tb green premix ex taq  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    PrimeScript RT Reagent Kit
    Description:
    When synthesizing cDNA for real time PCR the PrimeScript RT Reagent Kit Perfect Real Time allows maximal flexibility during reaction assembly This reverse transcription reagent kit facilitates cDNA synthesis prior to analysis by real time PCR Designed for two step real time RT PCR also called qRT PCR or RT qPCR the PrimeScript RT Reagent Kit Perfect Real Time contains all of the components needed for reverse transcription including PrimeScript RTase RNase inhibitor random 6 mers oligo dT primer dNTPs and reaction buffer Because the kit s primers and RTase are provided as separate components there is greater flexibility in reaction assembly
    Catalog Number:
    rr037b
    Price:
    None
    Size:
    800 Rxns
    Category:
    PrimeScript RT reagent kit Reverse transcription prior to qPCR Real time PCR
    Buy from Supplier


    Structured Review

    TaKaRa tb green premix ex taq
    When synthesizing cDNA for real time PCR the PrimeScript RT Reagent Kit Perfect Real Time allows maximal flexibility during reaction assembly This reverse transcription reagent kit facilitates cDNA synthesis prior to analysis by real time PCR Designed for two step real time RT PCR also called qRT PCR or RT qPCR the PrimeScript RT Reagent Kit Perfect Real Time contains all of the components needed for reverse transcription including PrimeScript RTase RNase inhibitor random 6 mers oligo dT primer dNTPs and reaction buffer Because the kit s primers and RTase are provided as separate components there is greater flexibility in reaction assembly
    https://www.bioz.com/result/tb green premix ex taq/product/TaKaRa
    Average 99 stars, based on 61 article reviews
    Price from $9.99 to $1999.99
    tb green premix ex taq - by Bioz Stars, 2020-11
    99/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia
    Article Snippet: .. After extracting total RNA using TRIzol reagent, we detected miR-1-3p, its targets, and the internal references U6 and GAPDH using a PrimeScript miRNA RT-PCR Kit (TaKaRa, Dalian, China) or a standard SYBR-Green RT-PCR Kit (TaKaRa) according to the manufacturer's specifications. ..

    Transfection:

    Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
    Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

    Isolation:

    Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
    Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

    Infection:

    Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
    Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

    Real-time Polymerase Chain Reaction:

    Article Title: Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation
    Article Snippet: .. Quantitative real-time PCR Total RNA was extracted using Trizol reagent (Takara) and reverse transcribed using PrimeScript qRT-PCR kit (Takara) according to the protocol. .. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara) on a 7300 Real-time PCR system (Applied Biosystems Inc.), and the primer for EDIL3 was as follows: forward, GTGAACTGTCGGGTTGTTCTGAG; and reverse, 5′-GGTTCCCAAGTGAACATGTCCAT-3′.

    Article Title: Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis
    Article Snippet: .. Reverse transcription was performed according to the instructions of PrimeScript™ RT reagent Kit (Takara). qRT‐PCR analysis was performed following the method outlined by the GoTaq® qPCR Master Mix kit (TaKaRa). ..

    Article Title: RACK1 is indispensable for porcine reproductive and respiratory syndrome virus replication and NF-κB activation in Marc-145 cells
    Article Snippet: .. Isolation of total RNA, Reverse transcription and qPCR analysis As we previously described , total RNA was isolated from Marc-145 cells at different time points post transfection and PRRSV infection using the RNAiso Plus RNA isolation kit (Takara Dalian, China, Cat. #9108/9109), and subjected to reverse transcription (Takara PrimerScript RT reagents kit, Cat. #RR037A) and qPCR analysis (Clontech, SYBR Primer Ex Taq II kit, Cat. # RR820Q). .. The reverse transcription was performed in 10 µl reaction incubated at 37 °C for 15 mins and then at 85 °C for 5 s, containing 2 µl of 5× Prime Script Buffer, 0.5 µl of Prime Script RT Enzyme Mix 1, 0.5 µl of Oligo dT primer, 0.5 µl of Random 6 mers, 3 µl of RNA (480 ng) and 3.5 µl of water.

    Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
    Article Snippet: .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The reverse-transcribed RNA was primed with oligonucleotides specific for VEGFR1 (Flt-1) (forward: 5′–GGGCAGACTCTTGTCCTCAACT–3′ and reverse: 5′–CAGCTCATTTGCACCCTCGT–3′ ), VEGFR2 (Flk-1) (forward: 5′–GACTGTGGCGAAGTGTTTTTGA–3′ and reverse: 5′–GTGCAGGGGAGGGTTGGCGTAG–3′ ), and β-actin (forward: 5′–GTGCGGGACATCAAGGAGAA–3′ and reverse: 5′–AGGAAGGAGGGCTGGAAGAG–3′ ) (Applied Biosystems, Carlsbad, CA, USA).

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

    Quantitative RT-PCR:

    Article Title: Elevated autocrine EDIL3 protects hepatocellular carcinoma from anoikis through RGD-mediated integrin activation
    Article Snippet: .. Quantitative real-time PCR Total RNA was extracted using Trizol reagent (Takara) and reverse transcribed using PrimeScript qRT-PCR kit (Takara) according to the protocol. .. Quantitative real-time PCR analyses were performed with SYBR Premix Ex Taq (Takara) on a 7300 Real-time PCR system (Applied Biosystems Inc.), and the primer for EDIL3 was as follows: forward, GTGAACTGTCGGGTTGTTCTGAG; and reverse, 5′-GGTTCCCAAGTGAACATGTCCAT-3′.

    Article Title: Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis, et al. Meiotic gatekeeper STRA8 regulates cell cycle by interacting with SETD8 during spermatogenesis
    Article Snippet: .. Reverse transcription was performed according to the instructions of PrimeScript™ RT reagent Kit (Takara). qRT‐PCR analysis was performed following the method outlined by the GoTaq® qPCR Master Mix kit (TaKaRa). ..

    Article Title: Exosome-mediated secretion of LOXL4 promotes hepatocellular carcinoma cell invasion and metastasis
    Article Snippet: .. Quantitative real-time polymerase chain reaction (qRT-PCR) Total RNA was isolated from HCC tissues and cell lines using TRIzol RNA isolation reagent (Takara, Japan) and reverse transcribed using a PrimeScript qRT-PCR kit (Takara, Japan) according to the manufacturer’s instructions. .. QRT-PCR was performed with an SYBR(R) PrimeScript RT-PCR Kit (Takara, Japan) using an ABI7500 system (Applied Biosystems, USA) and with specific primers: LOXL4 [forward 5’-CCGCTGCAAGTATGATGG-3′; reverse 5’-GTTCCTGAGACGCTGTTC-3′], 18sRNA [forward 5’-TGCGAGTACTCAACACCAACA-3′; reverse 5’-GCATATCTTCGGCCCACA-3′].

    miRNA RT:

    Article Title: microRNA-153 Targets mTORC2 Component Rictor to Inhibit Glioma Cells
    Article Snippet: .. For miRNA analysis, real-time PCR was performed using PrimeScript miRNA RT-PCR Kit (Takara) according to the manufacturer’s instructions. ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: microRNA-153 Targets mTORC2 Component Rictor to Inhibit Glioma Cells
    Article Snippet: .. For miRNA analysis, real-time PCR was performed using PrimeScript miRNA RT-PCR Kit (Takara) according to the manufacturer’s instructions. ..

    Article Title: The PI3K/mTOR dual inhibitor BEZ235 suppresses proliferation and migration and reverses multidrug resistance in acute myeloid leukemia
    Article Snippet: .. After extracting total RNA using TRIzol reagent, we detected miR-1-3p, its targets, and the internal references U6 and GAPDH using a PrimeScript miRNA RT-PCR Kit (TaKaRa, Dalian, China) or a standard SYBR-Green RT-PCR Kit (TaKaRa) according to the manufacturer's specifications. ..

