carcinoma induction, and the sox9b fh313 mutant suppressed hepatocyte dedifferentiation. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( B , C ) Sox9 antibody staining indicated the number of Sox9+ cells in the liver at 10 dpf in the DOX-induced control ( n = 5), kras G12V + ( n = 5) and kras G12V + and dnMAML+ ( n = 5) groups with statistical results. ( D ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) treatment strategy in sox9b fh313 mutant. ( E ) Three-dimensional images of Anxa4 antibody staining showed biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutants at 8 dpf and 10 dpf. ( F ) Monolayer images of Anxa4 antibody staining biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutant at 8 dpf and 10 dpf. Asterisks show significance: *— p < 0.05; **— p < 0.01. Scale bars—100 μm; error bars—S.D.
    Figure Legend Snippet: Hepatic Sox9 expression is upregulated after hepatocellular carcinoma induction, and the sox9b fh313 mutant suppressed hepatocyte dedifferentiation. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( B , C ) Sox9 antibody staining indicated the number of Sox9+ cells in the liver at 10 dpf in the DOX-induced control ( n = 5), kras G12V + ( n = 5) and kras G12V + and dnMAML+ ( n = 5) groups with statistical results. ( D ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) treatment strategy in sox9b fh313 mutant. ( E ) Three-dimensional images of Anxa4 antibody staining showed biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutants at 8 dpf and 10 dpf. ( F ) Monolayer images of Anxa4 antibody staining biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutant at 8 dpf and 10 dpf. Asterisks show significance: *— p < 0.05; **— p < 0.01. Scale bars—100 μm; error bars—S.D.

    Techniques Used: Expressing, Mutagenesis, Transgenic Assay, Staining

    Inhibition of the Notch signaling pathway after liver cancer induction reduced cancer cell migration and improved survival. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy to observe the migration of cancer cells. ( B ) Zebrafish larvae were classified into three classes, I, II, and III, by the number of cancer cells outside the liver and the number of locations of metastases. ( C ) The proportion of the total number of larvae in different metastasis classes in the kras G12V + ( n = 46) and kras G12V + and dnMAML+ ( n = 130) groups at 9 dpf. ( D ) Kaplan–Meier survival curves of the DOX-induced kras G12V + ( n = 191) and kras G12V + and dnMAML+ ( n = 163) groups. p values for survival curves were calculated by log-rank test. Scale bars , 100 μm.
    Figure Legend Snippet: Inhibition of the Notch signaling pathway after liver cancer induction reduced cancer cell migration and improved survival. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy to observe the migration of cancer cells. ( B ) Zebrafish larvae were classified into three classes, I, II, and III, by the number of cancer cells outside the liver and the number of locations of metastases. ( C ) The proportion of the total number of larvae in different metastasis classes in the kras G12V + ( n = 46) and kras G12V + and dnMAML+ ( n = 130) groups at 9 dpf. ( D ) Kaplan–Meier survival curves of the DOX-induced kras G12V + ( n = 191) and kras G12V + and dnMAML+ ( n = 163) groups. p values for survival curves were calculated by log-rank test. Scale bars , 100 μm.

    Techniques Used: Inhibition, Migration, Transgenic Assay

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    TaKaRa ef1a tet on 3g system
    Ef1a Tet On 3g System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ef1a tet on 3g system/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ef1a tet on 3g system - by Bioz Stars, 2023-02
    95/100 stars
      Buy from Supplier

    95
    TaKaRa 3g inducible vector
    3g Inducible Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/3g inducible vector/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    3g inducible vector - by Bioz Stars, 2023-02
    95/100 stars
      Buy from Supplier

    94
    TaKaRa revtet on system
    Revtet On System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/revtet on system/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    revtet on system - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    94
    TaKaRa prevtet on expression system
    Prevtet On Expression System, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prevtet on expression system/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    prevtet on expression system - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    95
    TaKaRa tet on components
    (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the <t>reverse</t> <t>tetracycline-controlled</t> transcriptional activator ( rtTA ) gene while the <t>tetracycline</t> <t>responsive</t> element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.
    Tet On Components, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet on components/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tet on components - by Bioz Stars, 2023-02
    95/100 stars
      Buy from Supplier

