tbe running buffer  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TBE Buffer Tris borate EDTA 10X
    Description:
    Thermo Scientific 10X TBE Buffer Tris borate EDTA is the most commonly used buffer for DNA and RNA polyacrylamide gel electrophoresis TBE is used with non denaturing or denaturing 7 M urea gels It is also routinely used for DNA automated sequencing gel TBE can also be used for agarose gels but is not recommended for preparative gels for recovery of nucleic acids Since borate in TBE buffer is a strong inhibitor for many enzymes TAE buffer Tris Acetate EDTA buffer 10X powder sc 296647 is recommended when looking at enzymatic applications for the DNA sample Applications• Electrophoresis of nucleic acids in agarose and polyacrylamide gels• Used both as a running buffer and as a gel preparation buffer• Filtered through a 0 22 µm membrane• Recommended for electrophoresis of RNA and DNA fragments smaller than 1500 bpNoteDouble stranded linear nucleic acid molecules migrate about 10 slower in TBE buffer than in TAE buffer
    Catalog Number:
    B52
    Price:
    None
    Category:
    Lab Reagents and Chemicals
    Applications:
    Agarose Gel Electrophoresis|DNA & RNA Purification & Analysis|Nucleic Acid Gel Electrophoresis & Blotting
    Buy from Supplier


    Structured Review

    Thermo Fisher tbe running buffer
    2.3% native agarose gel in <t>0.5X</t> <t>TBE</t> buffer, showing a representative library prep from wild-type Okazaki fragments. The gel is stained with Ethidium Bromide. Monosome- and disome-sized fragments with ligated sequencing-adaptors can be seen along with
    Thermo Scientific 10X TBE Buffer Tris borate EDTA is the most commonly used buffer for DNA and RNA polyacrylamide gel electrophoresis TBE is used with non denaturing or denaturing 7 M urea gels It is also routinely used for DNA automated sequencing gel TBE can also be used for agarose gels but is not recommended for preparative gels for recovery of nucleic acids Since borate in TBE buffer is a strong inhibitor for many enzymes TAE buffer Tris Acetate EDTA buffer 10X powder sc 296647 is recommended when looking at enzymatic applications for the DNA sample Applications• Electrophoresis of nucleic acids in agarose and polyacrylamide gels• Used both as a running buffer and as a gel preparation buffer• Filtered through a 0 22 µm membrane• Recommended for electrophoresis of RNA and DNA fragments smaller than 1500 bpNoteDouble stranded linear nucleic acid molecules migrate about 10 slower in TBE buffer than in TAE buffer
    https://www.bioz.com/result/tbe running buffer/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tbe running buffer - by Bioz Stars, 2021-05
    99/100 stars

    Images

    1) Product Images from "Detection and sequencing of Okazaki fragments in S. cerevisiae"

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae

    Journal: Methods in molecular biology (Clifton, N.J.)

    doi: 10.1007/978-1-4939-2596-4_10

    2.3% native agarose gel in 0.5X TBE buffer, showing a representative library prep from wild-type Okazaki fragments. The gel is stained with Ethidium Bromide. Monosome- and disome-sized fragments with ligated sequencing-adaptors can be seen along with
    Figure Legend Snippet: 2.3% native agarose gel in 0.5X TBE buffer, showing a representative library prep from wild-type Okazaki fragments. The gel is stained with Ethidium Bromide. Monosome- and disome-sized fragments with ligated sequencing-adaptors can be seen along with

    Techniques Used: Agarose Gel Electrophoresis, Staining, Sequencing

    Okazaki fragment preparations resolved on 0.7% native agarose gel in 0.5X TBE buffer, stained with Ethidium bromide. Large genomic DNA can be seen above the corresponding 10kb band of 2log ladder, while contaminating RNA typically runs below 100bp as
    Figure Legend Snippet: Okazaki fragment preparations resolved on 0.7% native agarose gel in 0.5X TBE buffer, stained with Ethidium bromide. Large genomic DNA can be seen above the corresponding 10kb band of 2log ladder, while contaminating RNA typically runs below 100bp as

    Techniques Used: Agarose Gel Electrophoresis, Staining

    2) Product Images from "Effective and robust plasmid topology analysis and the subsequent characterization of the plasmid isoforms thereby observed"

    Article Title: Effective and robust plasmid topology analysis and the subsequent characterization of the plasmid isoforms thereby observed

