Structured Review

Roche template pcr system
<t>DC-PCR</t> analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic <t>DNA</t> was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.
Template Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 42 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/template pcr system/product/Roche
Average 94 stars, based on 42 article reviews
Price from $9.99 to $1999.99
template pcr system - by Bioz Stars, 2020-04
94/100 stars

Images

1) Product Images from "Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice"

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20041074

DC-PCR analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic DNA was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.
Figure Legend Snippet: DC-PCR analysis of genomic switch recombination in wild type and Atm −/− B cells. Genomic DNA was isolated from B cells activated in vitro for 6 d, digested with EcoRI, and ligated with T4 DNA ligase. Twofold serial dilutions were used as a template for DC-PCR using primers specific for the recombined S regions. nAChR levels were also determined by DC-PCR to control for equal template loading. The results shown are representative of two independent experiments.

Techniques Used: Polymerase Chain Reaction, Isolation, In Vitro

2) Product Images from "H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation"

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20030569

Switch region accessibility is normal in the absence of H2AX. Real time RT-PCR for (a) μ sterile transcript, (b) γ1 sterile transcript, and (c) γ1 circle transcript in wild-type (solid circles) and H2AX −/− (open circles) B cells stimulated with LPS and IL-4 over 3 d. Mean results from two independent cultures are expressed as fold induction relative to resting B cells. (d) Proportion of mutations in the Sγ1 5′ region in wild-type, AID −/− , and H2AX −/− B cells stimulated with LPS and IL-4 and sorted for IgM surface expression and 5 divisions. The number of mutations was: Resting B cells, 5 mutations/59,301 bp; wild-type, 26 mutations/53,624 bp; AID −/− , 5 mutations/52,164 bp; H2AX −/− , 21 mutations/53,838 bp. Pie charts and statistics are as in Fig. 1 .
Figure Legend Snippet: Switch region accessibility is normal in the absence of H2AX. Real time RT-PCR for (a) μ sterile transcript, (b) γ1 sterile transcript, and (c) γ1 circle transcript in wild-type (solid circles) and H2AX −/− (open circles) B cells stimulated with LPS and IL-4 over 3 d. Mean results from two independent cultures are expressed as fold induction relative to resting B cells. (d) Proportion of mutations in the Sγ1 5′ region in wild-type, AID −/− , and H2AX −/− B cells stimulated with LPS and IL-4 and sorted for IgM surface expression and 5 divisions. The number of mutations was: Resting B cells, 5 mutations/59,301 bp; wild-type, 26 mutations/53,624 bp; AID −/− , 5 mutations/52,164 bp; H2AX −/− , 21 mutations/53,838 bp. Pie charts and statistics are as in Fig. 1 .

Techniques Used: Quantitative RT-PCR, Expressing

Related Articles

Clone Assay:

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
Article Snippet: Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

Article Title: A cis-Acting Diversification Activator Both Necessary and Sufficient for AID-Mediated Hypermutation
Article Snippet: All targeting constructs except the ones belonging to the series of ‘W ’ fragment deletions and reconstitutions were made by cloning the arms sequences into pBluescriptKS+ (Stratagene, CA) and then inserting GFP2 either into unique BamHI or BglII sites as shown in and . .. PCR amplifications of all target arms were performed using the Expand long template PCR System (Roche, Switzerland), DT40 genomic DNA as template and primers as described in the .

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. DNA Manipulation and Generation of mPDF Mutants —Genomic DNA isolated from M. tuberculosis strain H37Ra ( ) was used for PCR amplification and subsequent cloning of the def gene (Rv0429c) in expression vector (pET-mPDF) as described elsewhere ( ).

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
Article Snippet: Genomic DNA was amplified by PCR using Pfu Turbo DNA polymerase (Stratagene) from 5,000 sorted cell equivalents in four independent reactions that were pooled for cloning experiments. .. Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche).

Centrifugation:

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science). .. They were harvested by centrifugation at 3000 × g for 10 min and resuspended in PB-buffer.

Amplification:

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
Article Snippet: .. Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

Article Title: Campylobacter jejuni Dps Protein Binds DNA in the Presence of Iron or Hydrogen Peroxide
Article Snippet: .. The entire pLHPCRcj1534c plasmid was amplified by inverted PCR using the Expand long template PCR system (Roche) and the Cj1534c InvF and Cj1534c InvR primers. .. The chloramphenicol resistance gene from pC46 was PCR amplified using Phusion polymerase (NEB) and the CATF and CATR primers ( ).

Article Title: A cis-Acting Diversification Activator Both Necessary and Sufficient for AID-Mediated Hypermutation
Article Snippet: Targeting Constructs The GFP2 construct was made by combining the RSV promoter-GFP open reading frame of pHypermut2 with a PCR amplicon including an IRES , the blasticidin resistance gene and the SV40 polyadenylation signal . .. PCR amplifications of all target arms were performed using the Expand long template PCR System (Roche, Switzerland), DT40 genomic DNA as template and primers as described in the .

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. DNA Manipulation and Generation of mPDF Mutants —Genomic DNA isolated from M. tuberculosis strain H37Ra ( ) was used for PCR amplification and subsequent cloning of the def gene (Rv0429c) in expression vector (pET-mPDF) as described elsewhere ( ).