    94
    TaKaRa tet on 3g inducible expression systems
    (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the <t>reverse</t> <t>tetracycline-controlled</t> transcriptional activator ( rtTA ) gene while the <t>tetracycline</t> <t>responsive</t> element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.
    Tet On 3g Inducible Expression Systems, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tet on 3g inducible expression systems/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tet on 3g inducible expression systems - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    94
    TaKaRa pcmv tet3g vector
    (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the <t>reverse</t> <t>tetracycline-controlled</t> transcriptional activator ( rtTA ) gene while the <t>tetracycline</t> <t>responsive</t> element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.
    Pcmv Tet3g Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcmv tet3g vector/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    pcmv tet3g vector - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    94
    TaKaRa tre3g system tet on 3g
    The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for <t>TRE3G</t> promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).
    Tre3g System Tet On 3g, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tre3g system tet on 3g/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tre3g system tet on 3g - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    94
    TaKaRa bidirectional tetracycline responsive element tre
    The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for <t>TRE3G</t> promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).
    Bidirectional Tetracycline Responsive Element Tre, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bidirectional tetracycline responsive element tre/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bidirectional tetracycline responsive element tre - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    94
    TaKaRa ptre3g bi
    The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V <t>-ZsGreen1)</t> with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.
    Ptre3g Bi, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ptre3g bi/product/TaKaRa
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ptre3g bi - by Bioz Stars, 2023-02
    94/100 stars
      Buy from Supplier

    Image Search Results


    (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the reverse tetracycline-controlled transcriptional activator ( rtTA ) gene while the tetracycline responsive element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.

    Journal: PLoS ONE

    Article Title: Two Types of Tet-On Transgenic Lines for Doxycycline-Inducible Gene Expression in Zebrafish Rod Photoreceptors and a Gateway-Based Tet-On Toolkit

    doi: 10.1371/journal.pone.0051270

    Figure Lengend Snippet: (A) Diagram of the construct used to generate a stable transgenic zebrafish line that expresses doxycycline (Dox)-inducible GFP specifically in rod photoreceptors. The Xenopus rhodopsin promoter ( Xla.rho ) drives expression of the reverse tetracycline-controlled transcriptional activator ( rtTA ) gene while the tetracycline responsive element ( TRE ) drives expression of GFP in the converse direction. (B, C) Confocal z-projections of retinal sections from 6 dpf Tg(Xla.rho:rtTA, TRE:GFP) larvae labeled with anti-Rhodopsin antibody (red). (B) No GFP fluorescence (green) is visible in the absence of Dox. (C) Rod photoreceptors show strong GFP fluorescence (green) when transgenic larvae are treated for 72 h with Dox (3–6 dpf). (D, E) Confocal z-projections of the photoreceptor layer of retinas from Tg(Xop:rtTA, TRE:GFP) adult fish labeled with anti-Rhodopsin (red) and anti-GFP (green) antibodies. (D) No anti-GFP immunofluorescence (green) is visible in the untreated adult photoreceptors, whereas strong anti-GFP immunofluorescence (green) is visible in the adult photoreceptors after treatment with Dox for 72 h (E). dA, polyadenylation signal; Tol2, pTol integration site. Scale bars, 50 µm.

    Article Snippet: The Tet-On components, including the tetracycline response element ( TRE ) from pTRE-Tight (Clontech), the bi-directional tetracycline-response element ( biTRE ) from pTRE-Tight-BI-AcGFP1 (Clontech), and the reverse tetracycline-controlled transcriptional transactivator ( rtTA ) coding region from pTet-On Advanced (Clontech) were moved to Gateway entry vectors.

    Techniques: Construct, Transgenic Assay, Expressing, Labeling, Fluorescence, Immunofluorescence

    The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for TRE3G promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).