    Article Title: Effects and mechanism of aromatic aminoketone SY0916 on osteoclastic bone destruction
    Article Snippet: .. SYBR® PrimeScriptTM RT-PCR kit was from Takara. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa circrna 0079201
    <t>hsa_circRNA_0079201</t> significantly increases SMAD2 expression by suppressing miR-140-3p. SMAD2 (A) mRNA and (B) protein expression level was increased compared with that in the control group following overcircRNA_0079201. The expression of IHH, a SMAD2 target gene, was decreased compared with that in the control group following overcircRNA_0079201. (C and D) Though SMAD2 showed upregulation in the overcircRNA_0079201 group compared with the normal control group, no significant difference was observed in the SMAD2 mRNA or protein expression levels between the overcircRNA_ 0079201+ miR-140-3p mimic group and normal control group. Like SMAD2, IHH expression did not also demonstrate significant difference between the overcircRNA_ 0079201+ miR-140-3p mimic group and normal control group. This indicated hsa_circRNA_0079201 significantly increases SMAD2 expression and decreased IHH expression by suppressing miR-140-3p. The data are presented as the mean ± SD. n=3. *** P
    Circrna 0079201, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/circrna 0079201/product/TaKaRa
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    circrna 0079201 - by Bioz Stars, 2020-11
    90/100 stars
      Buy from Supplier

    99
    TaKaRa terra qpcr direct tb green premix
    KIF18A expression was effectively blocked in both A549 and H1975 human lung adenocarcinoma cells caused by its shRNA plasmids. (a) Quantitative <t>PCR</t> assays revealed the dramatically reduced expression levels of KIF18A caused by its shRNA in both A549 and H1975 cells, respectively. (b) Immunoblot assays confirmed the efficient silencing of KIF18A caused by its shRNA plasmids in A549 and H1975 cells. Results are presented as the mean ± SD; ∗ P
    Terra Qpcr Direct Tb Green Premix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/terra qpcr direct tb green premix/product/TaKaRa
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    terra qpcr direct tb green premix - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    99
    TaKaRa tb green premix ex taq ii mastermix
    Specificity of qPCR-ML (A) and qPCR-ama (B). The qPCR amplicons were run on a 2% agarose gel. Both qPCR assays were performed using three different PCR master mix: SYBR green PCR master mix, Diatheva (I); RT2 SYBR Green ROX FAST <t>Mastermix,</t> Qiagen (II); TB Green premix ex <t>Taq</t> II Mastermix, Takara Bio (III). For each master mix, DNA from L. ( L. ) infantum (0,006 ng/μl) , L. ( L. ) amazonensis (0,15 ng/μl) , Trypanosoma cruzi (0,1 ng/μl) and human DNA (30 ng/μl) were tested with the condition described in the manuscript. As negative control, a no template control was used for each qPCR run. M: ΦX174 DNA/ Bsu RI ( Hae III) Marker, 9 (ThermoFisher Scientific); NTC: no template control.
    Tb Green Premix Ex Taq Ii Mastermix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/tb green premix ex taq ii mastermix/product/TaKaRa
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    tb green premix ex taq ii mastermix - by Bioz Stars, 2020-11
    99/100 stars
      Buy from Supplier

    Image Search Results


    hsa_circRNA_0079201 significantly increases SMAD2 expression by suppressing miR-140-3p. SMAD2 (A) mRNA and (B) protein expression level was increased compared with that in the control group following overcircRNA_0079201. The expression of IHH, a SMAD2 target gene, was decreased compared with that in the control group following overcircRNA_0079201. (C and D) Though SMAD2 showed upregulation in the overcircRNA_0079201 group compared with the normal control group, no significant difference was observed in the SMAD2 mRNA or protein expression levels between the overcircRNA_ 0079201+ miR-140-3p mimic group and normal control group. Like SMAD2, IHH expression did not also demonstrate significant difference between the overcircRNA_ 0079201+ miR-140-3p mimic group and normal control group. This indicated hsa_circRNA_0079201 significantly increases SMAD2 expression and decreased IHH expression by suppressing miR-140-3p. The data are presented as the mean ± SD. n=3. *** P

