Structured Review

Roche tcda
Toxin titers in cultures of parent and codY null mutant strains. R elative levels of <t>TcdA</t> and <t>TcdB</t> in culture supernatants of UK1, UK1 codY (LB-CD16) and UK1 codY/codY + (ND-CD10) collected after 24 hrs of bacterial growth were determined by ELISA. Two samples were assayed for each toxin for each strain; toxin levels were averaged and normalized to the values in the wild-type strain (UK1) set at 1.0. Error bars were created for all pairs of samples, but for some pairs the difference was so small that the bars are not visible.
Tcda, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tcda/product/Roche
Average 91 stars, based on 8 article reviews
Price from $9.99 to $1999.99
tcda - by Bioz Stars, 2020-05
91/100 stars

Images

1) Product Images from "Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027"

Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027

Journal: PLoS ONE

doi: 10.1371/journal.pone.0206896

Toxin titers in cultures of parent and codY null mutant strains. R elative levels of TcdA and TcdB in culture supernatants of UK1, UK1 codY (LB-CD16) and UK1 codY/codY + (ND-CD10) collected after 24 hrs of bacterial growth were determined by ELISA. Two samples were assayed for each toxin for each strain; toxin levels were averaged and normalized to the values in the wild-type strain (UK1) set at 1.0. Error bars were created for all pairs of samples, but for some pairs the difference was so small that the bars are not visible.
Figure Legend Snippet: Toxin titers in cultures of parent and codY null mutant strains. R elative levels of TcdA and TcdB in culture supernatants of UK1, UK1 codY (LB-CD16) and UK1 codY/codY + (ND-CD10) collected after 24 hrs of bacterial growth were determined by ELISA. Two samples were assayed for each toxin for each strain; toxin levels were averaged and normalized to the values in the wild-type strain (UK1) set at 1.0. Error bars were created for all pairs of samples, but for some pairs the difference was so small that the bars are not visible.

Techniques Used: Mutagenesis, Enzyme-linked Immunosorbent Assay

Effect of a codY null mutation on tcdA and tcdB transcription in strain UK1. Cultures of strains UK1, LB-CD16 ( codY :: intron :: erm ) and ND-CD10 ( codY :: intron :: erm codY + ) were grown in CDMM medium and samples were removed at 8 hrs (late exponential growth phase) and 24 hrs (stationary phase). RNA was extracted and assayed for tcdA and tcdB expression by qRT-PCR (see Materials and Methods ). Results for the toxin genes were normalized to those obtained for the rpoA gene.
Figure Legend Snippet: Effect of a codY null mutation on tcdA and tcdB transcription in strain UK1. Cultures of strains UK1, LB-CD16 ( codY :: intron :: erm ) and ND-CD10 ( codY :: intron :: erm codY + ) were grown in CDMM medium and samples were removed at 8 hrs (late exponential growth phase) and 24 hrs (stationary phase). RNA was extracted and assayed for tcdA and tcdB expression by qRT-PCR (see Materials and Methods ). Results for the toxin genes were normalized to those obtained for the rpoA gene.

Techniques Used: Mutagenesis, Expressing, Quantitative RT-PCR

2) Product Images from "Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro"