    Journal: Cells

    Article Title: A Novel Cre/lox71-Based System for Inducible Expression of Recombinant Proteins and Genome Editing

    doi: 10.3390/cells11142141

    Figure Lengend Snippet: The effect of the number of lox71 sites on the transgene expression. Left panel—flow cytometry analysis of HEK293T cells transfected with the pVax1-lox71-C-GFP with one, three or six lox71 sites or control plasmids 48 h after the transfection. Right panel—fluorescent microscopy of transfected cells 48 h after the transfection. The number of lox71 sites is indicated within the construct name. Inductor: transfection by dCre Δ331 -VP4 gene for lox71 system and doxycycline for TRE3G promoter. *, The percentage of bright HEK293T cells among all GFP-positive cells; **, p < 0.05 compared to GFP fluorescence intensity of cells transfected with the appropriate plasmids without induction, n ≥ 30,000. Inductors: doxycycline for TetON 3G-GFP and dCre Δ331 -VP4 for lox71 1/3/6 -containing plasmids. In the diagram, data are presented as the median (25%; 75%).

    Article Snippet: Minimal promoter of TRE3G system Tet-On 3G (Takara Bio, Kusatsu, Japan, #631168), coreD (D for short) 5′-GAATTCTTTAGACGCGTACGGTGG GCGCCTATAAAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGCAATTCCACAACACTTTTGTCTTATACCAACTTTCCGTACCACTTCCTACCCTCGTAAA was used as a reference to assess the efficiency of A/B/C minimal synthetic promoters.

    Techniques: Expressing, Flow Cytometry, Transfection, Microscopy, Construct, Fluorescence

    The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.

    Journal: International Journal of Molecular Sciences

    Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

    doi: 10.3390/ijms23094705

    Figure Lengend Snippet: The Notch signaling pathway was upregulated after hepatocellular carcinoma induction, and the inhibition of Notch signaling suppressed hepatocyte dedifferentiation. ( A ) WISH results showed the expression pattern of notch1a , notch1b , notch2 , notch3 , and her15 at 10 dpf after DOX activation of kras G12V . ( B ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( C ) Monolayer images of Anxa4 antibody staining showed expression changes in the DOX-induced kras G12V + and kras G12V + and dnMAML+ groups at 8 dpf and 10 dpf. ( D ) Statistics of Anxa4 + and ZsGreen1 + /ZsGreen1+ ratio in the DOX-induced kras G12V + ( n = 11) and kras G12V + and dnMAML+ ( n = 13) groups at 8 dpf and 10 dpf. ( E ) The results of fluorescent in situ hybridization (FISH) showed sox9b expression in the DOX-induced control and kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. ( F ) The results of FISH showed cp expression in the DOX-induced control, kras G12V + and kras G12V + and dnMAML+ groups at 10 dpf. Numbers indicate the proportion of larvae exhibiting that expression. Asterisks show significance: ****— p < 0.0001. Scale bars—100 μm; error bars—S.D.

    Article Snippet: The cDNA of full-length Zebrafish kras was amplified by PrimeSTAR HS DNA polymerase (Takara) and point mutated to obtain kras G12V , cloned into the modified pTRE3G-BI:ZsGreen1 (Cat.631342, Clontech) vector; and TRE3G-BI is a bidirectional version of TRE3G promoter that allows for simultaneous, equivalent, and inducible expression of two transgenes.

    Techniques: Inhibition, Expressing, Activation Assay, Transgenic Assay, Staining, In Situ Hybridization

    Hepatic Sox9 expression is upregulated after hepatocellular carcinoma induction, and the sox9b fh313 mutant suppressed hepatocyte dedifferentiation. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( B , C ) Sox9 antibody staining indicated the number of Sox9+ cells in the liver at 10 dpf in the DOX-induced control ( n = 5), kras G12V + ( n = 5) and kras G12V + and dnMAML+ ( n = 5) groups with statistical results. ( D ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) treatment strategy in sox9b fh313 mutant. ( E ) Three-dimensional images of Anxa4 antibody staining showed biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutants at 8 dpf and 10 dpf. ( F ) Monolayer images of Anxa4 antibody staining biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutant at 8 dpf and 10 dpf. Asterisks show significance: *— p < 0.05; **— p < 0.01. Scale bars—100 μm; error bars—S.D.