Article Title: γCOP Is Required for Apical Protein Secretion and Epithelial Morphogenesis in Drosophila melanogaster
Article Snippet: .. Transgenes Using the expand long Template PCR system (Roche), the genomic region of γCOP and a ∼5.8 kb region between γCOP and the proximal gene CG1499 (ending at a Sal I site 3′ of the CG1499 gene) was amplified from ry506 flies according to the manufacturer's cycling conditions, using primer 100 for the 5′ end and primer 101 for the 3'end. .. This PCR product was subcloned into pCR 2.1 TOPO (Invitrogen).

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
Article Snippet: .. Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). ..

Binding Assay:

Article Title: mRNA Display Using Covalent Coupling of mRNA to Translated Proteins
Article Snippet: .. Expand long template PCR system (Roche) T7 RNA polymerase (NEB) 10× RNA polymerase buffer: 400 mM, Tris-HCl, pH7.9, 60 mM MgCl2 , 100 mM DTT, 20 mM spermidine RNase-free DNase (Promega) 10× DNase buffer: 400 mM Tris-HCl, pH8.0, 100 mM MgSO4 , 10 mM CaCl2 Acidic phenol chloroform : isoamyl alcohol (Ambion) 7.5 M LiCl RNA precipitation solution (Ambion) Puromycin oligo linker: 5′-Psoralen-(TAGCCGGTG)2′-OMe -dA15 C9C9dAdCdC-Puromycin-3′ Retic lysate IVT™ kit (Ambion) [35 S]-L-methionine (Perkin Elmer) Oligo(dT) cellulose (Ambion) 1× Oligo(dT) binding buffer: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA, 0.2% Triton X-100 Oligo(dT) wash buffer: 20 mM Tris-HCl, pH 8.0, 300 mM KCl, 0.1% Tween-20 RNase-free 10 mL poly-prep chromatography column (Biorad) SuperScript II RNase H− reverse transcriptase (Invitrogen) Reverse transcription primer: TTTTTTTTTTNNCCAGATCCAGACATTCCCAT Anti-FLAG M2 affinity gel (Sigma) FLAG peptide (Sigma) 100 mM glycine buffer pH3.5 1× TBST buffer: 20 mM Tris-HCl, pH8.0, 150 mM NaCl, 0.2 % Tween-20 1× TE buffer: 10 mM Tris-HCl, pH8.0, 1 mM EDTA NAP-5 column (GE Healthcare) NAP-10 column (GE Healthcare) QIAquick PCR purification kit (Qiagen) QIAquick gel extraction kit (Qiagen) .. Thermal cycler Nanodrop spectrophotometer UV lamp (Black Ray Lamp 365 nm, 0.16 Amps) Barnstead labquake shaker/rotator Scintillation counter

Synthesized:

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. Oligonucleotides used in this study were custom synthesized (Biobasic/IDT/Ocimum Biosolutions).

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: PrimerSelect (Lasergene package; DNAStar, Inc.) software was utilized for primer design, and oligonucleotides were synthesized by Microsynth (Balgach, Switzerland). .. PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland).

TA Cloning:

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
Article Snippet: Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

Construct:

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: A PCR hybrid construct was generated by fusing the CmR cassette of vector pX ( ) with homologous flanking regions of gene BH1040 ( ). .. PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science).

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: .. Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Targeting construct DNA was introduced into the R1 ES cell line ( ) by electroporation, and recombinant colonies were selected by addition of 400mg/ml Geneticin (Invitrogen, Burlington, ON, Canada).

Article Title: A cis-Acting Diversification Activator Both Necessary and Sufficient for AID-Mediated Hypermutation
Article Snippet: Paragraph title: Targeting Constructs ... PCR amplifications of all target arms were performed using the Expand long template PCR System (Roche, Switzerland), DT40 genomic DNA as template and primers as described in the .

Article Title: γCOP Is Required for Apical Protein Secretion and Epithelial Morphogenesis in Drosophila melanogaster
Article Snippet: Transgenes Using the expand long Template PCR system (Roche), the genomic region of γCOP and a ∼5.8 kb region between γCOP and the proximal gene CG1499 (ending at a Sal I site 3′ of the CG1499 gene) was amplified from ry506 flies according to the manufacturer's cycling conditions, using primer 100 for the 5′ end and primer 101 for the 3'end. .. In this way, the entire rescue construct was framed by two Not I sites, which were used to retrieve this genomic-cDNA-hybrid rescue construct and to clone it into the Not I site of pPCaSpeR4 resulting in pP {w+ γCOP Ω35} (or Ω35 for short notation).

Article Title: Distinct Roles for VeA and LaeA in Development and Pathogenesis of Aspergillus flavus ▿
Article Snippet: The veA replacement PCR products were constructed using fusion PCR following Szewczyk et al. ( ). .. All PCR steps were performed using an Expand long template PCR system (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions.

Expressing:

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. DNA Manipulation and Generation of mPDF Mutants —Genomic DNA isolated from M. tuberculosis strain H37Ra ( ) was used for PCR amplification and subsequent cloning of the def gene (Rv0429c) in expression vector (pET-mPDF) as described elsewhere ( ).

Western Blot:

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: .. ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. All other fine chemicals and reagents, including catalase, N -formyl-Met-Ala, and trinitrobenzene sulfonic acid, were procured from Sigma.

Transformation Assay:

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science). .. Transformation was done with B. halodurans protoplast cells following described methods ( , ).

Electroporation:

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Targeting construct DNA was introduced into the R1 ES cell line ( ) by electroporation, and recombinant colonies were selected by addition of 400mg/ml Geneticin (Invitrogen, Burlington, ON, Canada).

Inverse PCR:

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: Inverse PCR (iPCR) was performed as described elsewhere ( ). .. PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland).