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro

Journal: Antimicrobial Agents and Chemotherapy

doi: 10.1128/AAC.00275-15

qRT-PCR analysis of tcdA expression following treatment with surotomycin, metronidazole, or vancomycin at 8× MIC. Strain UK1 was grown in CaCl 2 -supplemented TY medium for ∼12 h as described above, at which time the culture was split and drugs were added at 8× MIC. At 2, 4, 8, and 24 h after addition of drugs, cell samples were harvested, RNA was extracted, and cDNA was synthesized as described in Materials and Methods. cDNA corresponding to tcdA mRNA was quantified by real-time PCR. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and SEM of the data obtained. Results were calculated using the threshold cycle (2 −ΔΔ CT ) method, in which the amount of target mRNA was normalized to that of an internal control transcript ( rpoC ).
Figure Legend Snippet: qRT-PCR analysis of tcdA expression following treatment with surotomycin, metronidazole, or vancomycin at 8× MIC. Strain UK1 was grown in CaCl 2 -supplemented TY medium for ∼12 h as described above, at which time the culture was split and drugs were added at 8× MIC. At 2, 4, 8, and 24 h after addition of drugs, cell samples were harvested, RNA was extracted, and cDNA was synthesized as described in Materials and Methods. cDNA corresponding to tcdA mRNA was quantified by real-time PCR. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and SEM of the data obtained. Results were calculated using the threshold cycle (2 −ΔΔ CT ) method, in which the amount of target mRNA was normalized to that of an internal control transcript ( rpoC ).

Techniques Used: Quantitative RT-PCR, Expressing, Synthesized, Real-time Polymerase Chain Reaction

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in a final volume of 20 μl using 4 μl diluted cDNA and primers at 1 μM final concentration.

Article Title: Rapid Stool-Based Diagnosis of Clostridium difficile Infection by Real-Time PCR in a Children's Hospital ▿ Infection by Real-Time PCR in a Children's Hospital ▿ †
Article Snippet: .. The tcdA and tcdB real-time PCR singleplex assays were performed on the LightCycler 1.0 (Roche Diagnostics, Indianapolis, IN) under identical conditions with a total reaction volume of 20 μl. .. Each amplification reaction mixture using the LightCycler TaqMan Master kit (Roche Diagnostics, Indianapolis, IN) consisted of TaqMan Master Mix (4.0 μl 5×), 0.6 μM forward primer, 0.6 μM reverse primer, 0.1 μM hydrolysis probe, PCR grade water, and a 5-μl DNA sample.

Article Title: Rapid Stool-Based Diagnosis of Clostridium difficile Infection by Real-Time PCR in a Children's Hospital ▿ Infection by Real-Time PCR in a Children's Hospital ▿ †
Article Snippet: .. Because toxins A and/or B are implicated in CDAD and genetic diversity of the PaLoc has been reported , we developed and clinically validated two separate hydrolysis probe real-time PCR assays targeting the tcdA and tcdB genes on the Roche LightCycler 1.0 platform ( , , ). .. We subsequently multiplexed the tcdA and tcdB PCRs on the Roche LightCycler 2.0 platform.

Article Title: Proline-Dependent Regulation of Clostridium difficile Stickland Metabolism
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122/oLB123), prdA (primers oLB170/oLB171), prdC (primers oLB221/oLB222), prdD (primers oLB265/oLB266), prdF (primers oLB261/oLB262), grdE (primers oLB176/oLB177), and tcdA (primers oLB131/oLB132) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027
Article Snippet: .. Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Article Title: Rapid Stool-Based Diagnosis of Clostridium difficile Infection by Real-Time PCR in a Children's Hospital ▿ Infection by Real-Time PCR in a Children's Hospital ▿ †
Article Snippet: .. Real-time PCR detection was performed with tcdA and tcdB gene-specific primers and hydrolysis probes using the LightCycler platforms (Roche Diagnostics, Indianapolis, IN). .. The sensitivities of stool real-time PCR and stool EIA were 95% and 35%, respectively, with a specificity of 100% for both methods.

Multiplex Assay:

Article Title: Rapid Stool-Based Diagnosis of Clostridium difficile Infection by Real-Time PCR in a Children's Hospital ▿ Infection by Real-Time PCR in a Children's Hospital ▿ †
Article Snippet: .. The tcdA and tcdB gene-specific multiplex assay was performed on the LightCycler 2.0 platform (Roche Diagnostics, Indianapolis, IN) with a total reaction volume of 20 μl (with 10 μl input DNA compared to the 5 μl DNA required for the singleplex reactions). .. The amplification reaction using the LightCycler TaqMan Master kit (Roche Diagnostics, Indianapolis, IN) consisted of TaqMan Master Mix (4.0 μl 5×), 0.48 μM tcdA forward primer, 0.6 μM tcdB forward primer, 0.48 μM tcdA reverse primer, 0.6 μM tcdB reverse primer, 0.08 μM tcdA hydrolysis probe, 0.1 μl of tcdB hydrolysis probe, PCR grade water, 0.4 μl AmpErase (Applied Biosystems, Inc., Foster City, CA), and 10 μl extracted DNA.