    Journal: International Journal of Molecular Sciences

    Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

    doi: 10.3390/ijms23094705

    Figure Lengend Snippet: Hepatic Sox9 expression is upregulated after hepatocellular carcinoma induction, and the sox9b fh313 mutant suppressed hepatocyte dedifferentiation. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy. ( B , C ) Sox9 antibody staining indicated the number of Sox9+ cells in the liver at 10 dpf in the DOX-induced control ( n = 5), kras G12V + ( n = 5) and kras G12V + and dnMAML+ ( n = 5) groups with statistical results. ( D ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) treatment strategy in sox9b fh313 mutant. ( E ) Three-dimensional images of Anxa4 antibody staining showed biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutants at 8 dpf and 10 dpf. ( F ) Monolayer images of Anxa4 antibody staining biliary duct changes in the DOX-induced kras G12V + and kras G12V + sox9b fh313 mutant at 8 dpf and 10 dpf. Asterisks show significance: *— p < 0.05; **— p < 0.01. Scale bars—100 μm; error bars—S.D.

    Article Snippet: The cDNA of full-length Zebrafish kras was amplified by PrimeSTAR HS DNA polymerase (Takara) and point mutated to obtain kras G12V , cloned into the modified pTRE3G-BI:ZsGreen1 (Cat.631342, Clontech) vector; and TRE3G-BI is a bidirectional version of TRE3G promoter that allows for simultaneous, equivalent, and inducible expression of two transgenes.

    Techniques: Expressing, Mutagenesis, Transgenic Assay, Staining

    Inhibition of the Notch signaling pathway after liver cancer induction reduced cancer cell migration and improved survival. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy to observe the migration of cancer cells. ( B ) Zebrafish larvae were classified into three classes, I, II, and III, by the number of cancer cells outside the liver and the number of locations of metastases. ( C ) The proportion of the total number of larvae in different metastasis classes in the kras G12V + ( n = 46) and kras G12V + and dnMAML+ ( n = 130) groups at 9 dpf. ( D ) Kaplan–Meier survival curves of the DOX-induced kras G12V + ( n = 191) and kras G12V + and dnMAML+ ( n = 163) groups. p values for survival curves were calculated by log-rank test. Scale bars , 100 μm.

    Journal: International Journal of Molecular Sciences

    Article Title: Notch–Sox9 Axis Mediates Hepatocyte Dedifferentiation in Kras G12V -Induced Zebrafish Hepatocellular Carcinoma

    doi: 10.3390/ijms23094705

    Figure Lengend Snippet: Inhibition of the Notch signaling pathway after liver cancer induction reduced cancer cell migration and improved survival. ( A ) Tg(fabp10a:Tet3G;TRE3G:kras G12V -ZsGreen1) with Tg(Hsp70l:dnMAML-GFP) double transgenic fish line treatment strategy to observe the migration of cancer cells. ( B ) Zebrafish larvae were classified into three classes, I, II, and III, by the number of cancer cells outside the liver and the number of locations of metastases. ( C ) The proportion of the total number of larvae in different metastasis classes in the kras G12V + ( n = 46) and kras G12V + and dnMAML+ ( n = 130) groups at 9 dpf. ( D ) Kaplan–Meier survival curves of the DOX-induced kras G12V + ( n = 191) and kras G12V + and dnMAML+ ( n = 163) groups. p values for survival curves were calculated by log-rank test. Scale bars , 100 μm.

    Article Snippet: The cDNA of full-length Zebrafish kras was amplified by PrimeSTAR HS DNA polymerase (Takara) and point mutated to obtain kras G12V , cloned into the modified pTRE3G-BI:ZsGreen1 (Cat.631342, Clontech) vector; and TRE3G-BI is a bidirectional version of TRE3G promoter that allows for simultaneous, equivalent, and inducible expression of two transgenes.

    Techniques: Inhibition, Migration, Transgenic Assay