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gnh124

    Quantitative AGE assay development. ( A ) Ethidium bromide versus Sybr-Gold ‘Staining’. Aliquots of 200 ng of four plasmid batches known to contain differing levels of recombinant plasmid were separated by AGE and then stained with 1× TBE containing either ethidium bromide (50 ng/ml) (left gel) or 1× Sybr-Gold (right gel) for 30 min prior to gel-image capture by Polaroid camera. Arrows indicate the position of low-level recombinants only clearly visible with Sybr-Gold staining. ( B ) Image analysis of a 1× Sybr-Gold stained gel using manufacture's recommended staining times. Image capture by ProXpress. For this analysis, 1, 2 and 5 μl volumes of MassRuler High Range DNA Ladder (MBI-Fermentas, Lithuania) were loaded in lanes 1, 2 and 3, respectively. Left panel, gel image with loads corresponding to DNA quantities (per band) ranging from 1.6 to 10 ng (lane 1), 3.2 to 20 ng (lane 2) and 8 to 50 ng (lane 3). Middle panel, schematic ImageQuant (Molecular Dynamics, SunnyVale, CA) generated electropherogram traces of each lane. Right panel, scatter-plot with trend-line representation of area-under-curve signal ( y -axis) against quantity (in nanograms) of DNA ( x -axis) of the combined 1.6 ng through to 50 ng results. This plot highlights the significant signal ‘plateau’ that develops above 50 ng loads ( C ) Extending assay linear range by increasing Sybr-Gold staining times. Triplicate 5 μl (lanes 1, 3 and 5) and 30 μl (lanes 2, 4 and 6) MassRuler DNA ladder loads were separated by AGE. Subsequently, the gel was then dissected longitudinally into three parts and stained for 20 min (lanes 1 and 2), 2 h (lanes 3 and 4) or 24 h (lanes 5 and 6). After such staining regimes, excess stain was removed by copious washing with water. Image analysis by ProXpress and scatter plot data representation was then undertaken as described above in (B). The 5 and 30 μl loads generate a collective DNA species quantitative range of between 8 and 300 ng. The results of analysis reveal the R 2 values obtained for the 20 min, 2 h and 24 h staining regimes are 0.910, 0.990 and 0.999, respectively.
    Figure Legend Snippet: Quantitative AGE assay development. ( A ) Ethidium bromide versus Sybr-Gold ‘Staining’. Aliquots of 200 ng of four plasmid batches known to contain differing levels of recombinant plasmid were separated by AGE and then stained with 1× TBE containing either ethidium bromide (50 ng/ml) (left gel) or 1× Sybr-Gold (right gel) for 30 min prior to gel-image capture by Polaroid camera. Arrows indicate the position of low-level recombinants only clearly visible with Sybr-Gold staining. ( B ) Image analysis of a 1× Sybr-Gold stained gel using manufacture's recommended staining times. Image capture by ProXpress. For this analysis, 1, 2 and 5 μl volumes of MassRuler High Range DNA Ladder (MBI-Fermentas, Lithuania) were loaded in lanes 1, 2 and 3, respectively. Left panel, gel image with loads corresponding to DNA quantities (per band) ranging from 1.6 to 10 ng (lane 1), 3.2 to 20 ng (lane 2) and 8 to 50 ng (lane 3). Middle panel, schematic ImageQuant (Molecular Dynamics, SunnyVale, CA) generated electropherogram traces of each lane. Right panel, scatter-plot with trend-line representation of area-under-curve signal ( y -axis) against quantity (in nanograms) of DNA ( x -axis) of the combined 1.6 ng through to 50 ng results. This plot highlights the significant signal ‘plateau’ that develops above 50 ng loads ( C ) Extending assay linear range by increasing Sybr-Gold staining times. Triplicate 5 μl (lanes 1, 3 and 5) and 30 μl (lanes 2, 4 and 6) MassRuler DNA ladder loads were separated by AGE. Subsequently, the gel was then dissected longitudinally into three parts and stained for 20 min (lanes 1 and 2), 2 h (lanes 3 and 4) or 24 h (lanes 5 and 6). After such staining regimes, excess stain was removed by copious washing with water. Image analysis by ProXpress and scatter plot data representation was then undertaken as described above in (B). The 5 and 30 μl loads generate a collective DNA species quantitative range of between 8 and 300 ng. The results of analysis reveal the R 2 values obtained for the 20 min, 2 h and 24 h staining regimes are 0.910, 0.990 and 0.999, respectively.

    Techniques Used: Staining, Plasmid Preparation, Recombinant, Generated

    Related Articles

    Electrophoresis:

    Article Title: Effective and robust plasmid topology analysis and the subsequent characterization of the plasmid isoforms thereby observed
    Article Snippet: A 25 × 20 cm2 0.6% agarose (1× TBE) gel containing 5.0 μg/ml chloroquine (Sigma–Aldrich) was employed. .. The 1× TBE running buffer also contained 5.0 μg/ml chloroquine, and electrophoresis was performed at 50 V for 48 h. Staining was carried out by soaking in 1× TBE containing 1× Sybr-Gold (Molecular Probes) for 24 h in the dark. .. For all MALLS analyses, a Wyatt Dawn EOS detector (Wyatt Technologies, Santa Barbara, CA) was connected in line to AEC (see above) and downstream of the UV detection.

    Staining:

    Article Title: Effective and robust plasmid topology analysis and the subsequent characterization of the plasmid isoforms thereby observed
    Article Snippet: A 25 × 20 cm2 0.6% agarose (1× TBE) gel containing 5.0 μg/ml chloroquine (Sigma–Aldrich) was employed. .. The 1× TBE running buffer also contained 5.0 μg/ml chloroquine, and electrophoresis was performed at 50 V for 48 h. Staining was carried out by soaking in 1× TBE containing 1× Sybr-Gold (Molecular Probes) for 24 h in the dark. .. For all MALLS analyses, a Wyatt Dawn EOS detector (Wyatt Technologies, Santa Barbara, CA) was connected in line to AEC (see above) and downstream of the UV detection.

    Article Title: ISWI chromatin remodellers sense nucleosome modifications to determine substrate preference
    Article Snippet: Forward: 5′-ATTTATTATGCATTTAGAATAAATTTTGTGTCGCCCTTG-3′ Reverse: 5′-CAGTCGAAAGACTGGGCCTTTC-3′ DNA fragment generated (bold, MMTV sequence): 5′-ATTTATTATGCATTTAGAATAAATTTTGTGTCGCCCTTGTCGCTGAGGTACCAGATCTGATATC ACTTGCAACAGTCCTAACATTCACCTCTTGTGTGTTTGTGTCTGTTCGCCATCCCGTCTCCGCTCGTCACTTATCCTTCACTTTCCAGAGGGTCCCCCCGCAGACCCCGGCGACCCTGGTCGGCCGACTGCGGCACAGTTTTTTG GATATCGGATCCCGTCAATCGAGAAGGGCG ACACCCCCTAATTAGCCCGG GCGAAAGGCCCAGTCTTTCGACTG-3′ Approximately 1 pmol of each nucleosome type was incubated in assay buffer (50 mM Tris, 150 mM NaCl, pH 7.5) for 1 h at 37 °C or 47 °C. .. After incubation, 5 µl of 50% sucrose was added to each sample and the samples were run on a 5% TBE gel in 0.5× TBE buffer for 40 min at 200 V. Nucleosomes were visualized by staining with SYBR Gold Nucleic Acid Gel Stain (ThermoFisher Scientific). ..