Southern Blot:

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Colonies were analyzed by Southern blotting to screen for proper homologous recombinants as previously described ( ).

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland). .. Southern blot analysis was performed as described elsewhere ( ).

Generated:

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: A PCR hybrid construct was generated by fusing the CmR cassette of vector pX ( ) with homologous flanking regions of gene BH1040 ( ). .. PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science).

DNA Sequencing:

Article Title: Campylobacter jejuni Dps Protein Binds DNA in the Presence of Iron or Hydrogen Peroxide
Article Snippet: The entire pLHPCRcj1534c plasmid was amplified by inverted PCR using the Expand long template PCR system (Roche) and the Cj1534c InvF and Cj1534c InvR primers. .. One plasmid containing the chloramphenicol cassette, inserted into the cj1534c gene, in the same transcriptional orientation (verified by DNA sequencing), was named pLHPCRcj1543cCAT.

Polymerase Chain Reaction:

Article Title: Immunoglobulin Class Switch Recombination Is Impaired in Atm-deficient Mice
Article Snippet: .. Sμ–Sγ1 junctions were amplified from genomic DNA from CD40L–IL-4–stimulated B cells using Expand long template PCR system (Roche) and primers 5μ3, 5′-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-3′ and γ1-R, 5′-CAATTAGCTCCTGCTCTTCTGTGG-3′. .. Amplification conditions were 35 cycles at 95°C for 30 s, 58°C for 45 s, and 72°C for 2 min and 30 s. PCR products (500–1,000 bp) were gel extracted, cloned using TA cloning kit (Invitrogen), and sequenced using 5μ3 and γ1-R primers.

Article Title: mRNA Display Using Covalent Coupling of mRNA to Translated Proteins
Article Snippet: .. Expand long template PCR system (Roche) T7 RNA polymerase (NEB) 10× RNA polymerase buffer: 400 mM, Tris-HCl, pH7.9, 60 mM MgCl2 , 100 mM DTT, 20 mM spermidine RNase-free DNase (Promega) 10× DNase buffer: 400 mM Tris-HCl, pH8.0, 100 mM MgSO4 , 10 mM CaCl2 Acidic phenol chloroform : isoamyl alcohol (Ambion) 7.5 M LiCl RNA precipitation solution (Ambion) Puromycin oligo linker: 5′-Psoralen-(TAGCCGGTG)2′-OMe -dA15 C9C9dAdCdC-Puromycin-3′ Retic lysate IVT™ kit (Ambion) [35 S]-L-methionine (Perkin Elmer) Oligo(dT) cellulose (Ambion) 1× Oligo(dT) binding buffer: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA, 0.2% Triton X-100 Oligo(dT) wash buffer: 20 mM Tris-HCl, pH 8.0, 300 mM KCl, 0.1% Tween-20 RNase-free 10 mL poly-prep chromatography column (Biorad) SuperScript II RNase H− reverse transcriptase (Invitrogen) Reverse transcription primer: TTTTTTTTTTNNCCAGATCCAGACATTCCCAT Anti-FLAG M2 affinity gel (Sigma) FLAG peptide (Sigma) 100 mM glycine buffer pH3.5 1× TBST buffer: 20 mM Tris-HCl, pH8.0, 150 mM NaCl, 0.2 % Tween-20 1× TE buffer: 10 mM Tris-HCl, pH8.0, 1 mM EDTA NAP-5 column (GE Healthcare) NAP-10 column (GE Healthcare) QIAquick PCR purification kit (Qiagen) QIAquick gel extraction kit (Qiagen) .. Thermal cycler Nanodrop spectrophotometer UV lamp (Black Ray Lamp 365 nm, 0.16 Amps) Barnstead labquake shaker/rotator Scintillation counter

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: .. PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science). .. Transformation was done with B. halodurans protoplast cells following described methods ( , ).

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: .. Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Targeting construct DNA was introduced into the R1 ES cell line ( ) by electroporation, and recombinant colonies were selected by addition of 400mg/ml Geneticin (Invitrogen, Burlington, ON, Canada).

Article Title: Campylobacter jejuni Dps Protein Binds DNA in the Presence of Iron or Hydrogen Peroxide
Article Snippet: .. The entire pLHPCRcj1534c plasmid was amplified by inverted PCR using the Expand long template PCR system (Roche) and the Cj1534c InvF and Cj1534c InvR primers. .. The chloramphenicol resistance gene from pC46 was PCR amplified using Phusion polymerase (NEB) and the CATF and CATR primers ( ).

Article Title: A cis-Acting Diversification Activator Both Necessary and Sufficient for AID-Mediated Hypermutation
Article Snippet: .. PCR amplifications of all target arms were performed using the Expand long template PCR System (Roche, Switzerland), DT40 genomic DNA as template and primers as described in the . .. Since the ‘W ’ fragment was difficult to amplify as a single sequence, it was sequentially cloned by combining upstream and downstream PCR amplicons with a 2.2 kb AvrII /SpeI restriction fragment excised from the rearranged IgL targeting construct ‘Construct R ’ .

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: .. ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. All other fine chemicals and reagents, including catalase, N -formyl-Met-Ala, and trinitrobenzene sulfonic acid, were procured from Sigma.