Amplification:

Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027
Article Snippet: .. Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Quantitative RT-PCR:

Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027
Article Snippet: .. Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

SYBR Green Assay:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in a final volume of 20 μl using 4 μl diluted cDNA and primers at 1 μM final concentration.

Article Title: Proline-Dependent Regulation of Clostridium difficile Stickland Metabolism
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122/oLB123), prdA (primers oLB170/oLB171), prdC (primers oLB221/oLB222), prdD (primers oLB265/oLB266), prdF (primers oLB261/oLB262), grdE (primers oLB176/oLB177), and tcdA (primers oLB131/oLB132) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027
Article Snippet: .. Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Polymerase Chain Reaction:

Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. .. Reactions were performed in a final volume of 20 μl using 4 μl diluted cDNA and primers at 1 μM final concentration.

Article Title: Proline-Dependent Regulation of Clostridium difficile Stickland Metabolism
Article Snippet: .. To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122/oLB123), prdA (primers oLB170/oLB171), prdC (primers oLB221/oLB222), prdD (primers oLB265/oLB266), prdF (primers oLB261/oLB262), grdE (primers oLB176/oLB177), and tcdA (primers oLB131/oLB132) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027
Article Snippet: .. Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • tcda  (Roche)
    91
    Roche tcda
    Toxin titers in cultures of parent and codY null mutant strains. R elative levels of <t>TcdA</t> and <t>TcdB</t> in culture supernatants of UK1, UK1 codY (LB-CD16) and UK1 codY/codY + (ND-CD10) collected after 24 hrs of bacterial growth were determined by ELISA. Two samples were assayed for each toxin for each strain; toxin levels were averaged and normalized to the values in the wild-type strain (UK1) set at 1.0. Error bars were created for all pairs of samples, but for some pairs the difference was so small that the bars are not visible.
    Tcda, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tcda/product/Roche
    Average 91 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    tcda - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    Image Search Results


    Toxin titers in cultures of parent and codY null mutant strains. R elative levels of TcdA and TcdB in culture supernatants of UK1, UK1 codY (LB-CD16) and UK1 codY/codY + (ND-CD10) collected after 24 hrs of bacterial growth were determined by ELISA. Two samples were assayed for each toxin for each strain; toxin levels were averaged and normalized to the values in the wild-type strain (UK1) set at 1.0. Error bars were created for all pairs of samples, but for some pairs the difference was so small that the bars are not visible.

    Journal: PLoS ONE

    Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027

    doi: 10.1371/journal.pone.0206896

    Figure Lengend Snippet: Toxin titers in cultures of parent and codY null mutant strains. R elative levels of TcdA and TcdB in culture supernatants of UK1, UK1 codY (LB-CD16) and UK1 codY/codY + (ND-CD10) collected after 24 hrs of bacterial growth were determined by ELISA. Two samples were assayed for each toxin for each strain; toxin levels were averaged and normalized to the values in the wild-type strain (UK1) set at 1.0. Error bars were created for all pairs of samples, but for some pairs the difference was so small that the bars are not visible.

    Article Snippet: Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler.

    Techniques: Mutagenesis, Enzyme-linked Immunosorbent Assay

    Effect of a codY null mutation on tcdA and tcdB transcription in strain UK1. Cultures of strains UK1, LB-CD16 ( codY :: intron :: erm ) and ND-CD10 ( codY :: intron :: erm codY + ) were grown in CDMM medium and samples were removed at 8 hrs (late exponential growth phase) and 24 hrs (stationary phase). RNA was extracted and assayed for tcdA and tcdB expression by qRT-PCR (see Materials and Methods ). Results for the toxin genes were normalized to those obtained for the rpoA gene.