    Article Title: ISWI chromatin remodellers sense nucleosome modifications to determine substrate preference
    Article Snippet: Six-microlitre time points were taken at 1, 2.5, 5, 15, 30, and 60 min and each was quenched by addition of 6 µl quench buffer (assay buffer with 800 ng/µl sheared salmon sperm DNA (ThermoFisher Scientific)) and placement on ice. .. Quenched assay samples were directly run on a 5% TBE gel in 0.5× TBE buffer for 40 min at 200 V. Nucleosomes were visualized by staining with SYBR Gold Nucleic Acid Gel Stain (ThermoFisher Scientific). .. Densitometry measurements were performed quantify the movement of nucleosomes away from their initial position using Image Studio Lite (LI-COR).

    Article Title: Polymorphism of G4 associates: from stacks to wires via interlocks
    Article Snippet: A mixture of 10–100-nt ssDNA fragments (low molecular weight marker, Affymetrix) was used as a control. .. The gels were run for 2 h at 200 V at room temperature with a standard 1× TBE running buffer (for denaturing gels) or 1× TBE with 10 mM KCl (for non-denaturing gels), stained with SYBR Gold (Thermo Fisher Scientific, USA) and analysed using a Gel Doc scanner (Bio-Rad, USA). .. Nuclear magnetic resonance (NMR) spectroscopy For nuclear magnetic resonance (NMR) spectroscopy, ONs were dissolved in 20 mM Tris–HCl buffer (pH 7.6) containing 0, 10 or 20 mM KCl.

    Incubation:

    Article Title: ISWI chromatin remodellers sense nucleosome modifications to determine substrate preference
    Article Snippet: Forward: 5′-ATTTATTATGCATTTAGAATAAATTTTGTGTCGCCCTTG-3′ Reverse: 5′-CAGTCGAAAGACTGGGCCTTTC-3′ DNA fragment generated (bold, MMTV sequence): 5′-ATTTATTATGCATTTAGAATAAATTTTGTGTCGCCCTTGTCGCTGAGGTACCAGATCTGATATC ACTTGCAACAGTCCTAACATTCACCTCTTGTGTGTTTGTGTCTGTTCGCCATCCCGTCTCCGCTCGTCACTTATCCTTCACTTTCCAGAGGGTCCCCCCGCAGACCCCGGCGACCCTGGTCGGCCGACTGCGGCACAGTTTTTTG GATATCGGATCCCGTCAATCGAGAAGGGCG ACACCCCCTAATTAGCCCGG GCGAAAGGCCCAGTCTTTCGACTG-3′ Approximately 1 pmol of each nucleosome type was incubated in assay buffer (50 mM Tris, 150 mM NaCl, pH 7.5) for 1 h at 37 °C or 47 °C. .. After incubation, 5 µl of 50% sucrose was added to each sample and the samples were run on a 5% TBE gel in 0.5× TBE buffer for 40 min at 200 V. Nucleosomes were visualized by staining with SYBR Gold Nucleic Acid Gel Stain (ThermoFisher Scientific). ..

    Article Title: Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid and Accurate Confirmatory Diagnosis of HTLV-1/2 Infection
    Article Snippet: Isothermal amplification was preceded by a preheating step, in which 5 μL of DNA was incubated with a mixture containing the MgSO4 , betaine, primers and dNTPs at 95 °C for 5 min, 65 °C for 1 min, 22 °C for 5 min, and then transferred to ice. .. Afterwards, a mixture with Bst DNA polymerase and ThermoPol® buffer was added into the tubes, and reactions were incubated at 65 °C for 1 h, followed by an enzyme inactivation step at 80 °C for 10 min. Two-microliters of LAMP reactions were electrophoresed in 2% agarose gel (Invitrogen, Carlsbad, CA, USA) in 1× Tris-Borate-EDTA (TBE) buffer (Invitrogen, Grand Island, NY, USA) containing 0.5× GelRed™ (Biotium, Fremont, CA, USA) at 100 V for 1 h. DNA amplification was also revealed with SYBR™ Green I (Invitrogen, Carlsbad, CA, USA) added to the reaction tubes to a 100× final concentration. .. Results were recorded in a L-PIX UV gel imaging system (Loccus Biotecnologia, Campinas, Brazil).

    Agarose Gel Electrophoresis:

    Article Title: Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid and Accurate Confirmatory Diagnosis of HTLV-1/2 Infection
    Article Snippet: Isothermal amplification was preceded by a preheating step, in which 5 μL of DNA was incubated with a mixture containing the MgSO4 , betaine, primers and dNTPs at 95 °C for 5 min, 65 °C for 1 min, 22 °C for 5 min, and then transferred to ice. .. Afterwards, a mixture with Bst DNA polymerase and ThermoPol® buffer was added into the tubes, and reactions were incubated at 65 °C for 1 h, followed by an enzyme inactivation step at 80 °C for 10 min. Two-microliters of LAMP reactions were electrophoresed in 2% agarose gel (Invitrogen, Carlsbad, CA, USA) in 1× Tris-Borate-EDTA (TBE) buffer (Invitrogen, Grand Island, NY, USA) containing 0.5× GelRed™ (Biotium, Fremont, CA, USA) at 100 V for 1 h. DNA amplification was also revealed with SYBR™ Green I (Invitrogen, Carlsbad, CA, USA) added to the reaction tubes to a 100× final concentration. .. Results were recorded in a L-PIX UV gel imaging system (Loccus Biotecnologia, Campinas, Brazil).

    Amplification:

    Article Title: Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid and Accurate Confirmatory Diagnosis of HTLV-1/2 Infection
    Article Snippet: Isothermal amplification was preceded by a preheating step, in which 5 μL of DNA was incubated with a mixture containing the MgSO4 , betaine, primers and dNTPs at 95 °C for 5 min, 65 °C for 1 min, 22 °C for 5 min, and then transferred to ice. .. Afterwards, a mixture with Bst DNA polymerase and ThermoPol® buffer was added into the tubes, and reactions were incubated at 65 °C for 1 h, followed by an enzyme inactivation step at 80 °C for 10 min. Two-microliters of LAMP reactions were electrophoresed in 2% agarose gel (Invitrogen, Carlsbad, CA, USA) in 1× Tris-Borate-EDTA (TBE) buffer (Invitrogen, Grand Island, NY, USA) containing 0.5× GelRed™ (Biotium, Fremont, CA, USA) at 100 V for 1 h. DNA amplification was also revealed with SYBR™ Green I (Invitrogen, Carlsbad, CA, USA) added to the reaction tubes to a 100× final concentration. .. Results were recorded in a L-PIX UV gel imaging system (Loccus Biotecnologia, Campinas, Brazil).