Article Title: γCOP Is Required for Apical Protein Secretion and Epithelial Morphogenesis in Drosophila melanogaster
Article Snippet: .. Transgenes Using the expand long Template PCR system (Roche), the genomic region of γCOP and a ∼5.8 kb region between γCOP and the proximal gene CG1499 (ending at a Sal I site 3′ of the CG1499 gene) was amplified from ry506 flies according to the manufacturer's cycling conditions, using primer 100 for the 5′ end and primer 101 for the 3'end. .. This PCR product was subcloned into pCR 2.1 TOPO (Invitrogen).

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: .. PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland). .. Southern blot analysis was performed as described elsewhere ( ).

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
Article Snippet: .. Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). ..

Article Title: Distinct Roles for VeA and LaeA in Development and Pathogenesis of Aspergillus flavus ▿
Article Snippet: .. All PCR steps were performed using an Expand long template PCR system (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions. .. The final construct was confirmed with endonuclease digestion and PCR using primers Int veA For and Rev for internal veA and primers A. fumigatus pyrG For and Rev for pyrG .

Recombinant:

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Targeting construct DNA was introduced into the R1 ES cell line ( ) by electroporation, and recombinant colonies were selected by addition of 400mg/ml Geneticin (Invitrogen, Burlington, ON, Canada).

Molecular Weight:

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: .. ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. All other fine chemicals and reagents, including catalase, N -formyl-Met-Ala, and trinitrobenzene sulfonic acid, were procured from Sigma.

Mutagenesis:

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: Paragraph title: Mutant Construction ... PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science).

Article Title: Campylobacter jejuni Dps Protein Binds DNA in the Presence of Iron or Hydrogen Peroxide
Article Snippet: Paragraph title: Construction of the C. jejuni isogenic dps mutant strain. ... The entire pLHPCRcj1534c plasmid was amplified by inverted PCR using the Expand long template PCR system (Roche) and the Cj1534c InvF and Cj1534c InvR primers.

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
Article Snippet: Paragraph title: PCR and Mutation Analysis. ... Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche).

Isolation:

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: .. Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Targeting construct DNA was introduced into the R1 ES cell line ( ) by electroporation, and recombinant colonies were selected by addition of 400mg/ml Geneticin (Invitrogen, Burlington, ON, Canada).

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. DNA Manipulation and Generation of mPDF Mutants —Genomic DNA isolated from M. tuberculosis strain H37Ra ( ) was used for PCR amplification and subsequent cloning of the def gene (Rv0429c) in expression vector (pET-mPDF) as described elsewhere ( ).

Mouse Assay:

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: As the phenotype of Adamts4 −/− mice had not been reported at the beginning of this study, a mouse strain bearing a floxed Adamts4 allele was created in order to circumvent potential embryonic lethality in Adamts4 −/− mice by conditional gene targeting if necessary. .. Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in .

Sequencing:

Article Title: A cis-Acting Diversification Activator Both Necessary and Sufficient for AID-Mediated Hypermutation
Article Snippet: PCR amplifications of all target arms were performed using the Expand long template PCR System (Roche, Switzerland), DT40 genomic DNA as template and primers as described in the . .. Since the ‘W ’ fragment was difficult to amplify as a single sequence, it was sequentially cloned by combining upstream and downstream PCR amplicons with a 2.2 kb AvrII /SpeI restriction fragment excised from the rearranged IgL targeting construct ‘Construct R ’ .

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: .. PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland). .. Southern blot analysis was performed as described elsewhere ( ).

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
Article Snippet: Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). .. Sequence analysis was performed using Sequence Manager II software (DNASTAR).

Article Title: Bacteriophage Tuc2009 Encodes a Tail-Associated Cell Wall-Degrading Activity
Article Snippet: Paragraph title: DNA manipulations and sequencing. ... PCR amplifications were carried out using an EXPAND long template PCR system (Roche) according to the manufacturer's instructions with a Gene Amp PCR system 2400 thermal cycler (Perkin-Elmer) and the primers described in Table .

Purification:

Article Title: mRNA Display Using Covalent Coupling of mRNA to Translated Proteins
Article Snippet: .. Expand long template PCR system (Roche) T7 RNA polymerase (NEB) 10× RNA polymerase buffer: 400 mM, Tris-HCl, pH7.9, 60 mM MgCl2 , 100 mM DTT, 20 mM spermidine RNase-free DNase (Promega) 10× DNase buffer: 400 mM Tris-HCl, pH8.0, 100 mM MgSO4 , 10 mM CaCl2 Acidic phenol chloroform : isoamyl alcohol (Ambion) 7.5 M LiCl RNA precipitation solution (Ambion) Puromycin oligo linker: 5′-Psoralen-(TAGCCGGTG)2′-OMe -dA15 C9C9dAdCdC-Puromycin-3′ Retic lysate IVT™ kit (Ambion) [35 S]-L-methionine (Perkin Elmer) Oligo(dT) cellulose (Ambion) 1× Oligo(dT) binding buffer: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA, 0.2% Triton X-100 Oligo(dT) wash buffer: 20 mM Tris-HCl, pH 8.0, 300 mM KCl, 0.1% Tween-20 RNase-free 10 mL poly-prep chromatography column (Biorad) SuperScript II RNase H− reverse transcriptase (Invitrogen) Reverse transcription primer: TTTTTTTTTTNNCCAGATCCAGACATTCCCAT Anti-FLAG M2 affinity gel (Sigma) FLAG peptide (Sigma) 100 mM glycine buffer pH3.5 1× TBST buffer: 20 mM Tris-HCl, pH8.0, 150 mM NaCl, 0.2 % Tween-20 1× TE buffer: 10 mM Tris-HCl, pH8.0, 1 mM EDTA NAP-5 column (GE Healthcare) NAP-10 column (GE Healthcare) QIAquick PCR purification kit (Qiagen) QIAquick gel extraction kit (Qiagen) .. Thermal cycler Nanodrop spectrophotometer UV lamp (Black Ray Lamp 365 nm, 0.16 Amps) Barnstead labquake shaker/rotator Scintillation counter

Article Title: Campylobacter jejuni Dps Protein Binds DNA in the Presence of Iron or Hydrogen Peroxide
Article Snippet: The entire pLHPCRcj1534c plasmid was amplified by inverted PCR using the Expand long template PCR system (Roche) and the Cj1534c InvF and Cj1534c InvR primers. .. Both PCR products were purified, digested with BglII, and ligated.