    Journal: International Journal of Molecular Medicine

    Article Title: Hsa_circularRNA_0079201 suppresses chondrocyte proliferation and endochondral ossification by regulating the microRNA-140-3p/SMAD2 signaling pathway in idiopathic short stature

    doi: 10.3892/ijmm.2020.4737

    Figure Lengend Snippet: hsa_circRNA_0079201 significantly increases SMAD2 expression by suppressing miR-140-3p. SMAD2 (A) mRNA and (B) protein expression level was increased compared with that in the control group following overcircRNA_0079201. The expression of IHH, a SMAD2 target gene, was decreased compared with that in the control group following overcircRNA_0079201. (C and D) Though SMAD2 showed upregulation in the overcircRNA_0079201 group compared with the normal control group, no significant difference was observed in the SMAD2 mRNA or protein expression levels between the overcircRNA_ 0079201+ miR-140-3p mimic group and normal control group. Like SMAD2, IHH expression did not also demonstrate significant difference between the overcircRNA_ 0079201+ miR-140-3p mimic group and normal control group. This indicated hsa_circRNA_0079201 significantly increases SMAD2 expression and decreased IHH expression by suppressing miR-140-3p. The data are presented as the mean ± SD. n=3. *** P

    Article Snippet: The RT-qPCR protocol used for circRNA-0079201 (TB Green® Premix Ex Taq™ II; Takara Bio, Inc.) was as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, and 60°C for 34 sec. GAPDH was used as the internal control.

    Techniques: Expressing

    miR-140-3p is a hsa_circRNA_0079201 target gene. (A) miR-140-3p expression was significantly reduced after hsa_circRNA_0079201 was over-expressed in human chondrocytes. (B) The potential target binding sites between miR-140-3p and cirRNA-0079201. (C) Luciferase activity was repressed in human chondrocyte co-transfected with WT hsa_circRNA_0079201 and miR-140-3p mimics, while it was restored in cells co-transfected with Mut hsa_circRNA_0079201 and miR-140-3p mimics. (D) The co-localization of circRNA_0079201 and miR-140-3p in the human chondrocyte and neonatal femur growth plate of C57 mice was further validated using in situ hybridization. The data are presented as the mean ± SD. n=3. ** P

    Journal: International Journal of Molecular Medicine

    Article Title: Hsa_circularRNA_0079201 suppresses chondrocyte proliferation and endochondral ossification by regulating the microRNA-140-3p/SMAD2 signaling pathway in idiopathic short stature

    doi: 10.3892/ijmm.2020.4737

    Figure Lengend Snippet: miR-140-3p is a hsa_circRNA_0079201 target gene. (A) miR-140-3p expression was significantly reduced after hsa_circRNA_0079201 was over-expressed in human chondrocytes. (B) The potential target binding sites between miR-140-3p and cirRNA-0079201. (C) Luciferase activity was repressed in human chondrocyte co-transfected with WT hsa_circRNA_0079201 and miR-140-3p mimics, while it was restored in cells co-transfected with Mut hsa_circRNA_0079201 and miR-140-3p mimics. (D) The co-localization of circRNA_0079201 and miR-140-3p in the human chondrocyte and neonatal femur growth plate of C57 mice was further validated using in situ hybridization. The data are presented as the mean ± SD. n=3. ** P

    Article Snippet: The RT-qPCR protocol used for circRNA-0079201 (TB Green® Premix Ex Taq™ II; Takara Bio, Inc.) was as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, and 60°C for 34 sec. GAPDH was used as the internal control.

    Techniques: Expressing, Binding Assay, Luciferase, Activity Assay, Transfection, Mouse Assay, In Situ Hybridization

    OvercircRNA_0079201 expression significantly decreases human chondrocyte proliferation and causes cell cycle arrest. (A) OvercircRNA_0079201 was confirmed in patients with ISS and normal controls using RT-qPCR. (B) hsa_circRNA_0079201 mRNA expression level was not significantly different between samples treated with RNase R from the patients with ISS and the normal controls. (C) Linear IQCE was significantly decreased following RNase R treatment. (D) hsa_circRNA_0079201 mRNA expression level was significantly increased following transfection with overcircRNA_ 0079201. (E) The CCK-8 and (F) EdU assays showed that overcircRNA_0079201 significantly suppressed human chondrocyte proliferation. (G) Flow cytometry analysis revealed that the cells transfected with overcircRNA_ 0079201 were arrested in the G0/G1 phase. The data are presented as the mean ± SD. n=3. ** P