    SYBR Green Assay:

    Article Title: Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid and Accurate Confirmatory Diagnosis of HTLV-1/2 Infection
    Article Snippet: Isothermal amplification was preceded by a preheating step, in which 5 μL of DNA was incubated with a mixture containing the MgSO4 , betaine, primers and dNTPs at 95 °C for 5 min, 65 °C for 1 min, 22 °C for 5 min, and then transferred to ice. .. Afterwards, a mixture with Bst DNA polymerase and ThermoPol® buffer was added into the tubes, and reactions were incubated at 65 °C for 1 h, followed by an enzyme inactivation step at 80 °C for 10 min. Two-microliters of LAMP reactions were electrophoresed in 2% agarose gel (Invitrogen, Carlsbad, CA, USA) in 1× Tris-Borate-EDTA (TBE) buffer (Invitrogen, Grand Island, NY, USA) containing 0.5× GelRed™ (Biotium, Fremont, CA, USA) at 100 V for 1 h. DNA amplification was also revealed with SYBR™ Green I (Invitrogen, Carlsbad, CA, USA) added to the reaction tubes to a 100× final concentration. .. Results were recorded in a L-PIX UV gel imaging system (Loccus Biotecnologia, Campinas, Brazil).

    Concentration Assay:

    Article Title: Loop-Mediated Isothermal Amplification (LAMP) Assay for Rapid and Accurate Confirmatory Diagnosis of HTLV-1/2 Infection
    Article Snippet: Isothermal amplification was preceded by a preheating step, in which 5 μL of DNA was incubated with a mixture containing the MgSO4 , betaine, primers and dNTPs at 95 °C for 5 min, 65 °C for 1 min, 22 °C for 5 min, and then transferred to ice. .. Afterwards, a mixture with Bst DNA polymerase and ThermoPol® buffer was added into the tubes, and reactions were incubated at 65 °C for 1 h, followed by an enzyme inactivation step at 80 °C for 10 min. Two-microliters of LAMP reactions were electrophoresed in 2% agarose gel (Invitrogen, Carlsbad, CA, USA) in 1× Tris-Borate-EDTA (TBE) buffer (Invitrogen, Grand Island, NY, USA) containing 0.5× GelRed™ (Biotium, Fremont, CA, USA) at 100 V for 1 h. DNA amplification was also revealed with SYBR™ Green I (Invitrogen, Carlsbad, CA, USA) added to the reaction tubes to a 100× final concentration. .. Results were recorded in a L-PIX UV gel imaging system (Loccus Biotecnologia, Campinas, Brazil).

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae
    Article Snippet: .. YPD (1% yeast extract, 2% peptone: autoclave and add filter-sterilized 40% glucose to a final concentration of 2%) 100mg/ml Doxycycline hydrochloride stock solution in DMSO (if using Dox-repressible CDC9 construct) (Fisher Scientific, Cat #BP2653-5) Shaking incubator 250ml Erlenmeyer flasks SCE: 1M sorbitol, 100mM sodium citrate, 60mM EDTA. pH to 7.0, filter-sterilize and store at 4°C Zymolyase 20T (Sunrise Science Products, N0766391) Lysis buffer: 50mM Tris-HCl pH8.0, 50mM EDTA, 100mM NaCl, 1.5% sarkosyl Proteinase K (Fisher Scientific, cat# BP1700100) Isopropanol 3M Sodium acetate, pH 5.2 Absolute ethanol STE: 100mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA Riboshredder RNase blend (Epicentre, cat #RS12500) or RNase A (20mg/ml stock solution) TE: 10mM Tris-HCl pH8.0, 1mM EDTA (Optional) Spin-X centrifuge tubes with 0.45um cellulose acetate filter (Costar, cat#8162) Agarose, 0.5x TAE/0.5x TBE running buffer, and GelRed or ethidium bromide (Invitrogen, Cat#15585-011) .. Klenow exo- DNA polymerase (NEB, cat#M0212L) α-[32P]dCTP 6000Ci/mmol (Perkin Elmer Health Sciences, cat#BLU013Z500UC) (Optional) illustra™ G-50 microspin columns (GE Healthcare Biosciences, cat #27-5330-02) 2-log ladder (NEB cat#N3200L) end-labeled with and γ-[32P]ATP (Perkin Elmer Health Sciences cat#BLU002H250UC) and T4 polynucleotide kinase (NEB cat #M0201L) Large-format agarose gel running apparatus (20×25cm) Agarose (Seakem LE or Invitrogen ultra-pure) 10X denaturing agarose running buffer: 500mM NaOH, 10mM EDTA 6X denaturing agarose loading buffer: 20% Ficoll, 300mM NaOH, 6mM EDTA 10mg/ml bromophenol blue stock solution Large plastic container for capillary transfer Plastic wrap (e.g. Saran wrap) 400 mM NaOH or 10X SSC for transfer (20X SSC: 3M NaCl, 300mM Sodium citrate dehydrate) EA Zeta-probe membrane (BioRad 1620159) or Genescreen™ Hybridization transfer membrane (Perkin Elmer, cat# NEF1018001PK) Hyblot 3A gel paper 20 X 20cm or 6MW Gel Blot Paper 20×20cm 0.83mm thick (Denvile B6003-20 or cat# 6MW-2020) Paper towels

    Construct:

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae
    Article Snippet: .. YPD (1% yeast extract, 2% peptone: autoclave and add filter-sterilized 40% glucose to a final concentration of 2%) 100mg/ml Doxycycline hydrochloride stock solution in DMSO (if using Dox-repressible CDC9 construct) (Fisher Scientific, Cat #BP2653-5) Shaking incubator 250ml Erlenmeyer flasks SCE: 1M sorbitol, 100mM sodium citrate, 60mM EDTA. pH to 7.0, filter-sterilize and store at 4°C Zymolyase 20T (Sunrise Science Products, N0766391) Lysis buffer: 50mM Tris-HCl pH8.0, 50mM EDTA, 100mM NaCl, 1.5% sarkosyl Proteinase K (Fisher Scientific, cat# BP1700100) Isopropanol 3M Sodium acetate, pH 5.2 Absolute ethanol STE: 100mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA Riboshredder RNase blend (Epicentre, cat #RS12500) or RNase A (20mg/ml stock solution) TE: 10mM Tris-HCl pH8.0, 1mM EDTA (Optional) Spin-X centrifuge tubes with 0.45um cellulose acetate filter (Costar, cat#8162) Agarose, 0.5x TAE/0.5x TBE running buffer, and GelRed or ethidium bromide (Invitrogen, Cat#15585-011) .. Klenow exo- DNA polymerase (NEB, cat#M0212L) α-[32P]dCTP 6000Ci/mmol (Perkin Elmer Health Sciences, cat#BLU013Z500UC) (Optional) illustra™ G-50 microspin columns (GE Healthcare Biosciences, cat #27-5330-02) 2-log ladder (NEB cat#N3200L) end-labeled with and γ-[32P]ATP (Perkin Elmer Health Sciences cat#BLU002H250UC) and T4 polynucleotide kinase (NEB cat #M0201L) Large-format agarose gel running apparatus (20×25cm) Agarose (Seakem LE or Invitrogen ultra-pure) 10X denaturing agarose running buffer: 500mM NaOH, 10mM EDTA 6X denaturing agarose loading buffer: 20% Ficoll, 300mM NaOH, 6mM EDTA 10mg/ml bromophenol blue stock solution Large plastic container for capillary transfer Plastic wrap (e.g. Saran wrap) 400 mM NaOH or 10X SSC for transfer (20X SSC: 3M NaCl, 300mM Sodium citrate dehydrate) EA Zeta-probe membrane (BioRad 1620159) or Genescreen™ Hybridization transfer membrane (Perkin Elmer, cat# NEF1018001PK) Hyblot 3A gel paper 20 X 20cm or 6MW Gel Blot Paper 20×20cm 0.83mm thick (Denvile B6003-20 or cat# 6MW-2020) Paper towels

    Lysis:

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae
    Article Snippet: .. YPD (1% yeast extract, 2% peptone: autoclave and add filter-sterilized 40% glucose to a final concentration of 2%) 100mg/ml Doxycycline hydrochloride stock solution in DMSO (if using Dox-repressible CDC9 construct) (Fisher Scientific, Cat #BP2653-5) Shaking incubator 250ml Erlenmeyer flasks SCE: 1M sorbitol, 100mM sodium citrate, 60mM EDTA. pH to 7.0, filter-sterilize and store at 4°C Zymolyase 20T (Sunrise Science Products, N0766391) Lysis buffer: 50mM Tris-HCl pH8.0, 50mM EDTA, 100mM NaCl, 1.5% sarkosyl Proteinase K (Fisher Scientific, cat# BP1700100) Isopropanol 3M Sodium acetate, pH 5.2 Absolute ethanol STE: 100mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA Riboshredder RNase blend (Epicentre, cat #RS12500) or RNase A (20mg/ml stock solution) TE: 10mM Tris-HCl pH8.0, 1mM EDTA (Optional) Spin-X centrifuge tubes with 0.45um cellulose acetate filter (Costar, cat#8162) Agarose, 0.5x TAE/0.5x TBE running buffer, and GelRed or ethidium bromide (Invitrogen, Cat#15585-011) .. Klenow exo- DNA polymerase (NEB, cat#M0212L) α-[32P]dCTP 6000Ci/mmol (Perkin Elmer Health Sciences, cat#BLU013Z500UC) (Optional) illustra™ G-50 microspin columns (GE Healthcare Biosciences, cat #27-5330-02) 2-log ladder (NEB cat#N3200L) end-labeled with and γ-[32P]ATP (Perkin Elmer Health Sciences cat#BLU002H250UC) and T4 polynucleotide kinase (NEB cat #M0201L) Large-format agarose gel running apparatus (20×25cm) Agarose (Seakem LE or Invitrogen ultra-pure) 10X denaturing agarose running buffer: 500mM NaOH, 10mM EDTA 6X denaturing agarose loading buffer: 20% Ficoll, 300mM NaOH, 6mM EDTA 10mg/ml bromophenol blue stock solution Large plastic container for capillary transfer Plastic wrap (e.g. Saran wrap) 400 mM NaOH or 10X SSC for transfer (20X SSC: 3M NaCl, 300mM Sodium citrate dehydrate) EA Zeta-probe membrane (BioRad 1620159) or Genescreen™ Hybridization transfer membrane (Perkin Elmer, cat# NEF1018001PK) Hyblot 3A gel paper 20 X 20cm or 6MW Gel Blot Paper 20×20cm 0.83mm thick (Denvile B6003-20 or cat# 6MW-2020) Paper towels