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: .. ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. All other fine chemicals and reagents, including catalase, N -formyl-Met-Ala, and trinitrobenzene sulfonic acid, were procured from Sigma.

Article Title: Bacteriophage Tuc2009 Encodes a Tail-Associated Cell Wall-Degrading Activity
Article Snippet: PCR amplifications were carried out using an EXPAND long template PCR system (Roche) according to the manufacturer's instructions with a Gene Amp PCR system 2400 thermal cycler (Perkin-Elmer) and the primers described in Table . .. Purification of plasmids from E. coli was performed using a Wizard Plus SV Miniprep kit (Promega).

Plasmid Preparation:

Article Title: Identification and Characterization of a Novel-type Ferric Siderophore Reductase from a Gram-positive Extremophile *
Article Snippet: A PCR hybrid construct was generated by fusing the CmR cassette of vector pX ( ) with homologous flanking regions of gene BH1040 ( ). .. PCRs were performed with Platinum® Pfx DNA polymerase (Invitrogen) and the Expand long template PCR system (Roche Applied Science).

Article Title: Partially redundant functions of Adamts1 and Adamts4 in the perinatal development of the renal medulla
Article Snippet: .. Homologous sequences were isolated from R1 embryonic stem (ES) cell genomic DNA by PCR using the Expand long template PCR system (Roche Molecular Biochemicals, Laval, QC, Canada), and inserted into the targeting vector so as to generate the construct illustrated in . .. Targeting construct DNA was introduced into the R1 ES cell line ( ) by electroporation, and recombinant colonies were selected by addition of 400mg/ml Geneticin (Invitrogen, Burlington, ON, Canada).

Article Title: Campylobacter jejuni Dps Protein Binds DNA in the Presence of Iron or Hydrogen Peroxide
Article Snippet: .. The entire pLHPCRcj1534c plasmid was amplified by inverted PCR using the Expand long template PCR system (Roche) and the Cj1534c InvF and Cj1534c InvR primers. .. The chloramphenicol resistance gene from pC46 was PCR amplified using Phusion polymerase (NEB) and the CATF and CATR primers ( ).

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: .. ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. All other fine chemicals and reagents, including catalase, N -formyl-Met-Ala, and trinitrobenzene sulfonic acid, were procured from Sigma.

Article Title: Distinct Roles for VeA and LaeA in Development and Pathogenesis of Aspergillus flavus ▿
Article Snippet: Paragraph title: Fusion PCR and vector construction. ... All PCR steps were performed using an Expand long template PCR system (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions.

Software:

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: PrimerSelect (Lasergene package; DNAStar, Inc.) software was utilized for primer design, and oligonucleotides were synthesized by Microsynth (Balgach, Switzerland). .. PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland).

Article Title: H2AX Is Required for Recombination Between Immunoglobulin Switch Regions but Not for Intra-Switch Region Recombination or Somatic Hypermutation
Article Snippet: Sμ-Sγ1 junctions were amplified using Expand long template PCR system (Roche). .. Sequence analysis was performed using Sequence Manager II software (DNASTAR).

Positron Emission Tomography:

Article Title: Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity *Three Consecutive Arginines Are Important for the Mycobacterial Peptide Deformylase Enzyme Activity * S⃞
Article Snippet: ECL Western blotting detection kit, PCR DNA and gel band purification kit, and protein molecular weight markers were from GE Healthcare; the Expand long template PCR system was from Roche Applied Science; Herculase fusion DNA polymerase was from Stratagene; VentR DNA polymerase was from New England Biolabs; and plasmid DNA preparation kits were from Qiagen. .. DNA Manipulation and Generation of mPDF Mutants —Genomic DNA isolated from M. tuberculosis strain H37Ra ( ) was used for PCR amplification and subsequent cloning of the def gene (Rv0429c) in expression vector (pET-mPDF) as described elsewhere ( ).

Chromatography:

Article Title: mRNA Display Using Covalent Coupling of mRNA to Translated Proteins
Article Snippet: .. Expand long template PCR system (Roche) T7 RNA polymerase (NEB) 10× RNA polymerase buffer: 400 mM, Tris-HCl, pH7.9, 60 mM MgCl2 , 100 mM DTT, 20 mM spermidine RNase-free DNase (Promega) 10× DNase buffer: 400 mM Tris-HCl, pH8.0, 100 mM MgSO4 , 10 mM CaCl2 Acidic phenol chloroform : isoamyl alcohol (Ambion) 7.5 M LiCl RNA precipitation solution (Ambion) Puromycin oligo linker: 5′-Psoralen-(TAGCCGGTG)2′-OMe -dA15 C9C9dAdCdC-Puromycin-3′ Retic lysate IVT™ kit (Ambion) [35 S]-L-methionine (Perkin Elmer) Oligo(dT) cellulose (Ambion) 1× Oligo(dT) binding buffer: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA, 0.2% Triton X-100 Oligo(dT) wash buffer: 20 mM Tris-HCl, pH 8.0, 300 mM KCl, 0.1% Tween-20 RNase-free 10 mL poly-prep chromatography column (Biorad) SuperScript II RNase H− reverse transcriptase (Invitrogen) Reverse transcription primer: TTTTTTTTTTNNCCAGATCCAGACATTCCCAT Anti-FLAG M2 affinity gel (Sigma) FLAG peptide (Sigma) 100 mM glycine buffer pH3.5 1× TBST buffer: 20 mM Tris-HCl, pH8.0, 150 mM NaCl, 0.2 % Tween-20 1× TE buffer: 10 mM Tris-HCl, pH8.0, 1 mM EDTA NAP-5 column (GE Healthcare) NAP-10 column (GE Healthcare) QIAquick PCR purification kit (Qiagen) QIAquick gel extraction kit (Qiagen) .. Thermal cycler Nanodrop spectrophotometer UV lamp (Black Ray Lamp 365 nm, 0.16 Amps) Barnstead labquake shaker/rotator Scintillation counter

DNA Purification:

Article Title: Circumventing the Effect of Product Toxicity: Development of a Novel Two-Stage Production Process for the Lantibiotic Gallidermin ▿
Article Snippet: DNA purification steps were performed with JetQuick columns (Genomed GmbH, Löhne, Germany). .. PCR, with primers designed on the epidermin cluster sequence, was performed using the Expand long template PCR system (Roche, Basel, Switzerland).

Marker:

Article Title: Distinct Roles for VeA and LaeA in Development and Pathogenesis of Aspergillus flavus ▿
Article Snippet: Next, a 1.9-kb fragment of the pyrG auxotrophy marker gene was amplified from A. fumigatus AF293 genomic DNA using primers A. fumigatus pyrG For and Rev. .. All PCR steps were performed using an Expand long template PCR system (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions.

Gel Extraction:

Article Title: mRNA Display Using Covalent Coupling of mRNA to Translated Proteins
Article Snippet: .. Expand long template PCR system (Roche) T7 RNA polymerase (NEB) 10× RNA polymerase buffer: 400 mM, Tris-HCl, pH7.9, 60 mM MgCl2 , 100 mM DTT, 20 mM spermidine RNase-free DNase (Promega) 10× DNase buffer: 400 mM Tris-HCl, pH8.0, 100 mM MgSO4 , 10 mM CaCl2 Acidic phenol chloroform : isoamyl alcohol (Ambion) 7.5 M LiCl RNA precipitation solution (Ambion) Puromycin oligo linker: 5′-Psoralen-(TAGCCGGTG)2′-OMe -dA15 C9C9dAdCdC-Puromycin-3′ Retic lysate IVT™ kit (Ambion) [35 S]-L-methionine (Perkin Elmer) Oligo(dT) cellulose (Ambion) 1× Oligo(dT) binding buffer: 100 mM Tris-HCl, pH 8.0, 1 M NaCl, 10 mM EDTA, 0.2% Triton X-100 Oligo(dT) wash buffer: 20 mM Tris-HCl, pH 8.0, 300 mM KCl, 0.1% Tween-20 RNase-free 10 mL poly-prep chromatography column (Biorad) SuperScript II RNase H− reverse transcriptase (Invitrogen) Reverse transcription primer: TTTTTTTTTTNNCCAGATCCAGACATTCCCAT Anti-FLAG M2 affinity gel (Sigma) FLAG peptide (Sigma) 100 mM glycine buffer pH3.5 1× TBST buffer: 20 mM Tris-HCl, pH8.0, 150 mM NaCl, 0.2 % Tween-20 1× TE buffer: 10 mM Tris-HCl, pH8.0, 1 mM EDTA NAP-5 column (GE Healthcare) NAP-10 column (GE Healthcare) QIAquick PCR purification kit (Qiagen) QIAquick gel extraction kit (Qiagen) .. Thermal cycler Nanodrop spectrophotometer UV lamp (Black Ray Lamp 365 nm, 0.16 Amps) Barnstead labquake shaker/rotator Scintillation counter