    Journal: PLoS ONE

    Article Title: Impact of CodY protein on metabolism, sporulation and virulence in Clostridioides difficile ribotype 027

    doi: 10.1371/journal.pone.0206896

    Figure Lengend Snippet: Effect of a codY null mutation on tcdA and tcdB transcription in strain UK1. Cultures of strains UK1, LB-CD16 ( codY :: intron :: erm ) and ND-CD10 ( codY :: intron :: erm codY + ) were grown in CDMM medium and samples were removed at 8 hrs (late exponential growth phase) and 24 hrs (stationary phase). RNA was extracted and assayed for tcdA and tcdB expression by qRT-PCR (see Materials and Methods ). Results for the toxin genes were normalized to those obtained for the rpoA gene.

    Article Snippet: Primers for qRT-PCR were designed using the online PrimerQuest tool from Integrated DNA Technologies ( http://www.idtdna.com/Scitools/Applications/Primerquest ), and amplification efficiencies for each primer set were determined prior to use. cDNA samples were used as templates for quantitative PCR of rpoA (defined as that of R20291_0096) (primers oLB273/oLB274), tcdA (primers oLB131/oLB132) and tcdB (primers oND32/oND33) using Roche SYBR Green I PCR mix and a Roche LightCycler 480 II thermocycler.

    Techniques: Mutagenesis, Expressing, Quantitative RT-PCR

    qRT-PCR analysis of tcdA expression following treatment with surotomycin, metronidazole, or vancomycin at 8× MIC. Strain UK1 was grown in CaCl 2 -supplemented TY medium for ∼12 h as described above, at which time the culture was split and drugs were added at 8× MIC. At 2, 4, 8, and 24 h after addition of drugs, cell samples were harvested, RNA was extracted, and cDNA was synthesized as described in Materials and Methods. cDNA corresponding to tcdA mRNA was quantified by real-time PCR. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and SEM of the data obtained. Results were calculated using the threshold cycle (2 −ΔΔ CT ) method, in which the amount of target mRNA was normalized to that of an internal control transcript ( rpoC ).

    Journal: Antimicrobial Agents and Chemotherapy

    Article Title: Effects of Surotomycin on Clostridium difficile Viability and Toxin Production In Vitro

    doi: 10.1128/AAC.00275-15

    Figure Lengend Snippet: qRT-PCR analysis of tcdA expression following treatment with surotomycin, metronidazole, or vancomycin at 8× MIC. Strain UK1 was grown in CaCl 2 -supplemented TY medium for ∼12 h as described above, at which time the culture was split and drugs were added at 8× MIC. At 2, 4, 8, and 24 h after addition of drugs, cell samples were harvested, RNA was extracted, and cDNA was synthesized as described in Materials and Methods. cDNA corresponding to tcdA mRNA was quantified by real-time PCR. Reactions were performed in triplicate using cDNA synthesized from each of a minimum of three biological replicates, and results are presented as the means and SEM of the data obtained. Results were calculated using the threshold cycle (2 −ΔΔ CT ) method, in which the amount of target mRNA was normalized to that of an internal control transcript ( rpoC ).

    Article Snippet: To control for chromosomal DNA contamination, mock cDNA synthesis reaction mixtures containing no reverse transcriptase were used as negative controls in subsequent amplifications. cDNA samples were diluted 4-fold and used as the templates for qPCR of rpoC (primers oLB122 [CTAGCTGCTCCTATGTCTCACATC] and oLB123 [CCAGTCTCTCCTGGATCAACTA]) and tcdA (primers oLB131 [GTATGGATAGGTGGAGAAGTCA] and oLB132 [CTCTTCCTCTAGTAGCTGTAATGC]) using Roche SYBR green I PCR mix and a Roche LightCycler 480 II thermocycler.

    Techniques: Quantitative RT-PCR, Expressing, Synthesized, Real-time Polymerase Chain Reaction