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae
    Article Snippet: .. YPD (1% yeast extract, 2% peptone: autoclave and add filter-sterilized 40% glucose to a final concentration of 2%) 100mg/ml Doxycycline hydrochloride stock solution in DMSO (if using Dox-repressible CDC9 construct) (Fisher Scientific, Cat #BP2653-5) Shaking incubator 250ml Erlenmeyer flasks SCE: 1M sorbitol, 100mM sodium citrate, 60mM EDTA. pH to 7.0, filter-sterilize and store at 4°C Zymolyase 20T (Sunrise Science Products, N0766391) Lysis buffer: 50mM Tris-HCl pH8.0, 50mM EDTA, 100mM NaCl, 1.5% sarkosyl Proteinase K (Fisher Scientific, cat# BP1700100) Isopropanol 3M Sodium acetate, pH 5.2 Absolute ethanol STE: 100mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA Riboshredder RNase blend (Epicentre, cat #RS12500) or RNase A (20mg/ml stock solution) TE: 10mM Tris-HCl pH8.0, 1mM EDTA (Optional) Spin-X centrifuge tubes with 0.45um cellulose acetate filter (Costar, cat#8162) Agarose, 0.5x TAE/0.5x TBE running buffer, and GelRed or ethidium bromide (Invitrogen, Cat#15585-011) .. Klenow exo- DNA polymerase (NEB, cat#M0212L) α-[32P]dCTP 6000Ci/mmol (Perkin Elmer Health Sciences, cat#BLU013Z500UC) (Optional) illustra™ G-50 microspin columns (GE Healthcare Biosciences, cat #27-5330-02) 2-log ladder (NEB cat#N3200L) end-labeled with and γ-[32P]ATP (Perkin Elmer Health Sciences cat#BLU002H250UC) and T4 polynucleotide kinase (NEB cat #M0201L) Large-format agarose gel running apparatus (20×25cm) Agarose (Seakem LE or Invitrogen ultra-pure) 10X denaturing agarose running buffer: 500mM NaOH, 10mM EDTA 6X denaturing agarose loading buffer: 20% Ficoll, 300mM NaOH, 6mM EDTA 10mg/ml bromophenol blue stock solution Large plastic container for capillary transfer Plastic wrap (e.g. Saran wrap) 400 mM NaOH or 10X SSC for transfer (20X SSC: 3M NaCl, 300mM Sodium citrate dehydrate) EA Zeta-probe membrane (BioRad 1620159) or Genescreen™ Hybridization transfer membrane (Perkin Elmer, cat# NEF1018001PK) Hyblot 3A gel paper 20 X 20cm or 6MW Gel Blot Paper 20×20cm 0.83mm thick (Denvile B6003-20 or cat# 6MW-2020) Paper towels

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher tbe running buffer
    Quantitative AGE assay development. ( A ) Ethidium bromide versus Sybr-Gold ‘Staining’. Aliquots of 200 ng of four plasmid batches known to contain differing levels of recombinant plasmid were separated by AGE and then stained with <t>1×</t> <t>TBE</t> containing either ethidium bromide (50 ng/ml) (left gel) or 1× Sybr-Gold (right gel) for 30 min prior to gel-image capture by Polaroid camera. Arrows indicate the position of low-level recombinants only clearly visible with Sybr-Gold staining. ( B ) Image analysis of a 1× Sybr-Gold stained gel using manufacture's recommended staining times. Image capture by ProXpress. For this analysis, 1, 2 and 5 μl volumes of MassRuler High Range DNA Ladder (MBI-Fermentas, Lithuania) were loaded in lanes 1, 2 and 3, respectively. Left panel, gel image with loads corresponding to DNA quantities (per band) ranging from 1.6 to 10 ng (lane 1), 3.2 to 20 ng (lane 2) and 8 to 50 ng (lane 3). Middle panel, schematic ImageQuant (Molecular Dynamics, SunnyVale, CA) generated electropherogram traces of each lane. Right panel, scatter-plot with trend-line representation of area-under-curve signal ( y -axis) against quantity (in nanograms) of DNA ( x -axis) of the combined 1.6 ng through to 50 ng results. This plot highlights the significant signal ‘plateau’ that develops above 50 ng loads ( C ) Extending assay linear range by increasing Sybr-Gold staining times. Triplicate 5 μl (lanes 1, 3 and 5) and 30 μl (lanes 2, 4 and 6) MassRuler DNA ladder loads were separated by AGE. Subsequently, the gel was then dissected longitudinally into three parts and stained for 20 min (lanes 1 and 2), 2 h (lanes 3 and 4) or 24 h (lanes 5 and 6). After such staining regimes, excess stain was removed by copious washing with water. Image analysis by ProXpress and scatter plot data representation was then undertaken as described above in (B). The 5 and 30 μl loads generate a collective DNA species quantitative range of between 8 and 300 ng. The results of analysis reveal the R 2 values obtained for the 20 min, 2 h and 24 h staining regimes are 0.910, 0.990 and 0.999, respectively.
    Tbe Running Buffer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tbe running buffer/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tbe running buffer - by Bioz Stars, 2021-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Quantitative AGE assay development. ( A ) Ethidium bromide versus Sybr-Gold ‘Staining’. Aliquots of 200 ng of four plasmid batches known to contain differing levels of recombinant plasmid were separated by AGE and then stained with 1× TBE containing either ethidium bromide (50 ng/ml) (left gel) or 1× Sybr-Gold (right gel) for 30 min prior to gel-image capture by Polaroid camera. Arrows indicate the position of low-level recombinants only clearly visible with Sybr-Gold staining. ( B ) Image analysis of a 1× Sybr-Gold stained gel using manufacture's recommended staining times. Image capture by ProXpress. For this analysis, 1, 2 and 5 μl volumes of MassRuler High Range DNA Ladder (MBI-Fermentas, Lithuania) were loaded in lanes 1, 2 and 3, respectively. Left panel, gel image with loads corresponding to DNA quantities (per band) ranging from 1.6 to 10 ng (lane 1), 3.2 to 20 ng (lane 2) and 8 to 50 ng (lane 3). Middle panel, schematic ImageQuant (Molecular Dynamics, SunnyVale, CA) generated electropherogram traces of each lane. Right panel, scatter-plot with trend-line representation of area-under-curve signal ( y -axis) against quantity (in nanograms) of DNA ( x -axis) of the combined 1.6 ng through to 50 ng results. This plot highlights the significant signal ‘plateau’ that develops above 50 ng loads ( C ) Extending assay linear range by increasing Sybr-Gold staining times. Triplicate 5 μl (lanes 1, 3 and 5) and 30 μl (lanes 2, 4 and 6) MassRuler DNA ladder loads were separated by AGE. Subsequently, the gel was then dissected longitudinally into three parts and stained for 20 min (lanes 1 and 2), 2 h (lanes 3 and 4) or 24 h (lanes 5 and 6). After such staining regimes, excess stain was removed by copious washing with water. Image analysis by ProXpress and scatter plot data representation was then undertaken as described above in (B). The 5 and 30 μl loads generate a collective DNA species quantitative range of between 8 and 300 ng. The results of analysis reveal the R 2 values obtained for the 20 min, 2 h and 24 h staining regimes are 0.910, 0.990 and 0.999, respectively.