Article Title: Distinct Roles for VeA and LaeA in Development and Pathogenesis of Aspergillus flavus ▿
Article Snippet: These three amplified PCR products were cleaned with a QIAquick gel extraction kit (Qiagen), quantified, and fused using published procedures ( ). .. All PCR steps were performed using an Expand long template PCR system (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche high pure pcr template preparation kit
    <t>PCR</t> analysis of extracted <t>DNA</t> from Nosema spore using primers ( 218 MITOC) specific for Nosema ceranae derived from 16 SrRNA of the protozoa( Lane 1-6), and the negative controls (TO1-3)
    High Pure Pcr Template Preparation Kit, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 274 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high pure pcr template preparation kit/product/Roche
    Average 99 stars, based on 274 article reviews
    Price from $9.99 to $1999.99
    high pure pcr template preparation kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    Roche expand long template pcr system
    Evidence of RAG involvement in Notch1 rearrangements in murine T-ALL . (A) Rearrangements in Notch1 deduced from sequencing of <t>PCR</t> products generated from 11 cell lines with type 1 deletions (top) and 3 cell lines with type 2 deletions (bottom). GL is the sequence of the germline <t>DNA</t> flanking the breakpoints. Nucleotide positions are expressed relative to the ATG start codon in exon 1 of Notch1 . Flanking sequences resembling RAG recognition sequences are boxed. Residues matching the consensus RAG signal sequence (a CACATGT heptamer followed by a 12- or 23-bp spacer and the nonameric sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. The point of joining in SCID-adh contains a single cytosine residue (underlined) of unknown origin. (B) Distribution of RAG2 binding and H3K4 trimethylation across the murine Notch1 locus. ChIP-Seq was performed with antibodies specific for RAG2 and H3K4-me3 on DNA immunoprecipitated from normal thymocytes (αRAG2 WT), thymocytes expressing a RAG1 D708A mutant (αRAG2 Mut) that binds chromatin but is catalytically inactive, and homozygous RAG2 knockout thymoctyes (αRAG2 −/− Histograms showing sequence reads that aligned to the murine genome are superimposed on a diagram of the Notch1 locus. The y-axis of each histogram corresponds to the number of aligned reads per 10 6 total reads.
    Expand Long Template Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long template pcr system/product/Roche
    Average 94 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    expand long template pcr system - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    PCR analysis of extracted DNA from Nosema spore using primers ( 218 MITOC) specific for Nosema ceranae derived from 16 SrRNA of the protozoa( Lane 1-6), and the negative controls (TO1-3)

    Journal: Iranian Journal of Parasitology

    Article Title: First Detection of Nosema ceranae, a Microsporidian Protozoa of European Honeybees (Apis mellifera) In Iran

    doi:

    Figure Lengend Snippet: PCR analysis of extracted DNA from Nosema spore using primers ( 218 MITOC) specific for Nosema ceranae derived from 16 SrRNA of the protozoa( Lane 1-6), and the negative controls (TO1-3)

    Article Snippet: DNA extraction was conducted using a High Pure PCR template preparation kit (catalog no. 1796828; Roche Diagnostic) as previously described ( ).

    Techniques: Polymerase Chain Reaction, Derivative Assay

    SP-D treatment does not alter C . burnetii stimulated transcriptional patterns in MH-S cells. MH-S cells were infected with PBS or SP-D treated C . burnetii RSA439 (phase II), RSA493 (phase I) or treated with E . coli LPS for 0, 4, and 8 hours. RNA was extracted as described and applied to real-time PCR. Data represent the mean ± standard deviation of fold change in RNA expression of select genes compared to expression of host cell Gapdh , n = 3. RSA439 and LPS data are representative of three independent experiments, RSA493 data are representative of two independent experiments. Student t-tests compare each time and condition to its corresponding 0 time point, all RSA439 and RSA439 + SP-D were significantly up-regulated * p

    Journal: PLoS ONE

    Article Title: Surfactant Protein D Binds to Coxiella burnetii and Results in a Decrease in Interactions with Murine Alveolar Macrophages

    doi: 10.1371/journal.pone.0136699

    Figure Lengend Snippet: SP-D treatment does not alter C . burnetii stimulated transcriptional patterns in MH-S cells. MH-S cells were infected with PBS or SP-D treated C . burnetii RSA439 (phase II), RSA493 (phase I) or treated with E . coli LPS for 0, 4, and 8 hours. RNA was extracted as described and applied to real-time PCR. Data represent the mean ± standard deviation of fold change in RNA expression of select genes compared to expression of host cell Gapdh , n = 3. RSA439 and LPS data are representative of three independent experiments, RSA493 data are representative of two independent experiments. Student t-tests compare each time and condition to its corresponding 0 time point, all RSA439 and RSA439 + SP-D were significantly up-regulated * p

    Article Snippet: Briefly, DNA was purified from C . burnetii at indicated time points using Roche High Pure PCR Template Prep Kit and then 2 uL of purified DNA was used in 20 uL real time PCR reactions using ABI Sybergreen master mix (Applied Biosystems by Life Technologies, Foster City, CA, USA) and primers specific for com1 (CBU_1910).

    Techniques: Infection, Real-time Polymerase Chain Reaction, Standard Deviation, RNA Expression, Expressing

    L . infantum parasite load detected at 6 months and 16 months post-infection in spleen, BM, liver, popliteal LN, and healthy pinna skin by real-time PCR. The number of parasites per milligram of tissue was calculated using a standard curve generated from DNA extracted from a known number of L . infantum promastigotes.

    Journal: PLoS ONE

    Article Title: Compartmentalized Immune Response in Leishmaniasis: Changing Patterns throughout the Disease

    doi: 10.1371/journal.pone.0155224

    Figure Lengend Snippet: L . infantum parasite load detected at 6 months and 16 months post-infection in spleen, BM, liver, popliteal LN, and healthy pinna skin by real-time PCR. The number of parasites per milligram of tissue was calculated using a standard curve generated from DNA extracted from a known number of L . infantum promastigotes.

    Article Snippet: Real-time PCR amplification of L . infantum DNA in tissue samples DNA was extracted using High Pure PCR Template Kit (Roche).