    Journal: International Journal of Molecular Medicine

    Article Title: Hsa_circularRNA_0079201 suppresses chondrocyte proliferation and endochondral ossification by regulating the microRNA-140-3p/SMAD2 signaling pathway in idiopathic short stature

    doi: 10.3892/ijmm.2020.4737

    Figure Lengend Snippet: OvercircRNA_0079201 expression significantly decreases human chondrocyte proliferation and causes cell cycle arrest. (A) OvercircRNA_0079201 was confirmed in patients with ISS and normal controls using RT-qPCR. (B) hsa_circRNA_0079201 mRNA expression level was not significantly different between samples treated with RNase R from the patients with ISS and the normal controls. (C) Linear IQCE was significantly decreased following RNase R treatment. (D) hsa_circRNA_0079201 mRNA expression level was significantly increased following transfection with overcircRNA_ 0079201. (E) The CCK-8 and (F) EdU assays showed that overcircRNA_0079201 significantly suppressed human chondrocyte proliferation. (G) Flow cytometry analysis revealed that the cells transfected with overcircRNA_ 0079201 were arrested in the G0/G1 phase. The data are presented as the mean ± SD. n=3. ** P

    Article Snippet: The RT-qPCR protocol used for circRNA-0079201 (TB Green® Premix Ex Taq™ II; Takara Bio, Inc.) was as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, and 60°C for 34 sec. GAPDH was used as the internal control.

    Techniques: Expressing, Quantitative RT-PCR, Transfection, CCK-8 Assay, Flow Cytometry

    OvercircRNA-0079201 inhibits chondrocyte hypertrophy and endochondral ossification. (A) The protein and mRNA expression level of RUNX2 and COL10A1 was decreased in cells transfected with over-circRNA-0079201, detected using western blot analysis and RT-qPCR, respectively. (B) Von Kossa staining showed the reduced mineralization in cells transfected with overcircRNA-0079201. The positive spots are indictaed using a red arrow. (C) ALP staining revealed that ALP activity was reduced in cells transfected with overcircRNA-0079201. The positive spots are indicated using a red arrow. The data are presented as the mean ± SD. n=3. *** P

    Journal: International Journal of Molecular Medicine

    Article Title: Hsa_circularRNA_0079201 suppresses chondrocyte proliferation and endochondral ossification by regulating the microRNA-140-3p/SMAD2 signaling pathway in idiopathic short stature

    doi: 10.3892/ijmm.2020.4737

    Figure Lengend Snippet: OvercircRNA-0079201 inhibits chondrocyte hypertrophy and endochondral ossification. (A) The protein and mRNA expression level of RUNX2 and COL10A1 was decreased in cells transfected with over-circRNA-0079201, detected using western blot analysis and RT-qPCR, respectively. (B) Von Kossa staining showed the reduced mineralization in cells transfected with overcircRNA-0079201. The positive spots are indictaed using a red arrow. (C) ALP staining revealed that ALP activity was reduced in cells transfected with overcircRNA-0079201. The positive spots are indicated using a red arrow. The data are presented as the mean ± SD. n=3. *** P

    Article Snippet: The RT-qPCR protocol used for circRNA-0079201 (TB Green® Premix Ex Taq™ II; Takara Bio, Inc.) was as follows: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, and 60°C for 34 sec. GAPDH was used as the internal control.

    Techniques: Expressing, Transfection, Western Blot, Quantitative RT-PCR, Staining, Activity Assay

    KIF18A expression was effectively blocked in both A549 and H1975 human lung adenocarcinoma cells caused by its shRNA plasmids. (a) Quantitative PCR assays revealed the dramatically reduced expression levels of KIF18A caused by its shRNA in both A549 and H1975 cells, respectively. (b) Immunoblot assays confirmed the efficient silencing of KIF18A caused by its shRNA plasmids in A549 and H1975 cells. Results are presented as the mean ± SD; ∗ P

    Journal: Disease Markers

    Article Title: Kinesin Family Member 18A (KIF18A) Contributes to the Proliferation, Migration, and Invasion of Lung Adenocarcinoma Cells In Vitro and In Vivo

    doi: 10.1155/2019/6383685

    Figure Lengend Snippet: KIF18A expression was effectively blocked in both A549 and H1975 human lung adenocarcinoma cells caused by its shRNA plasmids. (a) Quantitative PCR assays revealed the dramatically reduced expression levels of KIF18A caused by its shRNA in both A549 and H1975 cells, respectively. (b) Immunoblot assays confirmed the efficient silencing of KIF18A caused by its shRNA plasmids in A549 and H1975 cells. Results are presented as the mean ± SD; ∗ P

    Article Snippet: Quantitative PCR was performed using SYBR Ex Taq kit (#638319, Takara, Japan), and the expression levels of KIF18A were normalized to the expression of GAPDH.