    Journal: Nucleic Acids Research

    Article Title: Effective and robust plasmid topology analysis and the subsequent characterization of the plasmid isoforms thereby observed

    doi: 10.1093/nar/gnh124

    Figure Lengend Snippet: Quantitative AGE assay development. ( A ) Ethidium bromide versus Sybr-Gold ‘Staining’. Aliquots of 200 ng of four plasmid batches known to contain differing levels of recombinant plasmid were separated by AGE and then stained with 1× TBE containing either ethidium bromide (50 ng/ml) (left gel) or 1× Sybr-Gold (right gel) for 30 min prior to gel-image capture by Polaroid camera. Arrows indicate the position of low-level recombinants only clearly visible with Sybr-Gold staining. ( B ) Image analysis of a 1× Sybr-Gold stained gel using manufacture's recommended staining times. Image capture by ProXpress. For this analysis, 1, 2 and 5 μl volumes of MassRuler High Range DNA Ladder (MBI-Fermentas, Lithuania) were loaded in lanes 1, 2 and 3, respectively. Left panel, gel image with loads corresponding to DNA quantities (per band) ranging from 1.6 to 10 ng (lane 1), 3.2 to 20 ng (lane 2) and 8 to 50 ng (lane 3). Middle panel, schematic ImageQuant (Molecular Dynamics, SunnyVale, CA) generated electropherogram traces of each lane. Right panel, scatter-plot with trend-line representation of area-under-curve signal ( y -axis) against quantity (in nanograms) of DNA ( x -axis) of the combined 1.6 ng through to 50 ng results. This plot highlights the significant signal ‘plateau’ that develops above 50 ng loads ( C ) Extending assay linear range by increasing Sybr-Gold staining times. Triplicate 5 μl (lanes 1, 3 and 5) and 30 μl (lanes 2, 4 and 6) MassRuler DNA ladder loads were separated by AGE. Subsequently, the gel was then dissected longitudinally into three parts and stained for 20 min (lanes 1 and 2), 2 h (lanes 3 and 4) or 24 h (lanes 5 and 6). After such staining regimes, excess stain was removed by copious washing with water. Image analysis by ProXpress and scatter plot data representation was then undertaken as described above in (B). The 5 and 30 μl loads generate a collective DNA species quantitative range of between 8 and 300 ng. The results of analysis reveal the R 2 values obtained for the 20 min, 2 h and 24 h staining regimes are 0.910, 0.990 and 0.999, respectively.

    Article Snippet: The 1× TBE running buffer also contained 5.0 μg/ml chloroquine, and electrophoresis was performed at 50 V for 48 h. Staining was carried out by soaking in 1× TBE containing 1× Sybr-Gold (Molecular Probes) for 24 h in the dark.

    Techniques: Staining, Plasmid Preparation, Recombinant, Generated

    Characterization of barcoded 601 (BC-601) DNA a , BC-601 DNA prepared for all 115 nucleosome library members as described in Methods (Barcoded 601 (BC-601) DNA preparation). Ligation products are 192 bp in size and were visualized by polyacrylamide gel electrophoresis (5% acrylamide, 0.5× TBE, 200 V, 40 min) and staining with SYBR Safe DNA gel stain. A faint band corresponding to unligated 601 DNA (601) is slightly visible in certain cases. b .

    Journal: Nature

    Article Title: ISWI chromatin remodellers sense nucleosome modifications to determine substrate preference

    doi: 10.1038/nature23671

    Figure Lengend Snippet: Characterization of barcoded 601 (BC-601) DNA a , BC-601 DNA prepared for all 115 nucleosome library members as described in Methods (Barcoded 601 (BC-601) DNA preparation). Ligation products are 192 bp in size and were visualized by polyacrylamide gel electrophoresis (5% acrylamide, 0.5× TBE, 200 V, 40 min) and staining with SYBR Safe DNA gel stain. A faint band corresponding to unligated 601 DNA (601) is slightly visible in certain cases. b .

    Article Snippet: Quenched assay samples were directly run on a 5% TBE gel in 0.5× TBE buffer for 40 min at 200 V. Nucleosomes were visualized by staining with SYBR Gold Nucleic Acid Gel Stain (ThermoFisher Scientific).

    Techniques: Ligation, Polyacrylamide Gel Electrophoresis, Staining

    2.3% native agarose gel in 0.5X TBE buffer, showing a representative library prep from wild-type Okazaki fragments. The gel is stained with Ethidium Bromide. Monosome- and disome-sized fragments with ligated sequencing-adaptors can be seen along with

    Journal: Methods in molecular biology (Clifton, N.J.)

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae

    doi: 10.1007/978-1-4939-2596-4_10

    Figure Lengend Snippet: 2.3% native agarose gel in 0.5X TBE buffer, showing a representative library prep from wild-type Okazaki fragments. The gel is stained with Ethidium Bromide. Monosome- and disome-sized fragments with ligated sequencing-adaptors can be seen along with

    Article Snippet: YPD (1% yeast extract, 2% peptone: autoclave and add filter-sterilized 40% glucose to a final concentration of 2%) 100mg/ml Doxycycline hydrochloride stock solution in DMSO (if using Dox-repressible CDC9 construct) (Fisher Scientific, Cat #BP2653-5) Shaking incubator 250ml Erlenmeyer flasks SCE: 1M sorbitol, 100mM sodium citrate, 60mM EDTA. pH to 7.0, filter-sterilize and store at 4°C Zymolyase 20T (Sunrise Science Products, N0766391) Lysis buffer: 50mM Tris-HCl pH8.0, 50mM EDTA, 100mM NaCl, 1.5% sarkosyl Proteinase K (Fisher Scientific, cat# BP1700100) Isopropanol 3M Sodium acetate, pH 5.2 Absolute ethanol STE: 100mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA Riboshredder RNase blend (Epicentre, cat #RS12500) or RNase A (20mg/ml stock solution) TE: 10mM Tris-HCl pH8.0, 1mM EDTA (Optional) Spin-X centrifuge tubes with 0.45um cellulose acetate filter (Costar, cat#8162) Agarose, 0.5x TAE/0.5x TBE running buffer, and GelRed or ethidium bromide (Invitrogen, Cat#15585-011)

    Techniques: Agarose Gel Electrophoresis, Staining, Sequencing

    Okazaki fragment preparations resolved on 0.7% native agarose gel in 0.5X TBE buffer, stained with Ethidium bromide. Large genomic DNA can be seen above the corresponding 10kb band of 2log ladder, while contaminating RNA typically runs below 100bp as

    Journal: Methods in molecular biology (Clifton, N.J.)