    Techniques: Infection, Real-time Polymerase Chain Reaction, Generated

    Evidence of RAG involvement in Notch1 rearrangements in murine T-ALL . (A) Rearrangements in Notch1 deduced from sequencing of PCR products generated from 11 cell lines with type 1 deletions (top) and 3 cell lines with type 2 deletions (bottom). GL is the sequence of the germline DNA flanking the breakpoints. Nucleotide positions are expressed relative to the ATG start codon in exon 1 of Notch1 . Flanking sequences resembling RAG recognition sequences are boxed. Residues matching the consensus RAG signal sequence (a CACATGT heptamer followed by a 12- or 23-bp spacer and the nonameric sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. The point of joining in SCID-adh contains a single cytosine residue (underlined) of unknown origin. (B) Distribution of RAG2 binding and H3K4 trimethylation across the murine Notch1 locus. ChIP-Seq was performed with antibodies specific for RAG2 and H3K4-me3 on DNA immunoprecipitated from normal thymocytes (αRAG2 WT), thymocytes expressing a RAG1 D708A mutant (αRAG2 Mut) that binds chromatin but is catalytically inactive, and homozygous RAG2 knockout thymoctyes (αRAG2 −/− Histograms showing sequence reads that aligned to the murine genome are superimposed on a diagram of the Notch1 locus. The y-axis of each histogram corresponds to the number of aligned reads per 10 6 total reads.

    Journal: Blood

    Article Title: Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1

    doi: 10.1182/blood-2010-05-286328

    Figure Lengend Snippet: Evidence of RAG involvement in Notch1 rearrangements in murine T-ALL . (A) Rearrangements in Notch1 deduced from sequencing of PCR products generated from 11 cell lines with type 1 deletions (top) and 3 cell lines with type 2 deletions (bottom). GL is the sequence of the germline DNA flanking the breakpoints. Nucleotide positions are expressed relative to the ATG start codon in exon 1 of Notch1 . Flanking sequences resembling RAG recognition sequences are boxed. Residues matching the consensus RAG signal sequence (a CACATGT heptamer followed by a 12- or 23-bp spacer and the nonameric sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. The point of joining in SCID-adh contains a single cytosine residue (underlined) of unknown origin. (B) Distribution of RAG2 binding and H3K4 trimethylation across the murine Notch1 locus. ChIP-Seq was performed with antibodies specific for RAG2 and H3K4-me3 on DNA immunoprecipitated from normal thymocytes (αRAG2 WT), thymocytes expressing a RAG1 D708A mutant (αRAG2 Mut) that binds chromatin but is catalytically inactive, and homozygous RAG2 knockout thymoctyes (αRAG2 −/− Histograms showing sequence reads that aligned to the murine genome are superimposed on a diagram of the Notch1 locus. The y-axis of each histogram corresponds to the number of aligned reads per 10 6 total reads.

    Article Snippet: Genomic DNA was amplified using the Expand Long Template PCR System (Roche Diagnostics), the sense primer ATGGTGGAATGCCTACTTTGTA, and the antisense primer CGTTTGGGTAGAAGAGATGCTTTAC.

    Techniques: Sequencing, Polymerase Chain Reaction, Generated, Binding Assay, Chromatin Immunoprecipitation, Immunoprecipitation, Expressing, Mutagenesis, Knock-Out

    Detection of 5′ deletions and aberrant Notch1 transcripts in primary murine “thymomas.” (A) Sequences of PCR products obtained by amplification of genomic DNA isolated from 2 thymic lymphomas with primers flanking the most common breakpoints associated with type 1 aberrant transcripts. Sites of DNA breakage and joining, as deduced from sequencing of PCR products, are shown. Residues matching the consensus RAG recognition sequence (CACAGTG followed by a 12- or 23-bp spacer and the sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. GL indicates germline DNA flanking the breakpoints. Boxes represent sequences resembling RAG signal sequences. (B) Ratiometric Notch1 quantitative RT-PCR analysis. The relative amounts of transcripts containing 5′ (exons 23 and 24) and 3′ (exons 30 and 31) Notch1 sequences were determined for the tumors in panel A and normal murine thymus, a cell line with a homozygous type 2 deletion (135.2), and a cell line with a heterozygous type 1 deletion (144). Each determination was made in triplicate. The results shown are representative of 2 independent experiments.

    Journal: Blood

    Article Title: Deletion-based mechanisms of Notch1 activation in T-ALL: key roles for RAG recombinase and a conserved internal translational start site in Notch1

    doi: 10.1182/blood-2010-05-286328

    Figure Lengend Snippet: Detection of 5′ deletions and aberrant Notch1 transcripts in primary murine “thymomas.” (A) Sequences of PCR products obtained by amplification of genomic DNA isolated from 2 thymic lymphomas with primers flanking the most common breakpoints associated with type 1 aberrant transcripts. Sites of DNA breakage and joining, as deduced from sequencing of PCR products, are shown. Residues matching the consensus RAG recognition sequence (CACAGTG followed by a 12- or 23-bp spacer and the sequence ACAAAAAAC) are denoted with an asterisk. N nucleotides and P nucleotides (underlined) are also shown. GL indicates germline DNA flanking the breakpoints. Boxes represent sequences resembling RAG signal sequences. (B) Ratiometric Notch1 quantitative RT-PCR analysis. The relative amounts of transcripts containing 5′ (exons 23 and 24) and 3′ (exons 30 and 31) Notch1 sequences were determined for the tumors in panel A and normal murine thymus, a cell line with a homozygous type 2 deletion (135.2), and a cell line with a heterozygous type 1 deletion (144). Each determination was made in triplicate. The results shown are representative of 2 independent experiments.

    Article Snippet: Genomic DNA was amplified using the Expand Long Template PCR System (Roche Diagnostics), the sense primer ATGGTGGAATGCCTACTTTGTA, and the antisense primer CGTTTGGGTAGAAGAGATGCTTTAC.

    Techniques: Polymerase Chain Reaction, Amplification, Isolation, Sequencing, Quantitative RT-PCR