    Techniques: Expressing, shRNA, Real-time Polymerase Chain Reaction

    AK4 expression levels were markedly decreased in both MCF7 and MDA-MB-231 cells caused by its shRNA transfection. (a) Quantitative PCR assays showed the dramatically reduced expression levels of AK4 after the transfection of its shRNA in MCF7 and MDA-MB-231 cells, respectively. (b) Immunoblot assays showed the efficient decrease of AK4 expression caused by the transfection of its shRNA plasmids in both MCF7 and MDA-MB-231 cells. Results are presented as mean ± SD, ∗ P

    Journal: Disease Markers

    Article Title: AK4 Promotes the Progression of HER2-Positive Breast Cancer by Facilitating Cell Proliferation and Invasion

    doi: 10.1155/2019/8186091

    Figure Lengend Snippet: AK4 expression levels were markedly decreased in both MCF7 and MDA-MB-231 cells caused by its shRNA transfection. (a) Quantitative PCR assays showed the dramatically reduced expression levels of AK4 after the transfection of its shRNA in MCF7 and MDA-MB-231 cells, respectively. (b) Immunoblot assays showed the efficient decrease of AK4 expression caused by the transfection of its shRNA plasmids in both MCF7 and MDA-MB-231 cells. Results are presented as mean ± SD, ∗ P

    Article Snippet: Quantitative PCR was performed using the SYBR Ex Taq kit (638319, Takara, Japan), and the expression levels of AK4 were normalized to the expression of β -actin.

    Techniques: Expressing, Multiple Displacement Amplification, shRNA, Transfection, Real-time Polymerase Chain Reaction

    Specificity of qPCR-ML (A) and qPCR-ama (B). The qPCR amplicons were run on a 2% agarose gel. Both qPCR assays were performed using three different PCR master mix: SYBR green PCR master mix, Diatheva (I); RT2 SYBR Green ROX FAST Mastermix, Qiagen (II); TB Green premix ex Taq II Mastermix, Takara Bio (III). For each master mix, DNA from L. ( L. ) infantum (0,006 ng/μl) , L. ( L. ) amazonensis (0,15 ng/μl) , Trypanosoma cruzi (0,1 ng/μl) and human DNA (30 ng/μl) were tested with the condition described in the manuscript. As negative control, a no template control was used for each qPCR run. M: ΦX174 DNA/ Bsu RI ( Hae III) Marker, 9 (ThermoFisher Scientific); NTC: no template control.

    Journal: Data in Brief

    Article Title: Data on the differentiation among Leishmania (Viannia) spp., Leishmania (Leishmania) infantum and Leishmania (Leishmania) amazonensis in Brazilian clinical samples using real-time PCR

    doi: 10.1016/j.dib.2019.104914

    Figure Lengend Snippet: Specificity of qPCR-ML (A) and qPCR-ama (B). The qPCR amplicons were run on a 2% agarose gel. Both qPCR assays were performed using three different PCR master mix: SYBR green PCR master mix, Diatheva (I); RT2 SYBR Green ROX FAST Mastermix, Qiagen (II); TB Green premix ex Taq II Mastermix, Takara Bio (III). For each master mix, DNA from L. ( L. ) infantum (0,006 ng/μl) , L. ( L. ) amazonensis (0,15 ng/μl) , Trypanosoma cruzi (0,1 ng/μl) and human DNA (30 ng/μl) were tested with the condition described in the manuscript. As negative control, a no template control was used for each qPCR run. M: ΦX174 DNA/ Bsu RI ( Hae III) Marker, 9 (ThermoFisher Scientific); NTC: no template control.

    Article Snippet: Three different PCR master mix were tested: SYBR green PCR master mix (Diatheva srl, Fano, Italy), RT2 SYBR Green ROX FAST Mastermix (Qiagen, Hilden, Germany), TB Green premix ex Taq II Mastermix (Takara Bio Europe, France).

    Techniques: Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Polymerase Chain Reaction, SYBR Green Assay, Negative Control, Marker