    Article Title: Detection and sequencing of Okazaki fragments in S. cerevisiae

    doi: 10.1007/978-1-4939-2596-4_10

    Figure Lengend Snippet: Okazaki fragment preparations resolved on 0.7% native agarose gel in 0.5X TBE buffer, stained with Ethidium bromide. Large genomic DNA can be seen above the corresponding 10kb band of 2log ladder, while contaminating RNA typically runs below 100bp as

    Article Snippet: YPD (1% yeast extract, 2% peptone: autoclave and add filter-sterilized 40% glucose to a final concentration of 2%) 100mg/ml Doxycycline hydrochloride stock solution in DMSO (if using Dox-repressible CDC9 construct) (Fisher Scientific, Cat #BP2653-5) Shaking incubator 250ml Erlenmeyer flasks SCE: 1M sorbitol, 100mM sodium citrate, 60mM EDTA. pH to 7.0, filter-sterilize and store at 4°C Zymolyase 20T (Sunrise Science Products, N0766391) Lysis buffer: 50mM Tris-HCl pH8.0, 50mM EDTA, 100mM NaCl, 1.5% sarkosyl Proteinase K (Fisher Scientific, cat# BP1700100) Isopropanol 3M Sodium acetate, pH 5.2 Absolute ethanol STE: 100mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA Riboshredder RNase blend (Epicentre, cat #RS12500) or RNase A (20mg/ml stock solution) TE: 10mM Tris-HCl pH8.0, 1mM EDTA (Optional) Spin-X centrifuge tubes with 0.45um cellulose acetate filter (Costar, cat#8162) Agarose, 0.5x TAE/0.5x TBE running buffer, and GelRed or ethidium bromide (Invitrogen, Cat#15585-011)

    Techniques: Agarose Gel Electrophoresis, Staining

    RuvC and Nuc nuclease domains (A) Structures of the RuvC and Nuc domains. The α helices (red) and β strands (blue) in the RuvC (RNase H fold) and Nuc domains are numbered. Disordered regions are shown as dashed lines. (B) Active site of the RuvC domain. (C) Mutational analysis of key residues in the RuvC and Nuc domains. Effects of mutations on the ability to induce indels at two DNMT1 targets were examined (n = 3, error bars show mean ± SEM). Indel values are normalized against wild-type AsCpf1. (D) Spatial arrangement of the nuclease domains relative to the potential cleavage sites of the target DNA. The catalytic center of the RuvC domain is indicated by a red circle. The REC1 and PI domains are omitted for clarity. A schematic of the crRNA and target DNA is shown above the structure. The DNA strands not contained in the crystal structure are represented in light gray. (E) Interaction between Trp958 and the hydrophobic pocket in the REC2 domain. (F) The AsCpf1 R1226A mutant is a nickase cleaving the non-target DNA strand. The wild type or the R1226A mutant (inactivation of the Nuc domain) of AsCpf1 was incubated with crRNA and the target DNA, which was labeled at the 5′ ends of both strands (DNA 1), or at the 5′ end of either the non-target strand (DNA 2) or the target strand (DNA 3). The cleavage products were analyzed by 10% polyacrylamide TBE-Urea denaturing gel electrophoresis. The SpCas9 D10A mutant (inactivation of the RuvC domain) is a nickase cleaving the target strand, and was used as a control. .

    Journal: Cell

    Article Title: Crystal structure of Cpf1 in complex with guide RNA and target DNA

    doi: 10.1016/j.cell.2016.04.003

    Figure Lengend Snippet: RuvC and Nuc nuclease domains (A) Structures of the RuvC and Nuc domains. The α helices (red) and β strands (blue) in the RuvC (RNase H fold) and Nuc domains are numbered. Disordered regions are shown as dashed lines. (B) Active site of the RuvC domain. (C) Mutational analysis of key residues in the RuvC and Nuc domains. Effects of mutations on the ability to induce indels at two DNMT1 targets were examined (n = 3, error bars show mean ± SEM). Indel values are normalized against wild-type AsCpf1. (D) Spatial arrangement of the nuclease domains relative to the potential cleavage sites of the target DNA. The catalytic center of the RuvC domain is indicated by a red circle. The REC1 and PI domains are omitted for clarity. A schematic of the crRNA and target DNA is shown above the structure. The DNA strands not contained in the crystal structure are represented in light gray. (E) Interaction between Trp958 and the hydrophobic pocket in the REC2 domain. (F) The AsCpf1 R1226A mutant is a nickase cleaving the non-target DNA strand. The wild type or the R1226A mutant (inactivation of the Nuc domain) of AsCpf1 was incubated with crRNA and the target DNA, which was labeled at the 5′ ends of both strands (DNA 1), or at the 5′ end of either the non-target strand (DNA 2) or the target strand (DNA 3). The cleavage products were analyzed by 10% polyacrylamide TBE-Urea denaturing gel electrophoresis. The SpCas9 D10A mutant (inactivation of the RuvC domain) is a nickase cleaving the target strand, and was used as a control. .

    Article Snippet: For the RuvC domain mutants, the processed reactions were run on TBE 6% polyacrylamide or TBE-Urea 6% polyacrylamide gels (Life Technologies), and the gels were then stained with SYBR Gold (Invitrogen).

    Techniques: Mutagenesis, Incubation, Labeling, Nucleic Acid Electrophoresis